ID: 1192436458

View in Genome Browser
Species Human (GRCh38)
Location X:71146269-71146291
Sequence CTGGCTGAAGGGGTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 1, 1: 1, 2: 10, 3: 115, 4: 1130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192436458_1192436468 -7 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436468 X:71146285-71146307 CAGCCAGTTCTTAAAGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 216
1192436458_1192436477 25 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436477 X:71146317-71146339 TGGGAAGGCGGGAGAAATGGAGG 0: 1
1: 0
2: 3
3: 71
4: 864
1192436458_1192436470 5 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436470 X:71146297-71146319 AAAGGAGCAGGCCTGCAATCTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1192436458_1192436471 6 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436471 X:71146298-71146320 AAGGAGCAGGCCTGCAATCTGGG 0: 1
1: 0
2: 1
3: 18
4: 192
1192436458_1192436472 10 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436472 X:71146302-71146324 AGCAGGCCTGCAATCTGGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 213
1192436458_1192436474 14 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436474 X:71146306-71146328 GGCCTGCAATCTGGGAAGGCGGG 0: 1
1: 0
2: 3
3: 18
4: 257
1192436458_1192436476 22 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436476 X:71146314-71146336 ATCTGGGAAGGCGGGAGAAATGG 0: 1
1: 0
2: 1
3: 42
4: 378
1192436458_1192436473 13 Left 1192436458 X:71146269-71146291 CCCTCCCCCACCCCTTCAGCCAG 0: 1
1: 1
2: 10
3: 115
4: 1130
Right 1192436473 X:71146305-71146327 AGGCCTGCAATCTGGGAAGGCGG 0: 1
1: 0
2: 1
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192436458 Original CRISPR CTGGCTGAAGGGGTGGGGGA GGG (reversed) Intronic
900184256 1:1325573-1325595 CGGGCTTCAGGTGTGGGGGATGG - Intronic
900216840 1:1486246-1486268 CTGGCTGAACAGGTGGGCCAGGG + Intronic
900223921 1:1523975-1523997 CTGGCTGAACAGGTGGGCCAGGG + Intronic
900290887 1:1923142-1923164 CTGGCTGGAGGGGTGTGGCCAGG + Intronic
900311074 1:2033395-2033417 CTCGCTGGAGGGGAGGGGCAGGG - Intergenic
900361570 1:2291600-2291622 GAGACTGAGGGGGTGGGGGAGGG - Intronic
900412791 1:2520507-2520529 CTGGCGGTTGGGGTGGGGGCGGG - Intronic
900463001 1:2810246-2810268 CTGGCTGCGGGGGGGGGGGGGGG + Intergenic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900492510 1:2959348-2959370 CTGGCTGAGAGGTTTGGGGATGG + Intergenic
900494419 1:2969998-2970020 CTGGCTGAGGGTGTCAGGGAGGG + Intergenic
900556484 1:3283388-3283410 CTGGCTGCAGGAGGGAGGGAGGG - Intronic
900578084 1:3394112-3394134 TTGGGGGAAGAGGTGGGGGAAGG + Intronic
900830116 1:4959864-4959886 CAGACAGAAGGGGAGGGGGAAGG + Intergenic
901058301 1:6459921-6459943 CTGGCAGAAAGGGTGGGGCCAGG - Intronic
901182268 1:7349952-7349974 CTGGCAGAAGGGAAGAGGGATGG + Intronic
901364915 1:8738542-8738564 CTGCCTTGAGGGGTGGGGAATGG - Intronic
901458294 1:9376528-9376550 CACGCTCAAGGGGTTGGGGACGG - Intergenic
901498922 1:9639525-9639547 CAGACTGAAGGGTTGGGGGCAGG + Intergenic
901794624 1:11673212-11673234 CTGGCCCCAGGGGTGGGGGCAGG - Intronic
901839351 1:11944351-11944373 CCAGCAGCAGGGGTGGGGGAAGG - Intronic
901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG + Intronic
901925840 1:12565498-12565520 CTGGCTGAGAGGGAGGGGGTGGG + Intergenic
902074808 1:13775856-13775878 GTGGGTGAAGGGATGGGGGAAGG - Intronic
902227156 1:15003672-15003694 TTGGGAAAAGGGGTGGGGGACGG + Intronic
902359296 1:15933530-15933552 CTGGCTGGGGAGGTGGGGGAAGG - Exonic
902385050 1:16071737-16071759 CTGGCAGAGGGGGCGGTGGAGGG + Intronic
902432354 1:16373089-16373111 CTGGCTGAAGGGGAGAGGGTTGG + Intronic
902536554 1:17122208-17122230 CTTGCTGGAGGGGTGGGTGCGGG - Intergenic
902555139 1:17242495-17242517 CTGGCTGAAGGTGGCGGGGAGGG + Intronic
902693784 1:18126839-18126861 CTGGTGGTAGGGGTGGAGGATGG - Intronic
902836992 1:19053858-19053880 GTGGCAGAAGGGGTGTGTGAAGG - Intergenic
903005430 1:20295086-20295108 CTAGATAAAGGGGTGGGGAAAGG + Intronic
903150735 1:21406223-21406245 AGGGCTGAGGGGGTGGGGAATGG - Intergenic
903274643 1:22212827-22212849 CGGGCAGAACGGGTGGGGCAAGG - Intergenic
903435158 1:23343985-23344007 CGGGCTAAAGGGGCGGGGGGAGG + Intronic
903538686 1:24084286-24084308 ATGGCGGAAGGCGAGGGGGAAGG - Intronic
903572860 1:24319238-24319260 CTTGGTGAGGGGGTGGGGGGTGG - Intergenic
903968876 1:27106328-27106350 GTGGCTGGAGGGCTGGGGGCAGG + Intronic
904043627 1:27598112-27598134 CTGGCTCAGGGGGTGGGGAGGGG + Intronic
904064925 1:27742071-27742093 CTTACTGATGGGTTGGGGGATGG + Intronic
904082143 1:27879098-27879120 CTGGCGGAATGGGTGGGGGCTGG + Intronic
904423586 1:30409509-30409531 CTGGCTGATGGAGCAGGGGAAGG + Intergenic
904442380 1:30540113-30540135 CAGCCTGAGGGGGTGGGGAATGG + Intergenic
904604469 1:31691291-31691313 CTGGCTGGAGGAGAGGGTGAGGG - Intronic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
904699675 1:32351160-32351182 CTAGCTAGAGGCGTGGGGGAGGG - Intergenic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
905033169 1:34900991-34901013 CTGGCTGAGGACCTGGGGGAGGG + Intronic
905038235 1:34930566-34930588 GGGGCTGAAGACGTGGGGGAAGG + Intergenic
905323973 1:37137362-37137384 CTGGCTCAGGGGGTGGAGGTGGG + Intergenic
905335248 1:37240494-37240516 CTGGCTGCTTGGGTGGGGGCTGG - Intergenic
905755465 1:40505621-40505643 ATGTGTGAAGGGGTTGGGGAGGG + Intergenic
905774541 1:40660149-40660171 CTGGTTATAGGGGTGTGGGACGG + Intronic
905855520 1:41309082-41309104 ATGGCGGAAGGGGAAGGGGAAGG - Intergenic
905906049 1:41619138-41619160 GTGGCTGGAGGAGTGGGGGTGGG - Intronic
905916824 1:41690307-41690329 CTGGCTCAAGGGGCAGGGGATGG + Intronic
906143771 1:43548318-43548340 CTGGCTGGAGGGGTGGGTGGCGG + Intronic
906173168 1:43745275-43745297 CTTGCATAAGGGATGGGGGATGG + Intronic
906475439 1:46166611-46166633 CCGGAAGGAGGGGTGGGGGAAGG - Intronic
906476226 1:46171385-46171407 CTGGCTGAATGGGTAGGTGTGGG + Intronic
906795776 1:48695553-48695575 CTGGTTAAAGGGGAGGGGGTGGG - Intronic
906932013 1:50179160-50179182 GTGGGTGAGGGGGTGGGGAAAGG - Intronic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
907425115 1:54374667-54374689 CTGCCAGGTGGGGTGGGGGATGG - Intronic
907469654 1:54665047-54665069 GTGGCTGCTGGGGTGGGGTAAGG + Intronic
907945982 1:59137137-59137159 GTGGCTCAAGGGCTGGGGGCTGG + Intergenic
908089871 1:60674754-60674776 TTGGCTGAAAGGGTGGGAGAGGG - Intergenic
908090122 1:60677082-60677104 TTGGCTGAAAGGGTGGGAGAGGG - Intergenic
908117662 1:60956097-60956119 CTGGCTGAAGCTGTGTAGGAAGG + Intronic
908312651 1:62900851-62900873 CATGCTGAAGGGGTGGAAGAAGG + Intergenic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
908857889 1:68450024-68450046 TCAGCTGAAGGGGTGGGGAAGGG - Intergenic
908961178 1:69698583-69698605 CTGGTTGCAGGGGTGAGGAAGGG - Intronic
909477354 1:76095744-76095766 CTGGGGGAAGGAGTGTGGGAGGG + Intronic
909643254 1:77889190-77889212 CTGGGGCAAGTGGTGGGGGACGG - Intronic
909698795 1:78496885-78496907 AAAGCTGATGGGGTGGGGGAGGG - Intronic
910795417 1:91092728-91092750 GAGGAGGAAGGGGTGGGGGAGGG - Intergenic
910866439 1:91792381-91792403 CTGGCTGTAGGGGTGGAGTGGGG - Intronic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
911630518 1:100178820-100178842 ATGGTGGAAGGGGTGGGGGATGG - Intergenic
911900930 1:103502933-103502955 CTGGCTGAAGGGAGTTGGGAGGG - Intergenic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
912468532 1:109890738-109890760 CAGGCTCCAGGAGTGGGGGAAGG - Intergenic
912551894 1:110490104-110490126 CTGACTGAAGGGGTTCCGGAAGG - Intergenic
912629730 1:111236183-111236205 CTGGCTGTGGGGGTGGGGCTGGG + Intronic
912673074 1:111649363-111649385 CTGGCTGCAGGGATGGCCGAGGG - Intronic
913219918 1:116651039-116651061 CTGTCTGAAGGGTTGTGGGCTGG - Intronic
913370712 1:118095919-118095941 CTAGATGAAGGGGTGGGGAGGGG + Intronic
913452466 1:119001384-119001406 CAGGCTGAGGGGGCAGGGGAGGG + Intergenic
914802459 1:150971566-150971588 CTGGCTGAGGTGGAGGGGGCAGG - Intronic
915472782 1:156135882-156135904 CCAGCTGAAGGGGGGTGGGAGGG - Exonic
915510031 1:156381827-156381849 CTGGCTGGAGGGGTTGTGGTGGG + Exonic
915512238 1:156392673-156392695 GCGGCTGGAGAGGTGGGGGAAGG + Intergenic
915556803 1:156665244-156665266 CTGATTGGAGGGGTGGGGGAGGG + Intergenic
915571225 1:156746364-156746386 CTGGCTGAAGTGGAGGGGTGAGG + Intronic
915597681 1:156904771-156904793 CAGGCTGAAGGGGCGGGAGTGGG - Exonic
915945093 1:160143958-160143980 CTATCTGATGGGATGGGGGAAGG + Intergenic
915974350 1:160375193-160375215 GTGGGTGGTGGGGTGGGGGAGGG + Intergenic
916346509 1:163797769-163797791 CTGGCAGGAGGTGTGGGGGGTGG - Intergenic
916693669 1:167215925-167215947 CTGGCTGAAGGGGACGTAGAGGG + Intergenic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916741493 1:167650585-167650607 TTGGCTGAAGGGATGGGCGGCGG - Intronic
917018753 1:170563192-170563214 CTAGCTGCCGGGATGGGGGAGGG + Intergenic
917221451 1:172733332-172733354 CTGGCAGTGGTGGTGGGGGAGGG + Intergenic
917465005 1:175268279-175268301 CTGTGTGTAGGGGTGGGGGGAGG + Intergenic
917642735 1:176998528-176998550 CTGGGTGGAGAGGTGGGGGTGGG + Intronic
917822840 1:178782674-178782696 CCTGCTGATGTGGTGGGGGAAGG - Intronic
917969804 1:180199257-180199279 CTGGCAGACTGGGTGGGGGAGGG - Exonic
918043200 1:180925746-180925768 GTGGCTGGAGGGGTGGGGGAAGG + Intronic
918315137 1:183316938-183316960 CTAGCTGAGGGCATGGGGGATGG - Intronic
919786596 1:201262109-201262131 CCGGGGGAAGGGGTGGTGGAGGG + Intergenic
919935184 1:202246240-202246262 ATGGATGGAGGGATGGGGGATGG - Intronic
919975141 1:202605559-202605581 GTGGCTGAGAGGGTGGGGCAAGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920043973 1:203121649-203121671 CTGGTTGGGGGGATGGGGGATGG - Intronic
920298964 1:204976830-204976852 CTGGCTGCTGGGGAGGGGGTGGG - Intronic
920342607 1:205284882-205284904 CAGGCTGGAGGGGTGGGGAGGGG - Intergenic
920366621 1:205451288-205451310 CTGGTGGTAGGTGTGGGGGATGG - Intronic
920561286 1:206940442-206940464 CAGGCTGAAGGGGTGGAGCTTGG + Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920978532 1:210809162-210809184 TTGGCTGGGGAGGTGGGGGAGGG + Intronic
921281963 1:213576056-213576078 CTTGCTGAAGGGTTGGGTGGAGG + Intergenic
921347653 1:214203534-214203556 TTGCCTGAAAGGGTGGGAGAGGG - Intergenic
922336983 1:224625696-224625718 GTGGTTGAAGGTGTGGAGGAGGG + Intronic
922530747 1:226343041-226343063 CTGGATGCGGGGGTGGGGGGGGG + Intergenic
922613466 1:226946420-226946442 CTGGCTGAAGCGTTGGGGCACGG + Intronic
923170353 1:231410843-231410865 CTGGTCTAAGGGGTGGGGGGCGG + Intronic
923903074 1:238350550-238350572 CTGACTGAAGGGATTGGGGAAGG - Intergenic
924770837 1:247078396-247078418 CTGGCCGAAGCGGCGGGGCAGGG + Intronic
924948411 1:248861428-248861450 CTGGGTGGTGGGCTGGGGGATGG - Intergenic
1063089332 10:2848430-2848452 GGGGGTGGAGGGGTGGGGGAAGG - Intergenic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1064066334 10:12185224-12185246 CTGGGGGAAGGGGTGGGGCATGG + Intronic
1064110995 10:12538818-12538840 TTATCTGAAGTGGTGGGGGAGGG + Intronic
1065661485 10:28007908-28007930 TAGGCTGTTGGGGTGGGGGAAGG - Intergenic
1065811947 10:29450637-29450659 CTGGCTGGAGGTGGGAGGGAGGG - Intergenic
1065959832 10:30725520-30725542 CTGGCTGGAGGTGGGAGGGAGGG + Intergenic
1066182637 10:32978433-32978455 TTGGGTGGAGGGCTGGGGGAGGG - Intronic
1067429613 10:46234422-46234444 CTGGCTCAAGGGGTGGGGCCAGG + Intergenic
1067698435 10:48551963-48551985 CTGGCTGAAAGGCTGGGGGTGGG + Intronic
1068317393 10:55364166-55364188 ATGGCAGAAGGGGAAGGGGAAGG - Intronic
1068607417 10:59021227-59021249 GTGACTGAATGGGTTGGGGAAGG - Intergenic
1069184079 10:65400478-65400500 GTGTCTGGAGTGGTGGGGGAAGG - Intergenic
1069285139 10:66704608-66704630 ATAGCTGAAGGGGTCTGGGAGGG + Intronic
1069349565 10:67509332-67509354 GTGGGTGGAGGGCTGGGGGAGGG - Intronic
1069455882 10:68553405-68553427 AAGGCAGAGGGGGTGGGGGAGGG + Intergenic
1069530443 10:69214814-69214836 CTCACTGAAGGGGAAGGGGAGGG - Intergenic
1069827365 10:71262371-71262393 CTGGCTGGGGGGATGGGGCAGGG + Intronic
1069861823 10:71476231-71476253 CTGCATGAAGGGGTGGGGACGGG - Intronic
1070048380 10:72862356-72862378 CTGGTGGAAGGAGTGGTGGAAGG - Intronic
1070051004 10:72889746-72889768 GTGGCTGCCGGGGTGAGGGAGGG + Intergenic
1070770024 10:79076939-79076961 CTGGCTGGAGGGGAGAGGGGAGG - Intronic
1070896067 10:79983575-79983597 GGGGCTGCAGGCGTGGGGGAGGG - Intergenic
1071201317 10:83222627-83222649 GTGGCTGTTGGGGTGGGGGTGGG + Intergenic
1071563506 10:86660087-86660109 GAGGCTGAAGGTGTGGGGGCAGG + Intronic
1071621827 10:87127530-87127552 GTGGCAGACGGGGTGGGGGGGGG - Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1071945991 10:90645560-90645582 GTGGGTGAGGGGCTGGGGGAGGG - Intergenic
1072270319 10:93770053-93770075 ATGGCTGAATGGTTGGGGGAAGG - Intronic
1072678822 10:97490908-97490930 CAGACTGTAAGGGTGGGGGAAGG + Intronic
1073121438 10:101124671-101124693 GTGGCTGAAGAGGTGGAGGTGGG - Intronic
1073152405 10:101321092-101321114 CTGACTGAGGGGCTGGGAGAAGG + Intergenic
1073329680 10:102661891-102661913 CAGGCTGCAGAGGTGGGGTAGGG - Intergenic
1073492017 10:103859000-103859022 CTGGATGATGGGGGTGGGGAGGG - Intergenic
1074531251 10:114300390-114300412 CTGGCTGAAGGGGCGCAGGAAGG + Intronic
1074611391 10:115025442-115025464 CTGGCTGCAGGGGTGGGGGTTGG - Intergenic
1074626330 10:115191743-115191765 ATGGCGGAAGGGGAAGGGGAAGG - Intronic
1074783189 10:116817096-116817118 CTGCATGGTGGGGTGGGGGAAGG - Intergenic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1075483661 10:122802513-122802535 TTGGTTGCAGGGGTGGGGGGTGG + Intergenic
1075595921 10:123729020-123729042 CTGGCTGACTGGGTGGGGTAGGG - Intronic
1075730191 10:124631302-124631324 GAGGCTGAAGGAGTGGGGGAAGG + Intronic
1076360310 10:129883741-129883763 GTGGTTGCTGGGGTGGGGGAGGG + Intronic
1076398236 10:130157342-130157364 GGGGCAGGAGGGGTGGGGGATGG + Intronic
1076408100 10:130226727-130226749 CAGGCTGAATGGCTGGGGCAGGG + Intergenic
1076502157 10:130945685-130945707 CTCCCTGGAGGGGTGGGGGTGGG + Intergenic
1076802277 10:132836113-132836135 AGGGCTGCAGGGGAGGGGGAGGG - Intronic
1077007982 11:368163-368185 GGAGCTGATGGGGTGGGGGAAGG + Intergenic
1077028429 11:452001-452023 CAGCCTGAAGGGGTGTGGCAGGG - Intronic
1077063838 11:629732-629754 GGAGCTGAAGGGATGGGGGAAGG - Intergenic
1077080617 11:723034-723056 GTGGCTGAAGGGGCGGTGGGTGG - Intronic
1077118884 11:897783-897805 CTGGCTGAGGGAGTGGGGTCTGG + Intronic
1077140420 11:1021889-1021911 CTGGCCCAAGTGGTGGAGGAGGG - Intronic
1077357881 11:2127086-2127108 GTGGCTGGATGGGTAGGGGATGG + Intergenic
1077426990 11:2485359-2485381 CAGGGTGGGGGGGTGGGGGATGG - Intronic
1077552023 11:3204665-3204687 CTGGCAGAGGGGGTGGGGGCCGG - Intergenic
1077721663 11:4636512-4636534 CTGGATAACAGGGTGGGGGATGG - Intergenic
1078016198 11:7617245-7617267 CTGGCTGCAGGGCTGGGGCTCGG - Intronic
1078430088 11:11281769-11281791 CTGCCTGAAGGGATGTGGGAAGG + Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079158325 11:17969524-17969546 GTGGGTGGAGGGGTGAGGGAGGG + Intronic
1079317665 11:19422806-19422828 ATGGCAGAAGGGGAGAGGGATGG - Intronic
1079353917 11:19714594-19714616 CTGGCTGTTGCGGTGGGGGTGGG + Intronic
1079504074 11:21133733-21133755 CTTGGTGGGGGGGTGGGGGATGG + Intronic
1079763081 11:24355720-24355742 CTGTCTGAACTGGTGGGTGAGGG + Intergenic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080758779 11:35227571-35227593 CTTGATGAGGGGTTGGGGGAAGG - Intronic
1081454400 11:43206940-43206962 CTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1081540914 11:44033959-44033981 TTGGCAGAAGGGATGGGGGTGGG + Intergenic
1081613916 11:44579358-44579380 CTGGCTCCAGGGGTGGGTGTGGG + Intronic
1081806217 11:45892228-45892250 CTGGCTGAAACGGTGGGGTGGGG - Intronic
1081811603 11:45917429-45917451 CGGGCTCTGGGGGTGGGGGATGG - Intronic
1082007073 11:47425339-47425361 CTGGATGAATGGATGCGGGAGGG - Intronic
1082785259 11:57313177-57313199 CTGGCTTCAGTGATGGGGGAGGG + Exonic
1082928829 11:58578956-58578978 CTGAAGGAAGGGGTGGGGGAGGG + Intergenic
1083150232 11:60787203-60787225 CTGGCTGAGGGGGCTGGGGTTGG + Intronic
1083308449 11:61772584-61772606 CTGGCTGCTGGGGTGGCTGAAGG + Intronic
1083713953 11:64565157-64565179 CTGGCACAGGGGGTGGGGCAGGG + Intronic
1083886765 11:65576876-65576898 CTGGCTGAAGAGGCGGGAGTTGG - Intronic
1084431442 11:69113673-69113695 CTGAGTGAAGGTGTGGGGAAAGG - Intergenic
1084461447 11:69298787-69298809 CTGGCTGTAGGGCTGCGGGCCGG - Intronic
1084546972 11:69819435-69819457 CTGGGGGAGGGGGCGGGGGAGGG - Intergenic
1084726930 11:70947976-70947998 CTAGCTGCAGAGGTGGGGGTGGG - Intronic
1084971176 11:72772887-72772909 CTGGCAGCATGGTTGGGGGACGG - Intronic
1085403065 11:76246018-76246040 CTGGCTGAGGGGGTGAGAGGGGG + Intergenic
1085496182 11:76971898-76971920 CCAGATGAAGGGGTGGGGGGTGG + Intronic
1085508704 11:77074500-77074522 CTGGCTGATGAGGAGGGGGCTGG - Intronic
1086135602 11:83441218-83441240 ATGGCGGAAGGGGAAGGGGAAGG + Intergenic
1086412320 11:86554985-86555007 CAGCCTGAGGGGATGGGGGAGGG + Intronic
1086932014 11:92704213-92704235 TTAGCTGAGGGGGTGGTGGATGG - Intronic
1087768172 11:102179042-102179064 CTGGGTCACGGGGTGGGGGGTGG - Intronic
1088504071 11:110512234-110512256 CAGGGTGAGTGGGTGGGGGATGG + Intergenic
1088595647 11:111438446-111438468 CTAACTGAAGGGGTCGAGGAAGG - Intronic
1088625022 11:111723832-111723854 CTGGCTGTCGTGGTGGTGGAGGG - Exonic
1088864161 11:113830866-113830888 CTGACTGAAGGGGTTCGTGAAGG - Exonic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089319286 11:117613950-117613972 CTGGCTGCTGGGGTGGGGCAGGG + Intronic
1089401826 11:118168783-118168805 CTGGCTGAAAGGGCTGGGGAGGG + Intronic
1089579486 11:119472533-119472555 CTGGGTGAAGGCGCAGGGGAAGG + Intergenic
1089581915 11:119486790-119486812 CTGGCTGACGGGGCCAGGGAGGG - Intergenic
1090031337 11:123209184-123209206 GTGGGAGAAGGGTTGGGGGAGGG + Intergenic
1090053504 11:123401651-123401673 GTGGTGGCAGGGGTGGGGGAAGG + Intergenic
1090064483 11:123491456-123491478 CTGGGGGAAGGGGAGGGGCAGGG - Intergenic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090431872 11:126653034-126653056 CGGGTTGTGGGGGTGGGGGAGGG + Intronic
1090809305 11:130222628-130222650 CTGGCTGGAGGGGTGAGGGAAGG - Intergenic
1090836159 11:130455612-130455634 CAGGCTGCAGGGTTGGGAGAGGG + Intronic
1091057493 11:132432507-132432529 CTGGCTGAATGGCTTTGGGAAGG - Intronic
1091260317 11:134228871-134228893 CTGGCTGACGGGGTGGCATATGG + Intronic
1091553878 12:1557470-1557492 ATGGCAGAAGGGGTGGAAGAGGG + Intronic
1091658934 12:2367119-2367141 CTGACTGAAGGGATGGGGGCAGG + Intronic
1092007069 12:5078705-5078727 GTGGAAGATGGGGTGGGGGAGGG - Intergenic
1092516896 12:9224303-9224325 CGGGGTGGAGGGATGGGGGAGGG - Intergenic
1093435421 12:19130032-19130054 CTCGCTGCAGGGGTGAGAGAAGG - Exonic
1094017090 12:25876594-25876616 CTATCTGGAAGGGTGGGGGAGGG + Intergenic
1095976192 12:47942496-47942518 CAGGCGGGAGGGGTGTGGGAGGG - Intronic
1095998105 12:48106138-48106160 GTGGCTGAAGAGGAGGGGGCTGG + Intronic
1096249446 12:50019241-50019263 CTGCCTGAAGCAGTAGGGGAAGG - Intronic
1096472369 12:51887866-51887888 CTTGCTGAAGGGGTGGTTGCGGG - Intergenic
1096522349 12:52191494-52191516 CTGGGTGCAGGGGTGGGGCGCGG + Intronic
1096580240 12:52580419-52580441 GTGGCTGGAGGGGAGGTGGAGGG - Intergenic
1097123369 12:56753203-56753225 GAGGCTGAAGGGTTGGGGGCGGG + Intronic
1097152663 12:56991184-56991206 CTGGCTTATGGGGTGGAGGCAGG - Intergenic
1097167434 12:57093304-57093326 CTGGCTGGAGGGGGGGCAGAAGG + Intronic
1097192681 12:57226949-57226971 TGGGATGAGGGGGTGGGGGAAGG + Intergenic
1097244953 12:57602658-57602680 CTGGAAAAAGGGGTGGGAGAAGG - Exonic
1097260335 12:57716266-57716288 CTGACTGGTGGGGTGGGGGGGGG + Intronic
1098123863 12:67269855-67269877 ACGGCCGAAGGGGTGGGGCAAGG - Intronic
1098334554 12:69389516-69389538 CTGTCTTAATGGGTGGGGGTGGG - Intronic
1098618698 12:72563797-72563819 CTGGGGGCGGGGGTGGGGGATGG + Intronic
1098671008 12:73231586-73231608 CTGGCTCAAAGGGTGCGGGGTGG - Intergenic
1098680187 12:73344504-73344526 CAGGGTGAAGGGCTAGGGGAGGG - Intergenic
1098685089 12:73409859-73409881 GGGGGTGAAGGGCTGGGGGAGGG - Intergenic
1100195662 12:92241593-92241615 CTGGCTGAAGGGGAAAGAGAGGG + Intergenic
1100202225 12:92311770-92311792 CTCACTGAAAGGGTTGGGGAAGG - Intergenic
1100329891 12:93572466-93572488 TTGGCTGAAGAGGTGGGGGGCGG - Intronic
1100384306 12:94091553-94091575 CTGAGTGGAGGGGAGGGGGATGG + Intergenic
1101202858 12:102455000-102455022 TTGGCTGGAAGTGTGGGGGAAGG + Intronic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1101404546 12:104416400-104416422 CTGCCTGGAGGAGTGAGGGAAGG + Intergenic
1101743748 12:107522100-107522122 CAGGGTGGTGGGGTGGGGGAAGG + Intronic
1102177606 12:110887526-110887548 CTGGATGAAGGAGTGGCGGTGGG + Intronic
1102426641 12:112849012-112849034 CTGGCAGAAGGGCTTGGGTAGGG - Intronic
1102790442 12:115639856-115639878 CTGGGAGAGGCGGTGGGGGAAGG - Intergenic
1103241094 12:119413967-119413989 CTGGGAGAAGAGGTGAGGGAGGG - Intronic
1103839451 12:123850699-123850721 CTCGCTGAAGGCCTTGGGGAGGG - Intronic
1103917906 12:124385432-124385454 CTGTCTCACGGTGTGGGGGAAGG - Intronic
1103988162 12:124780867-124780889 CAGGGTGCAGGGGTGGGGGCTGG - Intronic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1105259187 13:18766300-18766322 CTGGCTGTAGGGTGGTGGGAAGG - Intergenic
1105261866 13:18785619-18785641 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1105264223 13:18802208-18802230 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1105264683 13:18805317-18805339 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1105458995 13:20566824-20566846 CTGTGTGAAGGGGGCGGGGAGGG - Intergenic
1105681234 13:22729283-22729305 CTGGGGGAAAGGGTGGGAGAGGG + Intergenic
1105780630 13:23702562-23702584 CTGGCAGCAGGGGCGGGGCAGGG - Intergenic
1106119338 13:26845993-26846015 GTGGTTGCAGGGGTTGGGGAAGG - Intergenic
1106410201 13:29506126-29506148 CAGGCTGGAGGGGTGGGCGCAGG - Intergenic
1107011238 13:35673447-35673469 CTGGCAGGAGGGCTGGGTGAGGG - Intergenic
1107394339 13:39999694-39999716 CTTGCTGGAGGGGTGGGGTTTGG + Intergenic
1107399258 13:40053140-40053162 CTGACAGAAGGGGTGGGGGTTGG - Intergenic
1107536094 13:41334369-41334391 CTGGCTGAAGGGTAGAGAGAGGG + Intronic
1107834865 13:44404951-44404973 CTGGCTGGGGGGCTGGGGGGAGG + Intergenic
1108218250 13:48206857-48206879 CGGGGTGGAGGGTTGGGGGAGGG + Intergenic
1108254098 13:48594213-48594235 GGGACTGAATGGGTGGGGGAAGG - Intergenic
1108452677 13:50582989-50583011 CTGGGTGCGGGGGTGGGGGCTGG + Intronic
1108478195 13:50842303-50842325 CTAGCAGAAGGAGTTGGGGAGGG - Intronic
1108688188 13:52838928-52838950 CTGGGAGAGGGGGTTGGGGAAGG + Intergenic
1109469029 13:62779972-62779994 CTGGCTGAAGGGGGAAGGGTTGG + Intergenic
1109677038 13:65690542-65690564 CTAGTTGGTGGGGTGGGGGAAGG - Intergenic
1109770493 13:66965229-66965251 CTGGCTGAAGTGGTTAAGGAAGG - Intronic
1110407012 13:75162184-75162206 ATGCGGGAAGGGGTGGGGGATGG - Intergenic
1112294110 13:98171365-98171387 CATGCTGAATGGGAGGGGGAAGG - Intronic
1112348998 13:98617259-98617281 CTGGCTCTAGGGCTGGGGCAGGG + Intergenic
1112682776 13:101786393-101786415 ATGGTTGGAGGGGTGGAGGACGG + Intronic
1113435709 13:110289449-110289471 CTGCCTGGAGCAGTGGGGGATGG - Intronic
1113574414 13:111383865-111383887 CTGGCTGTGGGGCTGGGAGAAGG + Intergenic
1113677147 13:112215001-112215023 AGGGCTGAAGGGGGGAGGGAGGG + Intergenic
1113677166 13:112215057-112215079 AGGGCTGAAGGGGGGAGGGAGGG + Intergenic
1113677185 13:112215113-112215135 AGGGCTGAAGGGGGGAGGGAGGG + Intergenic
1113677204 13:112215169-112215191 AGGGCTGAAGGGGGGAGGGAGGG + Intergenic
1113677223 13:112215225-112215247 AGGGCTGAAGGGGGGAGGGAGGG + Intergenic
1113767641 13:112890949-112890971 CTGGAGGAGGGGGTGAGGGAGGG + Intergenic
1113909595 13:113835893-113835915 CTTGGTGGAGGGGTGGGGGGCGG + Intronic
1114493460 14:23117535-23117557 CTGGCGGAAGAGGTTGCGGAGGG + Exonic
1115478254 14:33836710-33836732 ATGGCAGAAGGCCTGGGGGATGG - Intergenic
1116492819 14:45526547-45526569 CTGGGAGAAGGGGTGAGTGAAGG + Intergenic
1116947794 14:50852453-50852475 CAGGATGAAGGTGTAGGGGAGGG - Intergenic
1117076294 14:52108379-52108401 ATGGCTGAAGGAGGGAGGGAAGG + Intergenic
1117252046 14:53947942-53947964 GGGGTTGGAGGGGTGGGGGAAGG + Intergenic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1118859023 14:69647396-69647418 CTGGCTGGTGGAGTGGGGGTGGG + Intronic
1119026236 14:71155181-71155203 CTGGCTGGAGGGGATGGGGCAGG - Intergenic
1119490990 14:75033072-75033094 CTGCCTGATGGAGTGTGGGAAGG + Intronic
1119530851 14:75360146-75360168 ATGGCTGAAGGGGCTGGGCATGG - Intergenic
1119552602 14:75525745-75525767 AGGGCTCAAGGGGTGGGAGAAGG + Intronic
1119595469 14:75928862-75928884 CTTGCAGAAAGGGTGGGGGCAGG + Intronic
1119725556 14:76920080-76920102 CAGGGGGAGGGGGTGGGGGAAGG - Intergenic
1119883084 14:78116936-78116958 TTGGCTGAAGGTGGGTGGGAAGG + Intergenic
1120630937 14:86889274-86889296 CTGGAGGTAGGGTTGGGGGATGG + Intergenic
1120923811 14:89778742-89778764 CTGGCTGAAGGGCGGAGGGCAGG - Intergenic
1120941823 14:89956515-89956537 CTTGCTGAAGGCGTTGGGGACGG - Intronic
1121017655 14:90558184-90558206 ATGGCTGCCTGGGTGGGGGATGG + Intronic
1121252157 14:92507267-92507289 CTGGGTGCCGGGGTGGGGCAGGG - Intergenic
1121261378 14:92568804-92568826 CATGCTGAAAGGGTGGGTGATGG + Intronic
1121331016 14:93049846-93049868 CTGGCAGCTGGGGTGGGAGATGG + Intronic
1121369851 14:93347113-93347135 TGGGCAGAAGGGGTGGGGTAGGG + Intronic
1121791512 14:96702889-96702911 CGGGGTGAAGGGGGGTGGGAAGG + Intergenic
1122162791 14:99797916-99797938 CAAGCTGGAGGGGTGGGGGAAGG - Intronic
1122294520 14:100697822-100697844 GTTGCTGGAGGGGTGGGGGAGGG + Intergenic
1122600746 14:102920520-102920542 GTGGATGAAGGGATGGTGGATGG - Intergenic
1122619811 14:103049291-103049313 TTGGCTGAAGGAGGGTGGGATGG + Intronic
1122640694 14:103157331-103157353 CTGGGTGAAGGGGCAGGGAAGGG - Intergenic
1122706472 14:103625144-103625166 CTGGCTGGAGGGGCTGGGGCGGG - Intronic
1122810874 14:104287299-104287321 CAGACTGAAGGGGTGGGCAAGGG + Intergenic
1122885241 14:104707770-104707792 CAGGCAGCAGGGGTGGGGGTGGG - Exonic
1122904820 14:104796767-104796789 CTGGCAGCAGGGGAGGGGGTGGG + Intergenic
1122923326 14:104888846-104888868 CTGGAGGAAGGGGTGGGGCGGGG + Intronic
1122957592 14:105078251-105078273 GTGGTTGCAGGGGTTGGGGATGG - Intergenic
1123061550 14:105596961-105596983 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123061565 14:105597001-105597023 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123061579 14:105597042-105597064 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123061594 14:105597083-105597105 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123061608 14:105597124-105597146 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123061624 14:105597165-105597187 GTGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123085999 14:105717872-105717894 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086013 14:105717913-105717935 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086027 14:105717954-105717976 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086042 14:105717994-105718016 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086056 14:105718035-105718057 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086070 14:105718076-105718098 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086084 14:105718117-105718139 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086098 14:105718158-105718180 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086113 14:105718198-105718220 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086129 14:105718239-105718261 GTGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086143 14:105718280-105718302 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086158 14:105718321-105718343 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086172 14:105718362-105718384 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086187 14:105718403-105718425 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086201 14:105718444-105718466 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086216 14:105718485-105718507 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086230 14:105718526-105718548 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086245 14:105718567-105718589 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086259 14:105718608-105718630 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086274 14:105718649-105718671 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086288 14:105718690-105718712 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086303 14:105718731-105718753 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086317 14:105718772-105718794 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086332 14:105718813-105718835 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086346 14:105718854-105718876 ATGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086362 14:105718895-105718917 GTGGCAGGAGGGGTGGGTGAAGG + Intergenic
1202834231 14_GL000009v2_random:65833-65855 CTGGCTGTAGGGCCGTGGGAGGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124003157 15:25776320-25776342 CTGACGGATGGGGTGGGGGAGGG + Intronic
1124490796 15:30153897-30153919 GTGGCTGAGAGGGTGGGGCAAGG - Intergenic
1124580890 15:30954018-30954040 CTGGCAGCAGGGGTGGGGCAGGG - Intronic
1124692052 15:31831952-31831974 CTGGCGGAAGGGCTGGGGCAGGG + Intronic
1124752736 15:32384432-32384454 GTGGCTGAGAGGGTGGGGCAAGG + Intergenic
1124764976 15:32481550-32481572 ATGGGGGAAGGGGTGGGGGCTGG + Intergenic
1125183336 15:36902402-36902424 CTGCCTGCAGGGGTGGGAGGTGG + Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125600534 15:40913075-40913097 CTGGGTGCTGGGGTAGGGGAAGG - Intergenic
1125719856 15:41840139-41840161 CTGCCTGCAGAGGTGGGAGAGGG - Exonic
1125726850 15:41872518-41872540 GTGACTGGATGGGTGGGGGACGG - Intronic
1125878278 15:43168665-43168687 CTGCCTGGAGAGTTGGGGGATGG + Intronic
1126096201 15:45092496-45092518 CTGGCTGAAGAGGTAGGGTGGGG + Intergenic
1126100094 15:45113642-45113664 CTCTCTGATGGGGTGGCGGATGG - Intronic
1126779079 15:52123321-52123343 CTGGATGCAGGGGTGGGGGAGGG - Intronic
1126846476 15:52765164-52765186 ATGGCTGAAGGGGTAGTGGTGGG + Intronic
1127315312 15:57789264-57789286 CTTGCTGGGGAGGTGGGGGAAGG - Intergenic
1127359226 15:58230352-58230374 CTGGCTGGTGGGCTGGGAGAGGG + Intronic
1127397229 15:58552532-58552554 GTGGGTGAGGGGGCGGGGGAGGG - Intronic
1127755788 15:62090607-62090629 CGGGGTTAAGGGGTGGGAGAGGG - Intergenic
1128033606 15:64503325-64503347 CCAGCTGAAGAGATGGGGGAGGG + Intronic
1128154162 15:65382274-65382296 CTGGCTGAAGGAGGGGGAGGAGG + Exonic
1128743550 15:70098827-70098849 CAGGCTGAGGGGGTTGGGGATGG + Intergenic
1128749707 15:70140227-70140249 CTGGGTGGAGAGGTGGGGGTGGG + Intergenic
1129000209 15:72327029-72327051 TTCACTGAAGGGTTGGGGGAAGG - Intronic
1129220188 15:74127989-74128011 GTGGAAGTAGGGGTGGGGGAGGG - Exonic
1129220771 15:74130478-74130500 GCGGCTGAAGTGGGGGGGGAAGG - Intronic
1129332049 15:74832726-74832748 AGGGCTGATGGGGAGGGGGAAGG - Intergenic
1129355935 15:74991806-74991828 GTGGCTAAAGGGGTATGGGAAGG - Intronic
1129696449 15:77743082-77743104 GTGACTGAAAGGGTGGGGGGTGG + Intronic
1130467507 15:84199949-84199971 CTGGCTGCGGGGGGGGGGGGGGG + Intergenic
1131063189 15:89416951-89416973 CTAGCCGCAGGGATGGGGGAAGG - Intergenic
1131116610 15:89799925-89799947 CTGGGTGAATGGGAGGGGAAGGG - Intronic
1131237117 15:90706294-90706316 ATGGCTGAAGGCGGGGGGAAGGG - Intergenic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1131881935 15:96871169-96871191 CTGGGAGTTGGGGTGGGGGAGGG + Intergenic
1132074696 15:98810146-98810168 CTGGCGGAGGGGGTGGTGGGTGG + Intronic
1132146502 15:99432766-99432788 CTGGCTGGAGTGGCTGGGGAAGG + Intergenic
1132362728 15:101231071-101231093 GGGGCTGTAGGGGTGGTGGAGGG + Intronic
1132614858 16:835409-835431 GGGCCTGAAGGGGAGGGGGAGGG + Intergenic
1132641044 16:978720-978742 CCAGCTGAAGGGGTGGGGCAGGG + Intronic
1132668305 16:1091731-1091753 CTGTCTGAATGTGTGGGGGCTGG - Intronic
1132874439 16:2130028-2130050 TTGCCGGCAGGGGTGGGGGAAGG - Intronic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133139054 16:3731157-3731179 CCGGCTGTGGGGGTGGGGGTGGG + Intronic
1133149151 16:3813882-3813904 ACAGCTGAAGGGGTGGGGAAGGG + Intronic
1133326151 16:4943534-4943556 CAGCCTGCCGGGGTGGGGGAGGG + Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133774701 16:8887484-8887506 GTGGCTGAAGGCCTGGAGGAGGG + Intergenic
1133998335 16:10763798-10763820 CACGATGAAGGAGTGGGGGAAGG + Intronic
1134087120 16:11365000-11365022 CTGGGTGGATGGGTAGGGGAGGG + Intronic
1134553384 16:15148861-15148883 TTGCCGGCAGGGGTGGGGGAAGG - Intergenic
1134690345 16:16187088-16187110 CTGGCAGGAGGGGTGTGGGAGGG - Intronic
1134745862 16:16587765-16587787 CTGTCAGAATGGGTTGGGGAGGG - Intergenic
1134999617 16:18765977-18765999 CTGTCAGAATGGGTTGGGGAGGG + Intergenic
1135925170 16:26687634-26687656 CTGGCTGCATGGCTTGGGGATGG + Intergenic
1135949347 16:26898732-26898754 CTGGGTGATGGTGTTGGGGAAGG - Intergenic
1136234535 16:28905628-28905650 AGGGCGGGAGGGGTGGGGGAGGG + Intronic
1136279615 16:29200462-29200484 TTGCCTCAAGGGGTGGAGGAGGG - Intergenic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1137825723 16:51493208-51493230 CTGGGTGAAGGGTTTGGGGTTGG - Intergenic
1138168044 16:54820924-54820946 CTGGCTGGAGGGGTGGGTGGGGG + Intergenic
1138765237 16:59594486-59594508 CTGGTTGTAGGGGTGGGGTAGGG - Intergenic
1138961463 16:62035018-62035040 CTGCCAGACTGGGTGGGGGAAGG + Intronic
1139579246 16:67862502-67862524 TTGACTGAAGTGGTGGTGGAAGG - Intronic
1139664401 16:68446690-68446712 ATGGCTGATGGGGCGTGGGAGGG + Intronic
1140038538 16:71389954-71389976 CAGGCTGTAGGGGTGGGGGCGGG - Exonic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140522106 16:75590564-75590586 TTGCCTGATGTGGTGGGGGATGG - Intergenic
1140539242 16:75740535-75740557 GTGGCAGCAAGGGTGGGGGAGGG - Intronic
1141127489 16:81411116-81411138 CTGCCTGCCGGGGTGGGGGTGGG - Intergenic
1141139674 16:81489233-81489255 CTGACTTGAGGGGTGAGGGAGGG + Intronic
1141168544 16:81676800-81676822 CTGGGGGAAGGGGTGGGAGGGGG - Intronic
1141181743 16:81757823-81757845 GTAATTGAAGGGGTGGGGGAAGG - Intronic
1141587906 16:85047394-85047416 CTGGCTGAAGGGGTGAAGATAGG - Intronic
1141592591 16:85078487-85078509 CTGGCTGAGGGGCTGTGGGCTGG - Intronic
1141688744 16:85584890-85584912 GGGGCTGGAGGGGTGGGGGAAGG - Intergenic
1141784976 16:86193417-86193439 GTGGCTGAAAGGGTGGTGGGTGG + Intergenic
1141984829 16:87572898-87572920 CTGGCTGAAGGTCAGGGGGCAGG - Intergenic
1142129274 16:88425379-88425401 CAGGCTGCAGGGTTGGGGGTAGG - Intergenic
1142248409 16:88980132-88980154 ATGGGTGAATGGGTGGTGGATGG + Intergenic
1142248515 16:88980550-88980572 ATGGGTGAATGGGTGGTGGATGG + Intergenic
1142478606 17:204526-204548 GTGGGTGGAGGAGTGGGGGATGG - Intergenic
1142759430 17:2034544-2034566 GTGGCAGCAGGGGAGGGGGATGG - Intronic
1142808882 17:2386097-2386119 CAGGCTGCAGGGGACGGGGAAGG + Exonic
1143313295 17:6011644-6011666 CAGACTGAAGGGGTAGGGGCGGG - Intronic
1143581494 17:7830174-7830196 CTGGCTGAAAGGGTGAGTGGAGG - Intronic
1143723051 17:8827161-8827183 CTGGCTGAGATGGTAGGGGAGGG - Exonic
1144201172 17:12943890-12943912 CTGGAGGAGGGGGTGGGGGATGG - Intronic
1144581369 17:16461303-16461325 CAGGACGAAGGGGTGTGGGAGGG - Intronic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1144745504 17:17611473-17611495 CTTGCTGTCGGGCTGGGGGACGG + Intergenic
1145270171 17:21400588-21400610 GTGGCTGGATGGGTGGGCGAGGG + Intronic
1145308400 17:21688039-21688061 GTGGCTGGATGGGTGGGCGAGGG + Intergenic
1145931246 17:28687392-28687414 CTGGCTGTAAGGGTGGGCAATGG - Exonic
1146275426 17:31512975-31512997 CTGGCAGGAGTGGTGGGGCAGGG - Intronic
1146277222 17:31523493-31523515 CTGCCTGCAGGGGTGGGAGGAGG - Exonic
1146354114 17:32119778-32119800 CAGGCTCAAGGGGAGGGGAAAGG - Intergenic
1146370395 17:32262542-32262564 CAGGATGAAGGGCTGGGGAAGGG - Intergenic
1146371657 17:32268241-32268263 GGGGCTGGAGAGGTGGGGGAAGG + Intronic
1146619957 17:34389477-34389499 CTGGCTGAGGGGTGGGGGTAAGG + Intergenic
1147310192 17:39591452-39591474 TTGGCTGCATGGGTGGAGGAAGG + Intergenic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147747439 17:42703702-42703724 CTGGGAGGTGGGGTGGGGGATGG - Intronic
1147917666 17:43898369-43898391 CTTGCTGCATGGCTGGGGGAAGG + Exonic
1148031276 17:44622812-44622834 CTGGCTGCTGAGGTGGGGGCAGG + Intergenic
1148149178 17:45385891-45385913 GTGGCTGAAGGAGGGAGGGAGGG - Intergenic
1148216864 17:45838034-45838056 CAAGCTGCAGTGGTGGGGGAAGG + Intergenic
1148323205 17:46769747-46769769 CTCCCTGAAGGGTTTGGGGAGGG + Intronic
1148616036 17:48999811-48999833 TGGGCTGAAGGAGTGGGGGTAGG - Intronic
1148657483 17:49298587-49298609 GTGTGAGAAGGGGTGGGGGATGG + Exonic
1148753039 17:49956858-49956880 CTCTCTGAATGGGTGGGTGAAGG - Intergenic
1148835239 17:50462478-50462500 CTGGATGAAGTGGTGGCGGCTGG + Exonic
1148859231 17:50595463-50595485 AGGGGTGAAGGGGTGGGAGATGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1148945525 17:51259633-51259655 AAGGCTGACGGGGTGGGGGGAGG + Intronic
1148986045 17:51622213-51622235 AGGGCTGAAGGGTTGGGGGAGGG + Intergenic
1149340677 17:55682945-55682967 TAGGCTGAAGGTGTAGGGGAGGG + Intergenic
1149540971 17:57467847-57467869 ATGACAGAAGGGGTGGGGGGTGG - Intronic
1149585387 17:57782831-57782853 CTCGCAGAAGGGGCGGAGGAGGG + Intergenic
1150003465 17:61455931-61455953 CTGTCTGAGGGGTTGGGTGAGGG + Intronic
1150265751 17:63831455-63831477 CTGGCTGTGGGGGTGGGGTGTGG + Intronic
1150317153 17:64178554-64178576 GTGGCGGTGGGGGTGGGGGAAGG + Intronic
1150549007 17:66191952-66191974 CTGGTGGGAGGGGCGGGGGAAGG + Intronic
1150915511 17:69432647-69432669 CTATCGGGAGGGGTGGGGGAGGG + Intronic
1151576163 17:74953534-74953556 CCGGCTAAGGGGGTGGGTGACGG - Exonic
1151671611 17:75574286-75574308 CTGGCAGGAGGGGTGGGGAAGGG + Intronic
1151821780 17:76500776-76500798 CTGGATGGAGGGGCTGGGGAAGG - Intronic
1152049070 17:77958671-77958693 CTGGCTGAAGCGGGGGGAGGGGG + Intergenic
1152070631 17:78132154-78132176 CGGGCGGAAGGGGTGGGAGGGGG - Intronic
1152155927 17:78632762-78632784 ATGGGGGCAGGGGTGGGGGATGG - Intergenic
1152189484 17:78879828-78879850 TGGGCTGGAGGGGTGGGGGTGGG - Intronic
1152203179 17:78958923-78958945 CTGGCTGGAGGGGTGCGCCAGGG - Intergenic
1152269351 17:79314838-79314860 CTGGGTGTAGGGGAGGGGAACGG + Intronic
1152469684 17:80483753-80483775 CTGGCTGCTGAGGTGGGGGCCGG + Intergenic
1152514953 17:80817633-80817655 CCGGGAGAAGGGGTGGGGGAGGG + Intronic
1154423713 18:14256244-14256266 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1154424178 18:14259353-14259375 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1154426849 18:14278555-14278577 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1154429579 18:14298089-14298111 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1154431847 18:14314435-14314457 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1156337368 18:36183628-36183650 CTGGAGGAGGAGGTGGGGGAAGG - Intergenic
1156406868 18:36791154-36791176 ATGGCTGAAGAGGAAGGGGAAGG - Intronic
1156497290 18:37534279-37534301 CTGGGTGCTGGGGAGGGGGAAGG + Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1156897610 18:42264356-42264378 CTGCCTGAAAGGGAGGGAGAAGG + Intergenic
1157687379 18:49653100-49653122 CTGGATGCAGGGGAGGTGGAAGG - Intergenic
1157692034 18:49691592-49691614 TTGGCTGGAGGGGTGTGGGATGG + Intergenic
1158144085 18:54290827-54290849 CTGGATGGAGGGCTGAGGGAGGG + Intronic
1158868935 18:61665604-61665626 TTGGGTGAAGGGGTGGGGCTGGG - Intergenic
1158915330 18:62120202-62120224 CTGGGGGAAGGGGAAGGGGAAGG + Intronic
1159845235 18:73451233-73451255 CGGGGTGGAGGGGTAGGGGAGGG - Intergenic
1159915480 18:74183723-74183745 CTGTCTGGAGGGGTGGAGAATGG + Intergenic
1159995578 18:74960910-74960932 CTGGGTGAAGGGATAGGAGAAGG + Intronic
1160222100 18:76985040-76985062 CACGCTGAGGGGGTGGGGGCGGG + Intronic
1160508847 18:79442147-79442169 CGGGCCGAGGCGGTGGGGGAGGG + Intronic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1160970653 19:1766419-1766441 CTGGATGAAGGGGAGGATGAAGG + Intronic
1160980665 19:1815277-1815299 CTGCCTGGAGGTGAGGGGGAAGG + Exonic
1160981013 19:1816615-1816637 CTGGCTGGTGGGGCGGGGGAGGG + Intronic
1160991185 19:1860951-1860973 CAGGCTCAAGGGGTGGGGGAGGG + Intronic
1161083207 19:2321695-2321717 CTGGATGAAGGGGTTGGGGATGG + Exonic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161283515 19:3457781-3457803 CTGGCTGAGCGGATGGGGGCGGG + Intronic
1161397595 19:4052682-4052704 CGGGCTGTAGCGGTGGGGGCAGG - Intronic
1161470395 19:4454178-4454200 CTGGCTGATGGTGCTGGGGAGGG - Intronic
1161640748 19:5421179-5421201 CTGGCTGGAGGGGTGGGGGACGG + Intergenic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1161903197 19:7135165-7135187 CTGGTGGCAGGGGTGGGGGCAGG + Intronic
1161940386 19:7399249-7399271 GTGGCTGACTGGGTGAGGGAGGG + Intronic
1161984464 19:7646153-7646175 GTGGCTGGTAGGGTGGGGGATGG - Intronic
1162003140 19:7760733-7760755 GTGGCTGCAGTGGTGGTGGATGG + Intergenic
1162145629 19:8610988-8611010 CGGGGAGAATGGGTGGGGGAGGG + Intergenic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162913631 19:13863160-13863182 GAGGCGGAAGGGGTTGGGGAGGG - Intronic
1162936528 19:13984224-13984246 CAGGCGGACGGGGTGGGGGGCGG - Intronic
1163015343 19:14451122-14451144 AGGGCTGCAGGGGTGGGGTAGGG - Intronic
1163035965 19:14569130-14569152 CTGGCTGAAAGGGGGTGGAAAGG + Intronic
1163208304 19:15820767-15820789 GTGGCGGAAGGGGTGGGGTGGGG - Intergenic
1163238425 19:16043381-16043403 ATGGATGAATGGGTGGAGGATGG + Intergenic
1163421353 19:17215373-17215395 CCGGCGGAAGGGGTGGTGTAGGG + Exonic
1163773659 19:19205564-19205586 CAGGCAGCAGGGGTGGGGGCTGG + Intergenic
1164524716 19:29004968-29004990 CTGGCTGATGGGGCGGTGGCAGG - Intergenic
1164596016 19:29530981-29531003 CTGGGAGAAGGGATTGGGGATGG + Intronic
1164721877 19:30438498-30438520 CTGGCAGCAGGGTTGGGGGTGGG + Intronic
1164982952 19:32627985-32628007 CTGGCTGATGGGCTGGGTGGGGG - Intronic
1165077293 19:33286916-33286938 CAGGCTGAAGGGGCGAGGGGAGG + Intergenic
1165108092 19:33486310-33486332 CTGGCAGGAGGGGTGGGTGTGGG - Intronic
1165150974 19:33759942-33759964 CTGGGTGATGGGGTGGGAGCGGG - Intronic
1165305225 19:34999498-34999520 CTTGCAGACGGGGCGGGGGAGGG + Intronic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165776056 19:38404985-38405007 CTTGGTGAAGGGGTAGTGGAGGG + Exonic
1165922363 19:39307258-39307280 CCGGGTGACGGGCTGGGGGAGGG + Exonic
1165940714 19:39413523-39413545 GGGGCTGGAGGGGTGTGGGAAGG + Intronic
1165985220 19:39762820-39762842 GTGGGGGAGGGGGTGGGGGATGG - Intergenic
1166101983 19:40576524-40576546 GTGGCTGTAGGGGTGGGTGCGGG + Intergenic
1166103028 19:40582546-40582568 CAGGCTTAGGGGGTGGGGGTGGG - Intronic
1166220798 19:41363349-41363371 CTGCGTTAAGGGGTGGAGGAAGG + Intronic
1166359243 19:42245724-42245746 CGACCTGAAGGGGTGAGGGATGG + Intronic
1166566274 19:43767451-43767473 GTGGCTAAGGGGGCGGGGGATGG - Intronic
1166739036 19:45103145-45103167 CTGGATGAATTGGTGGTGGATGG + Intronic
1166792283 19:45405344-45405366 GCGCCTGAAGGGGTGGGGCAAGG - Intronic
1166882606 19:45938606-45938628 CTGGAGGGAGGGGTGGGAGATGG - Exonic
1166932465 19:46309263-46309285 CAGGCTGCCTGGGTGGGGGATGG - Exonic
1166966158 19:46530478-46530500 CTGGCTGAGGGAGAGGGAGAGGG - Intronic
1167237351 19:48322957-48322979 CTCCCTGAGGGGGTGAGGGATGG - Intronic
1167267098 19:48488675-48488697 CTAGGTGAAGGGGAAGGGGATGG - Intronic
1167412995 19:49355971-49355993 CTGCCCGTGGGGGTGGGGGAGGG + Intronic
1167765383 19:51479094-51479116 CTGGCCTGAGAGGTGGGGGAGGG - Intronic
1168180471 19:54659251-54659273 CGGGCTGGGGGGCTGGGGGAGGG + Intronic
1168330090 19:55563147-55563169 CTGACTGAAGGGCTGGGAGCGGG + Intergenic
1202638448 1_KI270706v1_random:61859-61881 CTGGCTGTAGGGCGGTGGGAGGG - Intergenic
925727242 2:6884969-6884991 CTGGCTTAATGGGTCAGGGATGG + Intronic
926332743 2:11838600-11838622 CTGGCTGACGGGGCAGGGAATGG - Intergenic
926744378 2:16138900-16138922 TTGGGTGAAAGTGTGGGGGATGG - Intergenic
926990640 2:18676458-18676480 CTGTCTGCAGTGGTGGGTGAGGG + Intergenic
927241739 2:20925387-20925409 CTTCCTGGAGTGGTGGGGGATGG - Intergenic
927699645 2:25259718-25259740 CCTGGAGAAGGGGTGGGGGAAGG - Intronic
927703086 2:25280326-25280348 GTGGCTGCCGGGGTGGGGGGTGG - Intronic
927846834 2:26476489-26476511 GTGGGGGAAGGGGTGGGGAAGGG - Intronic
927846877 2:26476573-26476595 GTGAGGGAAGGGGTGGGGGAAGG - Intronic
927846884 2:26476585-26476607 GTGGGGGAAGGGGTGAGGGAAGG - Intronic
927846901 2:26476621-26476643 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927846920 2:26476657-26476679 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927846927 2:26476669-26476691 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927846946 2:26476705-26476727 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927982204 2:27381002-27381024 CTGGCTGCAGGAGGGGGCGAGGG + Intergenic
927996401 2:27489914-27489936 CTGGCTGAAGGCTTGTGGGCGGG - Intergenic
928334276 2:30382861-30382883 CTGCTTGAGGGGGTAGGGGAAGG - Intergenic
929066499 2:37980727-37980749 CTGCCTGAAGGAGTAAGGGAAGG - Intronic
929188009 2:39115034-39115056 CTGGCATAAGAAGTGGGGGAAGG - Intronic
929456958 2:42072950-42072972 CTGGGCTCAGGGGTGGGGGAGGG - Intergenic
929562136 2:42962526-42962548 CTGGCTGGAGGGGTTGGGGGAGG + Intergenic
929681215 2:43995549-43995571 CAGGCTGAAGTGGCGGGGGCAGG + Intronic
930182154 2:48371105-48371127 CTGGCGGAGGGGGTGGGGCGCGG + Intronic
930575084 2:53136697-53136719 CTGGCAGAAGGGTTGGGGTGGGG + Intergenic
931099016 2:58974214-58974236 CTGGCTGCGGGGGTTGGGGGTGG + Intergenic
931566494 2:63620568-63620590 CTGGGGGAAGGGGTGGGTGTGGG + Intronic
931874733 2:66499486-66499508 CTGTAAGAAGGTGTGGGGGAAGG - Intronic
932092345 2:68817646-68817668 CCAGCTGCTGGGGTGGGGGATGG - Intronic
932614900 2:73225777-73225799 CTCCCTGCAGCGGTGGGGGATGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932751476 2:74374247-74374269 CAGGCTGCTGGGGTGGGGGTGGG - Intronic
932793203 2:74673566-74673588 CTGGCTGAACGGTGGGGAGAGGG + Exonic
933348787 2:81126562-81126584 GGTGCTGAAGGGGTGGGGGGGGG - Intergenic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
934494365 2:94784472-94784494 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
934574777 2:95392944-95392966 CTGGGGAAAGGGGTGAGGGATGG + Intergenic
934617622 2:95784457-95784479 GTGGGTGGAGGGCTGGGGGAGGG + Intergenic
934643271 2:96040102-96040124 GTGGGTGGAGGGCTGGGGGAGGG - Intergenic
934661693 2:96146484-96146506 CCGGCAGCAGGGCTGGGGGAGGG - Intergenic
934717689 2:96552927-96552949 CTGGCAGGAGGGGCAGGGGAGGG + Intergenic
934730522 2:96653774-96653796 CTGGCTCTAAGGGTGGGGGCTGG - Intergenic
934972493 2:98774597-98774619 GTGGATGAAGGGGAGGGGCAAGG - Intergenic
935019707 2:99218045-99218067 CAGTCTGATGGGGTTGGGGAAGG + Intronic
935250102 2:101253236-101253258 CTTGCTGAAGTAGTGGTGGAAGG - Exonic
935685407 2:105678540-105678562 CTGGCTGAAGTGGGAGGGAAGGG - Intergenic
935918080 2:107979467-107979489 GTGGCTGGGGGGCTGGGGGAGGG + Intergenic
936018788 2:108979365-108979387 CTGGGGGAAGTGGTGGGGCAGGG - Intronic
936791850 2:116161146-116161168 CTGGGTTAAGAGGTGGGAGAAGG + Intergenic
937292579 2:120790507-120790529 CTGGCTGGAGTGGTGGAAGAGGG + Intronic
937309800 2:120895044-120895066 CTGGCTGATGGGGAGGGGAGGGG + Intronic
937322677 2:120970404-120970426 GGGGTTGATGGGGTGGGGGAAGG - Exonic
937362516 2:121238948-121238970 CTGGCAGCAGGGGTGGAGGCAGG - Intronic
937369514 2:121287571-121287593 CAGGCGGAAGGGGGAGGGGAGGG - Intergenic
937487579 2:122331820-122331842 TTGCCCGAAGGGGTGAGGGATGG + Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
938686852 2:133746815-133746837 GTGGGTGAAGGGGTAGGGGAGGG - Intergenic
938725593 2:134106166-134106188 CCAGCTGAAGGGGTGGGGTGGGG - Intergenic
939638602 2:144612290-144612312 CTGGCTGGAGTGGTGGGGAGGGG + Intergenic
940017406 2:149121659-149121681 TGGGCTGAAGGGGTGGTAGAAGG + Intronic
940257222 2:151743754-151743776 GTGGCAGCAGGGCTGGGGGATGG + Intergenic
940348560 2:152654787-152654809 AAGGCTGAAGGGGTGGGTGAGGG - Exonic
940398672 2:153222302-153222324 CTGGCTGGGGGGGGGGGGGGGGG + Intergenic
940420735 2:153477574-153477596 GTGGGAGAAGGGGTGGGGGGAGG - Exonic
940577659 2:155531838-155531860 CTGAGTGAGGTGGTGGGGGATGG + Intergenic
940962033 2:159797209-159797231 CTGGGGCAAGGGGTGGGGGGGGG + Intronic
941020123 2:160398832-160398854 CTGGCTGGATGGGGAGGGGAAGG - Intronic
941276632 2:163498230-163498252 CTGGCGGAAGGGGTGGCTGTGGG + Intergenic
941667653 2:168258602-168258624 ATGGCAGAATGGGTGGGGGAGGG - Intergenic
943482854 2:188443182-188443204 CGGGCTGTGGGGGTGGGGGTTGG + Intronic
943552749 2:189360767-189360789 CCTGTTGGAGGGGTGGGGGAAGG - Intergenic
944094129 2:195947434-195947456 TGGGGTGAAGGGGTAGGGGAGGG - Intronic
944447378 2:199805196-199805218 GAGGCTGCAGGGGTGGAGGATGG - Intronic
944476309 2:200110376-200110398 CTGGCAGAAGGTTTGGTGGATGG - Intergenic
944526537 2:200625429-200625451 CTGGTTGAAGTGGTGAGGGTGGG - Intronic
945948146 2:216013688-216013710 CTGGCAGCCGGGCTGGGGGAGGG + Intronic
945955737 2:216084169-216084191 CAGGCAGATGGGGTGGGGGAGGG - Intronic
945977463 2:216282032-216282054 CTGGCTGAAAAGGAAGGGGAGGG + Intronic
946113399 2:217439847-217439869 CTGGGTGGTGGGGTGGGGGGCGG - Intronic
946341557 2:219072907-219072929 CTGGCGGGAGGAGTGGGGAATGG - Intergenic
947136943 2:226984917-226984939 CTGGGGGTTGGGGTGGGGGAGGG + Intronic
947743851 2:232497529-232497551 CTGGCTGGGGGAGTGGAGGAGGG + Intergenic
947758684 2:232587873-232587895 CTGACTGAAAGGGTGGAGGATGG - Intergenic
947817827 2:233049717-233049739 CTTGCTGGAGGTGTGGGAGAGGG - Intergenic
948016409 2:234694414-234694436 CTTGCTGATGGGTTGGGGGTTGG + Intergenic
948082458 2:235217720-235217742 AGGGCTGAAGTGGTGGGGGATGG - Intergenic
948560972 2:238851435-238851457 CTGGCTTGGAGGGTGGGGGAAGG + Intronic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948732816 2:239977945-239977967 GAGGCTGGAGGGGTGGGTGAGGG - Intronic
948745752 2:240092351-240092373 CTGGGTGGTGGGGTGGGGGAGGG - Intergenic
948824471 2:240567679-240567701 CTGGCGGATGGGGTGGGGACAGG + Intronic
948862614 2:240760249-240760271 CTGGGAGAGGTGGTGGGGGATGG - Intronic
1168831641 20:848352-848374 AAGGCTGCAGGGTTGGGGGAGGG - Intronic
1168928014 20:1598805-1598827 CTGACTGTAAGTGTGGGGGATGG - Intronic
1169111495 20:3037060-3037082 GTGGCAGAAGAGGTGGGGGCAGG - Intronic
1169192627 20:3667830-3667852 GTGGCTGACGGGGTGGTGGCTGG - Intergenic
1169207742 20:3749622-3749644 CTGTCTGCAGGGTCGGGGGAGGG - Intronic
1169321256 20:4635048-4635070 TTGGGTGCAGGGGTGAGGGAAGG - Intergenic
1170779928 20:19416155-19416177 CTTGGTGAGGTGGTGGGGGATGG - Intronic
1171242308 20:23581757-23581779 CTGGTAGAAGTGGTGGGGGTGGG + Intergenic
1171867660 20:30500221-30500243 TCGGCGGAAGAGGTGGGGGAAGG + Intergenic
1172007213 20:31825695-31825717 CTGAATGAAGGGGTGGGTAAAGG + Intronic
1172037293 20:32019082-32019104 CTGGCGGATGGGGTGGGGTGGGG + Exonic
1172178676 20:32987570-32987592 CTGGCAGAAGAGGTAGGGGGTGG - Intronic
1172390107 20:34560100-34560122 CTGGCTGGTGGGATGGGGGAGGG + Exonic
1172657274 20:36544836-36544858 CTGCAGGAAGGGGTGGGGGTTGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172852484 20:37976734-37976756 CTGGGCGTAGGTGTGGGGGAGGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173402366 20:42736840-42736862 CTGGCTGAGAGGCTGGGGGCTGG - Intronic
1173757412 20:45529566-45529588 TGGGGTGATGGGGTGGGGGAAGG - Intergenic
1174505431 20:51014801-51014823 TTGGCTGGAGGGGTGAAGGAGGG + Intronic
1175367371 20:58465326-58465348 TTGGAGGAGGGGGTGGGGGAAGG + Intronic
1175753663 20:61515947-61515969 CAGGCAGGAGGGGTGAGGGATGG - Intronic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1175781081 20:61682428-61682450 ATGGATGGAGGGGTGGGAGAAGG + Intronic
1175790317 20:61736585-61736607 ATGGATGAAGGGGAGAGGGAGGG + Intronic
1175794016 20:61760155-61760177 AAGGCTGAAGGGTAGGGGGAGGG + Intronic
1175934691 20:62509448-62509470 GTGGCTGGAGGGGTGGAGGATGG - Intergenic
1175934702 20:62509478-62509500 GTGGCTGGAGGGGTGGAGGGTGG - Intergenic
1176175541 20:63721689-63721711 CTACCTGAAGTTGTGGGGGAGGG - Intronic
1176220362 20:63966737-63966759 CTCGCAGAAGGGGCAGGGGAAGG + Exonic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1176845188 21:13871327-13871349 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1176847919 21:13890884-13890906 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1176849759 21:13903764-13903786 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1177608036 21:23407767-23407789 GTGGGTGAACGGGTGGAGGAAGG - Intergenic
1178248061 21:30973232-30973254 ATGGCTGTAGTGGTGGGAGAGGG - Intergenic
1178296191 21:31412416-31412438 ATGGATGAGGGGGTGGGGGATGG + Intronic
1178358977 21:31932442-31932464 GTGGCTGGAGGGGAGGGGAAGGG + Intronic
1178418806 21:32426773-32426795 TTGTCTGAAGGGGTGATGGAGGG - Intronic
1178695081 21:34785871-34785893 TAGGCTGGAGGGGTGGGGGTAGG + Intergenic
1178758845 21:35380672-35380694 CTGGATGAGGGGCTAGGGGAGGG + Intronic
1178878944 21:36433526-36433548 CTGGCTTCATGGGTGTGGGAGGG - Intergenic
1178997702 21:37420330-37420352 CATCCTGATGGGGTGGGGGAAGG - Exonic
1179452471 21:41475424-41475446 GTGGATGAAGGGGTGAGTGAGGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179833207 21:44011613-44011635 CTGGCGGAGGGGGTGGGGCGGGG + Intergenic
1179970767 21:44835989-44836011 GGGGCTGCAGGGGTGGGGTAAGG - Intergenic
1179970924 21:44836309-44836331 GGGGCTGCAGGGGTGGGGTAGGG - Intergenic
1180363518 22:11920029-11920051 CTGGCTGTAGGGCGGTGGGAGGG + Intergenic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1180626792 22:17199114-17199136 CTGGTGGAGGGGGAGGGGGAGGG - Intronic
1180821212 22:18829070-18829092 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
1180830251 22:18902005-18902027 CTTGCCTAAGTGGTGGGGGATGG - Intergenic
1180842529 22:18965982-18966004 CTCCCTGCAGGGGTGGGGGAGGG + Intergenic
1181058952 22:20272874-20272896 CTCCCTGCAGGGGCGGGGGAGGG - Intronic
1181063755 22:20295543-20295565 CTGGGTTGAGGGTTGGGGGATGG + Intergenic
1181191766 22:21146975-21146997 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1181441092 22:22935552-22935574 CTGGGTGAAGGGGTTGGCCAGGG + Intergenic
1181528311 22:23502370-23502392 GAGGATGGAGGGGTGGGGGATGG - Intergenic
1181528500 22:23502912-23502934 GTGGATGGAGGGATGGGGGATGG - Intergenic
1181528530 22:23502989-23503011 ATGGATGGAGGGATGGGGGATGG - Intergenic
1181545105 22:23598157-23598179 CTGGGTGAAGGGGTTGGCCAGGG - Intergenic
1181567694 22:23749778-23749800 GTTGCTGAAGAGGAGGGGGAGGG - Intronic
1181570521 22:23765767-23765789 CTGGCTGATGAGGTGGGGTCAGG - Exonic
1181592115 22:23891932-23891954 CTGGCTCCAGGGTTGGGGGTTGG - Intronic
1181627303 22:24130649-24130671 CAGGCTGGTGGGGTAGGGGAGGG - Intronic
1181815481 22:25433599-25433621 CTGTCGGAAGGGGAAGGGGAAGG + Intergenic
1182023663 22:27101023-27101045 CAGGCTGCAGGGGCGGGGGGAGG + Intergenic
1182585124 22:31340534-31340556 GTGGCTGTAGGGCTGGAGGAGGG + Intronic
1182770791 22:32794846-32794868 CTGGCAGATGAGGTGGAGGAGGG + Intronic
1183043531 22:35201566-35201588 CATGCTGAAGGGGTTGGAGAAGG + Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183374174 22:37453479-37453501 ATTCCTGAGGGGGTGGGGGATGG - Intergenic
1183537360 22:38410696-38410718 CGGGGAGAAGGGGAGGGGGAGGG + Intergenic
1183745784 22:39690995-39691017 CTGTCGGGAGGGGTGGGGGTAGG + Intergenic
1183755022 22:39753987-39754009 GTGGTTGAAGGGGTGGAGAATGG - Intronic
1184014852 22:41778175-41778197 ATGACAGAAGGGGTGAGGGAGGG + Intronic
1184149319 22:42629263-42629285 GTGGCTGGAGGGTTGGGGCAAGG - Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184293136 22:43508809-43508831 ATGGATGGAGGGATGGGGGATGG - Intergenic
1184350891 22:43943516-43943538 CAGGCAGAAGGGGAGGGGGCTGG - Intronic
1184512519 22:44941931-44941953 CTCACAGATGGGGTGGGGGATGG - Intronic
1184612450 22:45613404-45613426 TAGGCTGAAGGGGAGGAGGATGG - Intergenic
1184687396 22:46102793-46102815 CTGGCTGTGGCTGTGGGGGAAGG + Intronic
1184737744 22:46409219-46409241 TTGGCTGCAGGGGCGGGGGATGG + Intronic
1184850182 22:47115404-47115426 GTGGCTAAAGGGGCGGGGCAGGG - Intronic
1184892785 22:47389803-47389825 CTGGCAGGAGGGGTAGGGAAGGG + Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185287636 22:50009631-50009653 CAGGCTGTCGGGGTGGGGGTGGG + Intronic
1185312209 22:50162365-50162387 GTGGGGGAGGGGGTGGGGGAGGG - Intergenic
1185390860 22:50561158-50561180 GTGGCTTAAGGGGTGGTTGATGG + Intronic
1203219488 22_KI270731v1_random:31881-31903 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1203271337 22_KI270734v1_random:54946-54968 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
1203280340 22_KI270734v1_random:127276-127298 CTTGCCTAAGTGGTGGGGGATGG - Intergenic
949299742 3:2570043-2570065 CTGGCAGGATGGGTGGGAGAAGG + Intronic
949804558 3:7940209-7940231 GGGGCTGGAGGGCTGGGGGAGGG + Intergenic
949893699 3:8753221-8753243 GAGGCTGAGGGGGTGGGGGCAGG + Exonic
950087996 3:10274595-10274617 CTGTGTGTAGGGGTCGGGGAGGG + Intronic
950109109 3:10407175-10407197 CTGCCAGATGGGGTGGGGGTGGG + Intronic
950119273 3:10470972-10470994 ATGGCTGGAGGGGTGGAGAACGG + Intronic
950153933 3:10708329-10708351 CTGGCTGTGGGGGTGGGGCGGGG - Intergenic
950196380 3:11011966-11011988 CTAGCTGCAGGGATGGGGCAGGG - Intronic
950474299 3:13205895-13205917 ATGGCTGGATGGATGGGGGATGG - Intergenic
950811868 3:15656954-15656976 CTGGCCGGAGTGGTGGGGGATGG + Intergenic
950939462 3:16878825-16878847 CTGGCTGTGGGGGTGAGAGAAGG + Intronic
952577817 3:34795760-34795782 GTTGCTGCAGAGGTGGGGGAGGG + Intergenic
952809539 3:37388966-37388988 CAGGGTGAAGGGGTTAGGGAAGG - Intronic
952855524 3:37767361-37767383 CTGCCTTAAGGGATGGGGAAAGG + Intronic
952884475 3:38003985-38004007 AGGGCTGCAGGGGTAGGGGAGGG - Intronic
953393195 3:42545677-42545699 AGGGCTGCAGTGGTGGGGGAAGG - Intergenic
953674864 3:44993078-44993100 CTGGCTGAGGGGCTGGGGGTGGG + Intronic
953836581 3:46351370-46351392 CTGGCAGAAGGTGTGGAGGGGGG + Intergenic
953904380 3:46861164-46861186 CTGGCTGGAGAGGTGGAGGGGGG - Intronic
954214145 3:49115182-49115204 TTGGCTGGAGGGGGCGGGGAGGG - Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954361491 3:50124983-50125005 CTGGCTGCAGGGGATGGGGATGG + Intergenic
954615190 3:51965909-51965931 CTGGAAGAAGGGCTGGGGGGTGG + Intronic
954816637 3:53287177-53287199 CTGGGGGAAGCGGTGGGGGCCGG + Exonic
955094395 3:55782758-55782780 CTGGCTGAATGTGGGGGAGAGGG - Intronic
955746165 3:62142361-62142383 CTGGCTGGCCGGGTAGGGGAAGG + Intronic
956260423 3:67333871-67333893 GTGGCTGGAGGTGTGGGGAAGGG + Intergenic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
957453096 3:80404961-80404983 CTGGCTCAATGAGTAGGGGAAGG + Intergenic
957618527 3:82565511-82565533 CTTCCTGAAGGGGTTAGGGATGG - Intergenic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
958715435 3:97774488-97774510 ATGGCAGCATGGGTGGGGGAGGG + Intronic
958883348 3:99697957-99697979 GTGGGTGAGGGGGTGGGGGAGGG - Intronic
960561409 3:119087617-119087639 TTGGGGGAAAGGGTGGGGGATGG + Intronic
961016705 3:123473982-123474004 CTGGCTGAAGGTGGAGGGCAGGG + Intergenic
961045056 3:123702305-123702327 CTAGGGGAAGGGGTGGGGGCAGG + Intronic
961482542 3:127193312-127193334 ATGGCTGAGGGGGTGGGGCGAGG + Intronic
961650981 3:128416495-128416517 CTGGAAGAAGGGGCGGGAGATGG - Intergenic
961813244 3:129533757-129533779 CTGGGGGAAGGTGTAGGGGATGG - Exonic
962023651 3:131526075-131526097 CTGGGTGAAGGGGTGGGATGGGG + Intergenic
962848638 3:139291228-139291250 CTGGCTTAGGGAGTGAGGGAGGG - Intronic
962856941 3:139355553-139355575 CAGGCTGGAGGGATTGGGGAAGG - Intronic
963011181 3:140771877-140771899 CTGGCTGACAGGGTGTGTGAGGG - Intergenic
963162911 3:142170107-142170129 CTGACTGAAGGGGTGAGGTGAGG + Intronic
963228705 3:142888752-142888774 GAGGCTGCAGGGGTGGAGGAAGG + Intronic
963619910 3:147593972-147593994 ATGGGTGGGGGGGTGGGGGAGGG - Intergenic
963767984 3:149357689-149357711 GTGGCTGCAGGGTTGGGGGTGGG - Intergenic
963926555 3:150957402-150957424 CTTGATGAAGTGGTGGGGAAGGG - Intronic
963975719 3:151478089-151478111 CTGCCTGAGGGTGTGGGGGCAGG - Intergenic
964358463 3:155870974-155870996 CTGGGGGAAGGGGGTGGGGAAGG - Intronic
964484271 3:157171527-157171549 GTGGCTGAAGAGGTGGGCGAGGG + Intergenic
964620714 3:158717734-158717756 CTGGCTGAGGGGGCGGGGAGAGG + Intronic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
965462131 3:168979080-168979102 TTGGGTGGAGGGTTGGGGGAGGG - Intergenic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
965890288 3:173505038-173505060 CGGGGGCAAGGGGTGGGGGAAGG - Intronic
966077037 3:175948971-175948993 GAGGATGAAGGGGTGGGGGAGGG + Intergenic
966870934 3:184290392-184290414 GTGGCAGGAGAGGTGGGGGAAGG + Intronic
966883614 3:184362756-184362778 CCGGCTGAAGGGGCGGTGTAGGG + Intronic
966916068 3:184584627-184584649 ATGGCAGAACGGGTAGGGGAAGG + Intronic
967061763 3:185879088-185879110 GTGGCTGATGAGGTGGAGGAAGG + Intergenic
967680858 3:192362378-192362400 TGGGGTGGAGGGGTGGGGGAGGG - Intronic
967813004 3:193776055-193776077 CTGGCGGGAGGGGGAGGGGAAGG - Intergenic
967824322 3:193866666-193866688 CTTGCTGAAAGGGTGGGGCCTGG - Intergenic
968388993 4:173179-173201 GTTGCTGGAGGGGTGGGGAAGGG - Intergenic
968451293 4:677233-677255 CTGGTTCAAGGGGTGGGAGGAGG - Intronic
968551533 4:1226066-1226088 CCGACTGCAGGGGTGGGGCATGG - Intronic
968581167 4:1396048-1396070 CTGGCTGGTGGGGTGAGGGGTGG + Intergenic
968620724 4:1602298-1602320 GTGGCTGCAGGGGCAGGGGAGGG + Intergenic
969171999 4:5371583-5371605 CCGGCTGAAGGGGAGGTGGGAGG + Intronic
969188459 4:5497573-5497595 TTGCATGAAGGGTTGGGGGAAGG + Intronic
969441594 4:7220263-7220285 TTGGGGGAGGGGGTGGGGGACGG + Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969523850 4:7694125-7694147 CTGGCTGCAGGGGCAGAGGAAGG + Intronic
969599340 4:8166770-8166792 ATGGGTGAATGGGTGGGAGATGG - Intergenic
969614472 4:8244362-8244384 CTTGCTGAATGTGTGTGGGAAGG - Intergenic
970004869 4:11400678-11400700 CTGGCTGGAAGAGTGGGGGCAGG - Intronic
970448073 4:16140492-16140514 CTGGGGGAAGGGGTGGGTGGCGG - Intergenic
970571345 4:17386217-17386239 ATGGCAGAAGGGGAAGGGGAAGG + Intergenic
970654753 4:18218775-18218797 CTGGCTGTGGGGGTGGGACATGG + Intergenic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
971709873 4:30097290-30097312 GTGGGGGATGGGGTGGGGGAAGG - Intergenic
971836066 4:31764165-31764187 CTGTCTGAAGGAGTGAGGGTAGG - Intergenic
971962049 4:33501733-33501755 CGGGCGGAAAGGGTGGGAGAGGG - Intergenic
972894752 4:43606421-43606443 CTGGCTGGGGGGTTGGGGGCTGG + Intergenic
973392363 4:49567224-49567246 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
973867436 4:55127485-55127507 TTGGATAAAGGGGTGGGAGATGG + Intergenic
975132341 4:70842029-70842051 CTGGGAGAGGGGGTGTGGGAAGG + Intergenic
975784981 4:77877898-77877920 CTGGCTGGGGGGTGGGGGGACGG + Intronic
975843488 4:78501107-78501129 GAGGATGAAGGGCTGGGGGAGGG - Intronic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
976588536 4:86825882-86825904 ATGGCAGAAGGGGTGAGAGAAGG + Intronic
976609947 4:87019870-87019892 GTGTCTGAAGGGGTCGGGGGGGG + Intronic
976613719 4:87054901-87054923 CTGGCTAAAAGTGTGGGGGGCGG - Intronic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
977065046 4:92304190-92304212 CGGGCTGTAGGGGCGGGGGCGGG + Intergenic
977940304 4:102850467-102850489 CTGGCTGAAATGGTTGGGAAAGG - Intronic
978340540 4:107717911-107717933 GGGGCTGAAGGGCTGGGGTAAGG - Intronic
979766683 4:124472221-124472243 ATGGCAGCATGGGTGGGGGAGGG - Intergenic
979994901 4:127420121-127420143 CTGTCTGATGGGGTGGTAGAGGG - Intergenic
980337957 4:131500236-131500258 CTGGATGGGGGGGTGGGGGGTGG + Intergenic
980491518 4:133533698-133533720 CGGGGAGAAGGGGTGGGGGGCGG + Intergenic
980759475 4:137211316-137211338 CTGGCTGAAGGGGAAGGTGGAGG + Intergenic
981641182 4:146945610-146945632 CTGGCTGTAGGGGTCAGGGAAGG + Intronic
982094501 4:151909683-151909705 CTGCCTGGAGGGGTGAGGGAAGG - Intergenic
982617586 4:157659679-157659701 CTGTCTGGGGGTGTGGGGGAAGG + Intergenic
983539352 4:168891717-168891739 CTGGCTGATAGGGTTGGGGAGGG + Intronic
983543344 4:168935807-168935829 CTGGGGGAAGGGGTGGCGGTGGG + Intronic
983622704 4:169776676-169776698 CGGGGTGGGGGGGTGGGGGATGG - Intergenic
983801067 4:171930117-171930139 CTGGCTGTAGGGTTGGGTGCAGG - Intronic
983938829 4:173521704-173521726 CTCCCTGGAGGGCTGGGGGAAGG + Intergenic
984676658 4:182556647-182556669 CTGGCTACAGGGGAGTGGGAAGG - Intronic
984767143 4:183408327-183408349 CTGTCTGGGGGAGTGGGGGACGG - Intergenic
984868849 4:184309703-184309725 CTGGCCGCAGAGGTGGAGGACGG + Intergenic
984900929 4:184585834-184585856 GGGGGTGGAGGGGTGGGGGATGG - Intergenic
1202765785 4_GL000008v2_random:147717-147739 CTGGCTGTAGGGCCGTGGGAGGG - Intergenic
985520911 5:373634-373656 GGGGCTGGAGAGGTGGGGGATGG + Intronic
985861106 5:2471336-2471358 CTGGCTGGGGGGTTGGGGGAAGG + Intergenic
985994849 5:3592248-3592270 CAGGCTGTGGGGGTGGGGGTTGG - Intergenic
986403997 5:7407419-7407441 GTGGCTGAAGGGGAAGGGGAAGG + Intronic
986476921 5:8143671-8143693 CAGGCCCAAGGGGTTGGGGAAGG - Intergenic
986879640 5:12154047-12154069 CTGGGTGAAGGGGTGGCTGTTGG + Intergenic
988215584 5:28268151-28268173 CAGGAGGAAGGGGTGAGGGAAGG - Intergenic
988776892 5:34485165-34485187 GTGAATGAAGGGGTGGGGGTGGG - Intergenic
988911999 5:35852553-35852575 GAGGCTGAAGACGTGGGGGAAGG + Intergenic
990014367 5:51041057-51041079 CTGGGAGAAGGGGTGGGGTTGGG + Intergenic
990698912 5:58454229-58454251 CTTCCTGAAGGGGAGGGAGAAGG - Exonic
991292303 5:65044816-65044838 GTGGGTGCTGGGGTGGGGGATGG - Intergenic
991339855 5:65596791-65596813 CTGGCTGAGGGTGTGGGGTGGGG - Intronic
991584779 5:68190806-68190828 GTGGGTGGAGGGTTGGGGGATGG - Intronic
992008169 5:72499952-72499974 ATTGTTGGAGGGGTGGGGGAAGG - Intronic
992010134 5:72517817-72517839 GTGGGTGAAGGGGTGGGGCAAGG - Intergenic
992312057 5:75511278-75511300 CGGGGTGAAGGGTCGGGGGATGG + Exonic
993868230 5:93219855-93219877 CTGTGTGGAGGGGTGGGGGTGGG - Intergenic
993970839 5:94418465-94418487 GTGGGGGCAGGGGTGGGGGAGGG - Intronic
994016989 5:94978690-94978712 CTGGTAGTAGGGGTGGGGAATGG + Intronic
994326893 5:98458426-98458448 CTGGCTGAAGTTCTGGGGTATGG - Intergenic
994625995 5:102219793-102219815 CTGGGGGAAAGGGTGGGAGAGGG - Intergenic
995537651 5:113153300-113153322 CTGCTTGAAGGGGTTGGGGGAGG + Intronic
996053336 5:118957175-118957197 CTGGCTTTAGGAGTGGAGGAAGG + Intronic
996522036 5:124438100-124438122 CTGGCACACGGGGTGGGGGAGGG + Intergenic
996770717 5:127082594-127082616 CTGGCGGTGGGGGTGGGGGTGGG + Intergenic
997096448 5:130918631-130918653 GTGGGTGAGGGGCTGGGGGAGGG + Intergenic
997250876 5:132387717-132387739 CTGACGGGAGGGGTGGGGTAGGG - Intronic
997500690 5:134371335-134371357 CCCGCTGAAGGGCTCGGGGAAGG + Exonic
997826498 5:137111398-137111420 CTGGCTGGAGGAGATGGGGAGGG + Intronic
998128948 5:139641517-139641539 TTTGCTGGAGGGGTGAGGGATGG - Intergenic
998265542 5:140665069-140665091 CTGGCTGCAGGGGACGTGGACGG + Exonic
998606803 5:143643745-143643767 CTTGCTGGAGGGGTGAGGGAAGG - Intergenic
999277346 5:150340013-150340035 CTGATTGAGGGGGTGGGGCATGG - Intergenic
999713700 5:154341909-154341931 CTGGCTCATGGGATGGGGAAAGG - Intronic
1000163693 5:158626509-158626531 CTGGCTGAACGGGTGAGGGAAGG - Intergenic
1000329564 5:160196245-160196267 CTGGCAGAAGGGGTTGGATAGGG - Intronic
1000747013 5:165046149-165046171 GTGGCAGCAGGGCTGGGGGAGGG - Intergenic
1001564032 5:172688115-172688137 ACGGCTGAGGGGGTGGGGCAGGG - Exonic
1001706116 5:173742132-173742154 CTGGGTGTAGGAGTGGGGAATGG + Intergenic
1001808893 5:174611862-174611884 GGGGCCGAAGGGGTCGGGGAGGG + Intergenic
1002056939 5:176603550-176603572 CTGGCTTATGAGGTGGGGGAGGG + Intronic
1002108799 5:176894206-176894228 CTGGTGGAAGGGGTGGGGAAGGG + Intronic
1002136589 5:177111646-177111668 CTGGCTGATGGGGGGTGGGAGGG + Intergenic
1002305744 5:178281655-178281677 CTGGAGGAAGGGGTGCGGGTAGG - Intronic
1002436436 5:179234639-179234661 ATGGCTGATGGGTTGGGGTAGGG - Intronic
1003369210 6:5508533-5508555 CTGGCAGGTGGGGCGGGGGAGGG + Intronic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1004236076 6:13875282-13875304 TTGGGTGGGGGGGTGGGGGACGG + Intergenic
1004507072 6:16255414-16255436 CTGGCAGTAGGGGTGGGACATGG - Intronic
1004509918 6:16277117-16277139 CTGGTTGCAGGGCGGGGGGAAGG + Intronic
1004720965 6:18266716-18266738 CTCGCTGACGTGGTAGGGGACGG + Intergenic
1006323267 6:33333585-33333607 CTGTCTGGGGGAGTGGGGGAAGG + Intergenic
1006388360 6:33744861-33744883 GGGGCTGAAGGGGAGGGGGTGGG + Intronic
1006527565 6:34620137-34620159 CTAGCTGAAGGGGGCAGGGATGG + Intronic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1006782834 6:36643717-36643739 CTGAACGAGGGGGTGGGGGAGGG - Intergenic
1007079108 6:39086219-39086241 CTGTCTGATGGGTTTGGGGAGGG - Exonic
1007168450 6:39845592-39845614 CTGGGTGAAGCGGTGGGGAGTGG - Intronic
1007553363 6:42746656-42746678 TTGGGGGAAGGGGTGGTGGAAGG - Intergenic
1007622071 6:43221374-43221396 CTGGCAGAAGGAGGGGGGAACGG + Intronic
1007641332 6:43342322-43342344 TTGGCAGAGGGGGTGGGGGTGGG - Intronic
1007647029 6:43390917-43390939 TTAGGTGAAGGGGTGGGGGACGG - Intergenic
1008487292 6:52050179-52050201 CTGGCTGGCGGGGTGTGGCACGG - Exonic
1008561925 6:52732444-52732466 CTGACTGAGGGGGACGGGGATGG + Intergenic
1008627871 6:53335494-53335516 CAGACTGGTGGGGTGGGGGAGGG - Intronic
1008644303 6:53497971-53497993 TTGGCGGCAGGGGTGGGGGGTGG - Exonic
1010029941 6:71263013-71263035 CTGGCGGCGGGGGTGGGGGTTGG + Intergenic
1010487738 6:76435455-76435477 ATGGCTGAAGGGGTGTGGTGTGG + Intergenic
1010622911 6:78099409-78099431 ATGGCAGCATGGGTGGGGGAGGG + Intergenic
1010752502 6:79631257-79631279 CAGGCTGAAGGGGAAGGAGAGGG - Intergenic
1010846943 6:80720676-80720698 GTGGCGGTGGGGGTGGGGGATGG - Intergenic
1011216889 6:85014673-85014695 CTGGGTCACTGGGTGGGGGAGGG + Intergenic
1011259217 6:85454115-85454137 CTGGCTGATGGGTTTGGAGATGG + Intronic
1012468851 6:99547430-99547452 GATGCTGAAAGGGTGGGGGAGGG + Intronic
1012905145 6:105055771-105055793 CTGTCTGAAGGGTGGAGGGAAGG - Intronic
1012924937 6:105258281-105258303 TTGGCGGCGGGGGTGGGGGAGGG - Intergenic
1012930506 6:105311326-105311348 GTGGATGAAGGGCAGGGGGAAGG - Intronic
1013232459 6:108169982-108170004 CAGGTGGAGGGGGTGGGGGAAGG - Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013360827 6:109392528-109392550 CTGGATGAAGGGGAAGGGGCAGG + Intronic
1014013841 6:116506862-116506884 CAGGCTGGGGGGCTGGGGGAGGG + Intronic
1014448962 6:121561589-121561611 GTGGGTGGAGGGCTGGGGGAGGG - Intergenic
1015019414 6:128454112-128454134 TTGGCTGAAGGGGCAAGGGACGG - Intronic
1015503927 6:133962041-133962063 CTAGTTGAAGGAGTGGGGAAAGG + Intronic
1015613048 6:135046224-135046246 CTGACTGAAGGAGTCTGGGAAGG - Intronic
1015724810 6:136289388-136289410 CGGGCTGAAGAAATGGGGGAAGG + Intronic
1016622445 6:146127923-146127945 GTGGCTCAAAGGCTGGGGGATGG + Intronic
1016923417 6:149317759-149317781 CTGGCTGAGGGGGAGGGGAGGGG - Intronic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017511014 6:155114489-155114511 ATGGCTGTGGGGGTGGGGCATGG - Intronic
1018276341 6:162135744-162135766 AAGGCTGAAGGAATGGGGGAGGG + Intronic
1018448180 6:163877851-163877873 CTAGCTACAGGGGTGGGGGAAGG - Intergenic
1018740530 6:166725446-166725468 GAGGCTGAAGGGGAGGGTGAGGG - Intronic
1018838771 6:167504398-167504420 GTGGCGGGAGGGGTGGGGGTGGG + Intergenic
1019031596 6:169018440-169018462 CTGGCTAAAATGGTGGGGGCAGG + Intergenic
1019564343 7:1672018-1672040 CTGGCTGTAGGACAGGGGGAGGG - Intergenic
1019643966 7:2119338-2119360 CTGTCAGAAAGGGTGGGTGATGG - Intronic
1019652851 7:2169951-2169973 CTGGGTGGAGGGGTTGCGGAAGG + Intronic
1019712767 7:2524999-2525021 CTGCCTGAATGGGCGGGGGCGGG + Intronic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1019960972 7:4459129-4459151 AAGAATGAAGGGGTGGGGGAGGG + Intergenic
1020035642 7:4961365-4961387 CTGGGGGGTGGGGTGGGGGATGG + Intergenic
1020079994 7:5282111-5282133 CTGGATGGAAGGGTGGGGGGAGG + Intronic
1020459296 7:8410590-8410612 CTGACTCTAGGGGTGGGGCAGGG + Intergenic
1021099783 7:16574648-16574670 GGGGCTGGAGGGCTGGGGGAGGG + Intronic
1021451779 7:20788930-20788952 AAGGAGGAAGGGGTGGGGGAAGG + Intergenic
1021777968 7:24072469-24072491 CTGGCAGATGGGCTGGGGGAAGG + Intergenic
1021821136 7:24498548-24498570 ATAGCTGAGGGGTTGGGGGAGGG + Intergenic
1022366427 7:29723948-29723970 CTGGCTGCAGGGATGAGAGAGGG - Intergenic
1022427029 7:30278754-30278776 CTGACTGAAGGGATGGGGATTGG - Intergenic
1022474200 7:30699693-30699715 CTGGGTGAGGGGGCAGGGGAAGG - Intronic
1022514927 7:30969438-30969460 CTGGCTGCAAGGGTGGAGGAGGG + Intronic
1022701209 7:32762080-32762102 GGGGCTGAAGGCGTTGGGGAGGG - Intergenic
1023677102 7:42642269-42642291 CTGGTTGAAGAGGGGAGGGAAGG + Intergenic
1024365784 7:48518958-48518980 TTGGGGGATGGGGTGGGGGAGGG - Intronic
1024477627 7:49830659-49830681 TGGGGTGAGGGGGTGGGGGAGGG - Intronic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1025032050 7:55565735-55565757 CTGGCTGCAGGGGTGGAGGTGGG + Intronic
1025113889 7:56241458-56241480 CTTGTTGGAGGGGCGGGGGAGGG - Intergenic
1025198920 7:56950105-56950127 CTGGATGGAAGGGTGGGGGGAGG - Intergenic
1025247849 7:57330934-57330956 TTGGCCGAAGGGCTGGGGCATGG - Intergenic
1025673026 7:63626828-63626850 CTGGATGGAAGGGTGGGGGGAGG + Intergenic
1025728944 7:64092976-64092998 CTTGTTGTAGGGTTGGGGGATGG + Intronic
1026176587 7:68002906-68002928 GAGGGTGAGGGGGTGGGGGATGG + Intergenic
1026477156 7:70746701-70746723 GTGGCTGAAGGAGAGGGAGAGGG + Intronic
1026869618 7:73842328-73842350 GGGGCTGCAGGGCTGGGGGAAGG + Intronic
1027272730 7:76532615-76532637 CTGGGAGCAGGGGTGGGGGGAGG - Intergenic
1027326178 7:77051700-77051722 CTGGGAGCAGGGGTGGGGGGAGG - Intergenic
1027476925 7:78643727-78643749 ATGGCACAAGGGGTGGGGGATGG + Intronic
1027631243 7:80608911-80608933 CTGGCTATGGGGGTGGGGGTGGG - Intronic
1027708101 7:81560156-81560178 CTGTCTGAGGGGGTCAGGGATGG + Intergenic
1027936322 7:84608199-84608221 TTGGATGGAGAGGTGGGGGAAGG - Intergenic
1028446611 7:90931583-90931605 ATGGCTGATGTGATGGGGGAAGG + Intronic
1028511576 7:91630973-91630995 CTGGCTGAAGGATTGGGAGGAGG + Intergenic
1028884619 7:95917561-95917583 ATGACTGAAGGGATTGGGGATGG - Intronic
1029181254 7:98703605-98703627 CTGGCGGAAGGGATGGGAAACGG - Intergenic
1029365473 7:100113604-100113626 CTGCCTCAAAGGTTGGGGGAGGG - Exonic
1029436783 7:100568169-100568191 CTGGTTGATGGGGAGTGGGAAGG + Exonic
1029487939 7:100854489-100854511 TTGGCTGAAGGGTTTGGGGAGGG + Intronic
1029514378 7:101016686-101016708 GAGGCTGAGGGGGTGGGGGGAGG + Intronic
1029647884 7:101869558-101869580 GTGGCTGGTGGGGCGGGGGAGGG + Intronic
1030014599 7:105206145-105206167 CTGGGTGGTGGGGTGGGGGTGGG - Intronic
1030458440 7:109801788-109801810 ATGGCAGCAGGGGTTGGGGAGGG + Intergenic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031598015 7:123670052-123670074 CTGGATGGAGGGGTGGGGGCTGG + Intergenic
1031598024 7:123670092-123670114 CTGGATGGAGGAGTGGGGGCTGG + Intergenic
1032263265 7:130353142-130353164 ATGGCTGGAGGGGAGAGGGAAGG - Intronic
1032417450 7:131747323-131747345 GTGTATGGAGGGGTGGGGGATGG + Intergenic
1032504339 7:132424348-132424370 ATGGCTGAAGGGGCTGAGGAGGG + Intronic
1033212126 7:139467801-139467823 CTGGGTGTCGGGCTGGGGGACGG - Intronic
1033213880 7:139480350-139480372 CAGGCTGAGGGGGTGGGTGCTGG - Intronic
1033268972 7:139913686-139913708 CTGCGTGGAGGGGTGGGTGAGGG - Intronic
1033277722 7:139985301-139985323 CAGGCTAGAGGGGTGGGGGGTGG - Intronic
1033305233 7:140220444-140220466 CTGGTTGAAGGGGTGGGAAGGGG + Intergenic
1034113762 7:148563821-148563843 TTGCCTGAAGGGGAGAGGGAGGG + Intergenic
1034415597 7:150962914-150962936 CTGGCTGAAGAGCTGGGAGCAGG - Intronic
1034438240 7:151073946-151073968 CGGGTGGAAGGGGTGGGGCAGGG - Intronic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034678172 7:152907558-152907580 CAGTCAGAAGGGGTGAGGGAGGG - Intergenic
1034832568 7:154322095-154322117 TGGGCTGAGGAGGTGGGGGAGGG - Intronic
1035107780 7:156456636-156456658 CTGGCTGAAGGAGTGGAGTGGGG + Intergenic
1035574822 8:697690-697712 GTGGCTGAGGGGGCGGGGGCGGG - Intronic
1035808943 8:2475091-2475113 CTTGGTGATGGGGTGGGAGAGGG - Intergenic
1036188319 8:6645143-6645165 GTGGCTGATGTGGTGGGGGATGG - Intergenic
1036210171 8:6834943-6834965 CTCGCAGAAGGGGTGGCGGGGGG - Intronic
1036789152 8:11706757-11706779 CAATCAGAAGGGGTGGGGGAAGG - Intronic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1037484726 8:19336499-19336521 TTGGTTGGAGGGGTGTGGGAAGG - Intronic
1037618556 8:20543165-20543187 CTGGGTGAAGGGGTTGTGGGCGG + Intergenic
1038585333 8:28783355-28783377 CTGGATGCTGGGGTGGGGCAAGG - Intronic
1038609713 8:29049125-29049147 GTGGCTGATGGGGTGGGGGAGGG + Intronic
1038867832 8:31458878-31458900 TGGGGTGAGGGGGTGGGGGATGG + Intergenic
1038911768 8:31972688-31972710 CTGGCTGCAGGAGTGGTGAAGGG - Intronic
1039059736 8:33564179-33564201 GTTTCTGAAGGGGTGAGGGAAGG + Intronic
1039464671 8:37776041-37776063 CTGCCTCGAGGGGTGGGGGTAGG + Intronic
1040753399 8:50739569-50739591 CTGGATGTGGGGCTGGGGGAGGG + Intronic
1041156354 8:54991005-54991027 TTGGGTGGTGGGGTGGGGGAGGG + Intergenic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1041681236 8:60594623-60594645 GGGGTTGAAGGGCTGGGGGAGGG - Intronic
1042062085 8:64830545-64830567 CAGGATGAAGGGTTGGGGGTGGG - Intergenic
1042751454 8:72162388-72162410 CTGTCTGTCGGGGTGGGGGCAGG - Intergenic
1043175437 8:77018826-77018848 ATGGCAGGAGGGGTGGGAGAGGG - Intergenic
1043785427 8:84392590-84392612 CAGCCTGAAGGAGTTGGGGAGGG + Intronic
1043791589 8:84475051-84475073 CTGGGTGGGGGGCTGGGGGAGGG - Intronic
1043945892 8:86252425-86252447 GTGGCTAAAGGGGTGTGAGAGGG - Intronic
1044590406 8:93908844-93908866 CTGGCTGAAGCCGTGGCAGAAGG - Intronic
1044721775 8:95157612-95157634 CTGGTTGAGGGGTTGGGGGTGGG + Intergenic
1045102389 8:98858561-98858583 CTGGCTGAAGGGATAGTGGGAGG + Intronic
1045139401 8:99263580-99263602 CTGGCTTTAGAGATGGGGGAAGG - Intronic
1045143536 8:99313875-99313897 ATGGCAGCAAGGGTGGGGGAGGG - Intronic
1045165004 8:99593903-99593925 ATGGGTGGAGGGGTGAGGGAGGG + Intronic
1045472997 8:102529035-102529057 CTGGCTGCCGGGGTGGGGCGGGG - Intronic
1045519906 8:102894576-102894598 GTGGATGTGGGGGTGGGGGATGG + Intronic
1045888095 8:107123403-107123425 CAGGCTGGTGGGGCGGGGGACGG - Intergenic
1046131727 8:109974799-109974821 GTGGGTGGAGGGGTTGGGGAAGG + Exonic
1046669067 8:117037507-117037529 CTGGCTTAAGCGGTGGGTGAGGG - Intronic
1047456379 8:125016993-125017015 CTGCCTGGAGCTGTGGGGGACGG + Intronic
1047492848 8:125388672-125388694 CTCGGGGAAGGGGTGGGGGGAGG - Intergenic
1047521587 8:125599196-125599218 ATGGCAGAAGGGGTAGGGGCAGG + Intergenic
1047629512 8:126691827-126691849 GGGGCTGCAGGGGTGGGGGTTGG + Intergenic
1047838615 8:128721697-128721719 GTGGGAGTAGGGGTGGGGGAGGG - Intergenic
1048254903 8:132898336-132898358 CTGGCTGAAGGGCTGGGCCATGG - Intronic
1048898573 8:139016495-139016517 AGGGATGAAGGGGTGAGGGATGG + Intergenic
1049008706 8:139873432-139873454 CCTGATGGAGGGGTGGGGGAAGG - Intronic
1049150249 8:141030529-141030551 GTGGCAGAAAGGGTGGGGCAAGG - Intergenic
1049200781 8:141339612-141339634 CAGGCTCAAGGCCTGGGGGAAGG - Intergenic
1049223151 8:141436960-141436982 CTGGGTGGGGGGGTGGGGGGTGG + Intergenic
1049320521 8:141993815-141993837 TTGGGGGAAGGGCTGGGGGAGGG - Intergenic
1049433679 8:142576647-142576669 CTGGCAGGAGGGCTGGGGGCAGG - Intergenic
1049464533 8:142744832-142744854 ATGGGTGGATGGGTGGGGGATGG + Intergenic
1049464581 8:142744974-142744996 ATGGGTGGATGGGTGGGGGATGG + Intergenic
1049526544 8:143129745-143129767 CAGGCTTCAGGGCTGGGGGAAGG + Intergenic
1049570275 8:143367051-143367073 CTGGCGAAGGGGGTGGGTGAAGG + Intergenic
1049600599 8:143505677-143505699 GTGGCTGAGGGGGTGTGTGAGGG - Intronic
1049608524 8:143541246-143541268 GTGGCGGCTGGGGTGGGGGACGG - Intronic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1050037711 9:1454726-1454748 ATGGCTGAAGTGGGAGGGGAAGG - Intergenic
1051051935 9:12944142-12944164 TGGGGTGAAGGGATGGGGGAGGG + Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1053194818 9:36108932-36108954 ATGGTTGAAGGGGTAGGGGATGG - Intronic
1053404430 9:37859850-37859872 CGGGGTGAAGGTGTGGGGAAAGG - Intronic
1053641027 9:40080252-40080274 CTGGCAGGGGGGTTGGGGGATGG + Intergenic
1053662761 9:40295896-40295918 CTGGCTGTAGGGTGGTGGGAGGG + Intronic
1053765109 9:41385216-41385238 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1053913207 9:42926071-42926093 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1054321769 9:63676548-63676570 CTGGCAGGCGGGTTGGGGGATGG + Intergenic
1054374890 9:64442120-64442142 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1054451974 9:65408209-65408231 GTGGATGATGGGGTGGGGGGAGG - Intergenic
1054521448 9:66077626-66077648 CCGGCTGTAGGGTTGTGGGAGGG - Intergenic
1054521852 9:66080388-66080410 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1054543725 9:66296378-66296400 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1055563230 9:77542838-77542860 CAGGCTGAAGTAATGGGGGAAGG + Intronic
1056246587 9:84701519-84701541 AGGGCTTAGGGGGTGGGGGAGGG + Intronic
1056380301 9:86051739-86051761 CTGGCTGCGGGGGTGGGAGTTGG - Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056586337 9:87929869-87929891 CTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1056610545 9:88123074-88123096 CTGGCTGTAGGGTGGTGGGAGGG + Intergenic
1057030777 9:91773694-91773716 CTGGCTTATGGGCTGGGGCAAGG - Intronic
1057189044 9:93075996-93076018 GTGGCTCTGGGGGTGGGGGATGG + Intronic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1057411050 9:94816737-94816759 CTGGGTTAGGAGGTGGGGGAAGG + Intronic
1057677868 9:97149889-97149911 CTGGCTGTAGGGTTGTGGAAGGG - Intergenic
1057874973 9:98746915-98746937 CTGGCTGAAGACGTGGGTGTGGG - Intronic
1058560333 9:106221761-106221783 TTGGCAGAAGGGGAGTGGGAGGG - Intergenic
1058643454 9:107108972-107108994 ATGGCAGCAGGGGTTGGGGATGG - Intergenic
1058725517 9:107799808-107799830 CTGGCTGAAGAAGTTGAGGATGG + Intergenic
1059806552 9:117807313-117807335 CTGGCTGAAAAGTTGGGGAAAGG - Intergenic
1059878815 9:118667299-118667321 GAGGCTGATGGGGTGGGGGTGGG - Intergenic
1060043271 9:120320031-120320053 ATGACTGAAGGGGTGGGGAAAGG - Intergenic
1060059669 9:120447927-120447949 CTGGCTGAAGCAGTGATGGAGGG - Exonic
1060087609 9:120715556-120715578 CTGGTTGCAGGGGTTGGGGTGGG + Intergenic
1060337276 9:122737349-122737371 CCGGGTGGAGGGCTGGGGGAGGG - Intergenic
1060528559 9:124334227-124334249 CTGGCTGGATGGATGGGTGATGG + Intronic
1060551597 9:124488047-124488069 GTGGCTGCAGGGGTGGGGACGGG - Intronic
1060656114 9:125373984-125374006 CTGGCTGGAGGGGAAGGAGAAGG - Intergenic
1060867962 9:127014767-127014789 AAGGCTGATGAGGTGGGGGATGG - Intronic
1061005831 9:127928037-127928059 CTTGCGGCAGGGGTGGGGCAGGG - Intronic
1061313062 9:129776786-129776808 CTGGCTCCAGGGGTGGGGGTGGG - Intergenic
1061371013 9:130197604-130197626 CTGGCGGGAGGGCTGGGGGCAGG + Intronic
1061397237 9:130349717-130349739 CTGGATGTGGGGGTTGGGGAAGG + Intronic
1061654645 9:132079612-132079634 CCGGCTGAAGGGGCCGGGGTCGG - Intronic
1061858720 9:133457012-133457034 AAGGCTGGAGGGGTGGGGGCGGG - Intronic
1061911816 9:133729036-133729058 ATGGATGAAGGGAAGGGGGATGG + Intronic
1061939587 9:133876811-133876833 CTGGGTGCAGGGGTGAGGCAGGG + Intronic
1061963064 9:133998135-133998157 ATGGCTGGAGGGATGTGGGATGG - Intergenic
1062097396 9:134710449-134710471 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097453 9:134710603-134710625 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097498 9:134710732-134710754 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097525 9:134710798-134710820 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097538 9:134710832-134710854 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097559 9:134710894-134710916 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097572 9:134710927-134710949 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097585 9:134710960-134710982 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062097605 9:134711022-134711044 TTGGGTGCAGTGGTGGGGGAGGG + Intronic
1062132719 9:134908626-134908648 CTGGCTTTGGGGTTGGGGGAAGG + Intronic
1062231212 9:135482429-135482451 CTGGCTGAAGTGATGGGGATGGG - Intronic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062523218 9:136968199-136968221 GTGGCTGGGCGGGTGGGGGAGGG + Intergenic
1062578977 9:137221419-137221441 GAGGAGGAAGGGGTGGGGGAGGG + Intronic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062708807 9:137960394-137960416 CTGACTGGGGGGGAGGGGGAGGG + Intronic
1203769381 EBV:41119-41141 CGGGGTGCTGGGGTGGGGGATGG - Intergenic
1203789659 EBV:144038-144060 CGGGGTGCTGGGGTGGGGGATGG - Intergenic
1185867936 X:3639465-3639487 ATGGATGAAGGGGTAGGGGGTGG + Intronic
1185868268 X:3641782-3641804 GTGGACGAATGGGTGGGGGAAGG + Intronic
1186084683 X:5974147-5974169 CTGAATGAAGGGGTGGGGAATGG + Intronic
1186349796 X:8730583-8730605 CTGGGTCAAGGGGTGGGGGGGGG - Intronic
1186459198 X:9734811-9734833 CTGGCAGGAGGGGTGGGGACTGG - Intronic
1186517768 X:10179277-10179299 TGGGCTGAAGGGGCAGGGGAGGG + Intronic
1186796347 X:13050316-13050338 CTGACTCAAGGTGTGGGGGAGGG + Intergenic
1187053592 X:15718569-15718591 CTCGCAGAAGGGGTGAGGGAAGG - Intronic
1187197174 X:17098864-17098886 CTGGCTGAGGTGTTGGGGAAGGG - Intronic
1187678633 X:21743537-21743559 TTGGCTGAAGGGAAGGGAGAAGG + Intronic
1187770398 X:22689533-22689555 AGATCTGAAGGGGTGGGGGAGGG - Intergenic
1189044699 X:37578132-37578154 CTAACTGAAGTGGTGAGGGAAGG + Intronic
1189252514 X:39612521-39612543 CTGGCTCCTGGGATGGGGGAAGG - Intergenic
1189311299 X:40019913-40019935 CTGGCTTTTGGGGTGGGGGTGGG - Intergenic
1190894234 X:54600562-54600584 CTGGTTGAAGTGGGTGGGGATGG + Intergenic
1191177170 X:57516721-57516743 CTGGTTGCAGCGGTGGTGGAGGG + Intergenic
1191726047 X:64282355-64282377 CTGTCAGAAGGGGTGGGGGTAGG + Intronic
1192029639 X:67495486-67495508 ATGGCAGAAGGGGAAGGGGAAGG - Intergenic
1192204512 X:69087197-69087219 CTGTCTGCAGGAGTGGGGCAAGG + Intergenic
1192227805 X:69241399-69241421 CTGGCAGTAGGGCTGGGGCAGGG - Intergenic
1192343097 X:70280372-70280394 CTGGGAGAAAGGGTGGGGAATGG - Intronic
1192415769 X:70979242-70979264 ATGGTTGAAAGGGTGGGGGTAGG + Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1192587962 X:72335095-72335117 CTGCCTGTAGGGGAAGGGGAAGG - Intronic
1192644269 X:72888164-72888186 AGGGCTGGAGGGGAGGGGGAGGG - Intronic
1192661905 X:73050343-73050365 ATGGCAGCATGGGTGGGGGAGGG + Intergenic
1192707465 X:73541429-73541451 CTGGGTGAAGGGGTGGCTGTGGG + Intergenic
1193915206 X:87354794-87354816 ATGGCAGCATGGGTGGGGGAGGG + Intergenic
1195105450 X:101598848-101598870 CTGGAGGCGGGGGTGGGGGAAGG + Intergenic
1195107432 X:101614919-101614941 CTGGAGGCGGGGGTGGGGGAAGG - Intergenic
1195455977 X:105070275-105070297 AAGCCTGAAGGGTTGGGGGAAGG - Intronic
1195470105 X:105220584-105220606 CTGGCTGAAGAGGTGAGGCCTGG - Exonic
1195732745 X:107982299-107982321 CTGGCTGAAGAGGTGAGGCCTGG - Exonic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1197603056 X:128553570-128553592 CTGGCTGCAGGGGTGGGGTGGGG - Intergenic
1197714640 X:129697573-129697595 TAGGCTGAAGAGATGGGGGAGGG + Intergenic
1197734693 X:129842170-129842192 CTGACTGAAGGGGTGGGGACGGG + Intronic
1197774625 X:130110996-130111018 CGGGCGGGCGGGGTGGGGGAGGG + Intergenic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1198087303 X:133293352-133293374 CTGGCAGTAGGGGTGAGGGTGGG + Intergenic
1198178069 X:134174572-134174594 CTGGGAGGAGGGGTGGGAGATGG - Intergenic
1198409852 X:136355580-136355602 GTTCTTGAAGGGGTGGGGGAAGG - Intronic
1198962523 X:142197327-142197349 CGGGCTGATGGGTTGGGGGTAGG - Intergenic
1199150461 X:144478928-144478950 GGGGTAGAAGGGGTGGGGGAGGG + Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1200064893 X:153499636-153499658 CTGCCTGAGGGGCTGGGGGCTGG - Intronic
1200065249 X:153501711-153501733 CAGGCTGGAGGGGCGGGGGCCGG - Intronic
1200282143 X:154786062-154786084 CTGGCATAATGGGTGGGGGAGGG - Intronic
1200394417 X:155975097-155975119 CTGGCTGAAGGGCTACTGGATGG - Intergenic
1200751977 Y:6954381-6954403 GTGGCTGCAAGGCTGGGGGAGGG - Intronic
1200795934 Y:7341282-7341304 GTGGACGAATGGGTGGGGGAAGG - Intergenic
1201073155 Y:10168535-10168557 CTGGCTGAGGGTGGGGAGGAGGG + Intergenic