ID: 1192439355

View in Genome Browser
Species Human (GRCh38)
Location X:71163419-71163441
Sequence GGACCTGCCCTGAAAATGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192439342_1192439355 20 Left 1192439342 X:71163376-71163398 CCCAGAGTTTCTGATTCCTTAGG 0: 2
1: 12
2: 175
3: 607
4: 1298
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439338_1192439355 26 Left 1192439338 X:71163370-71163392 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439339_1192439355 25 Left 1192439339 X:71163371-71163393 CCCACCCCAGAGTTTCTGATTCC 0: 6
1: 39
2: 233
3: 701
4: 1544
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439340_1192439355 24 Left 1192439340 X:71163372-71163394 CCACCCCAGAGTTTCTGATTCCT 0: 1
1: 7
2: 38
3: 151
4: 554
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439352_1192439355 -6 Left 1192439352 X:71163402-71163424 CCAAGGGAGGGAAATGAGGACCT 0: 1
1: 0
2: 4
3: 23
4: 270
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439344_1192439355 19 Left 1192439344 X:71163377-71163399 CCAGAGTTTCTGATTCCTTAGGC 0: 1
1: 4
2: 31
3: 271
4: 949
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439341_1192439355 21 Left 1192439341 X:71163375-71163397 CCCCAGAGTTTCTGATTCCTTAG 0: 2
1: 18
2: 146
3: 557
4: 1261
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439351_1192439355 -3 Left 1192439351 X:71163399-71163421 CCTCCAAGGGAGGGAAATGAGGA 0: 1
1: 0
2: 1
3: 43
4: 304
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185
1192439349_1192439355 4 Left 1192439349 X:71163392-71163414 CCTTAGGCCTCCAAGGGAGGGAA 0: 1
1: 0
2: 1
3: 29
4: 244
Right 1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192439355 Original CRISPR GGACCTGCCCTGAAAATGAG GGG Intronic
901837608 1:11934568-11934590 GGAGCTGCCCTAATAAGGAGAGG + Intronic
905495881 1:38385523-38385545 GGACCTTCTCAGAAAATGAAAGG - Intergenic
907490370 1:54805533-54805555 GTCCCTGCCCTGAAAATAATGGG - Intergenic
910547366 1:88433239-88433261 GGACCTGCCCTGAGCCAGAGAGG + Intergenic
911019876 1:93375530-93375552 GGACCTGCCCTGGATGAGAGGGG + Intergenic
912106207 1:106278828-106278850 GGACCTGCCCTCAATGTGGGTGG - Intergenic
912499464 1:110112477-110112499 GGAGCTGCCCTGAAGATTAGGGG - Exonic
913465292 1:119135142-119135164 GGAGCTGCACCGTAAATGAGTGG - Intronic
913574461 1:120156885-120156907 AGAGATGCCCTGAAAATGAAAGG - Exonic
913664181 1:121032280-121032302 GGACCTGCAGTGAAGCTGAGGGG + Intergenic
914015573 1:143815559-143815581 GGACCTGCAGTGAAGCTGAGGGG + Intergenic
914162210 1:145145449-145145471 GGACCTGCAGTGAAGCTGAGGGG - Intergenic
914654192 1:149724100-149724122 GGACCTGCAGTGAAGCTGAGGGG + Intergenic
914935475 1:151975411-151975433 GGGAGTGCCCTGAAAATGACTGG + Intergenic
915687582 1:157650157-157650179 GGACCTGGAATGAGAATGAGGGG - Intergenic
916360593 1:163963012-163963034 GAACCTGCCCTGAACAAGAGGGG + Intergenic
917364038 1:174209336-174209358 GGACCTGCCCTGGACCAGAGGGG + Intronic
918140492 1:181715679-181715701 GGACCTTCTCTTAAAATGTGTGG + Intronic
918266557 1:182847528-182847550 GAATCTGCCCTGTACATGAGTGG + Intronic
918570651 1:185987928-185987950 AGACCTGCGCTGAAATTAAGAGG + Intronic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
920623682 1:207574960-207574982 TGACCTGACCCAAAAATGAGGGG - Intronic
921002298 1:211056146-211056168 GGACCTGCCCTAAGACAGAGGGG + Intronic
922997521 1:229976331-229976353 TGCTCTGCCCTGAAAACGAGGGG + Intergenic
923250646 1:232176946-232176968 GGGCCAGTCCTGAAACTGAGGGG - Intergenic
1062958235 10:1554138-1554160 GGGCCTGCCCTGCAGATGGGTGG - Intronic
1063263112 10:4412964-4412986 GGAACTGACCTGAAGAGGAGGGG - Intergenic
1065746827 10:28849641-28849663 GGAGCTGCCCAGAAAAAGTGTGG - Intronic
1069248827 10:66243989-66244011 GGACCTGCCCTGGACCAGAGGGG + Intronic
1071737637 10:88318898-88318920 GCACCTGCCCTGATATAGAGGGG - Intronic
1076668342 10:132105298-132105320 GGAACTGACCTGAAACAGAGTGG + Intronic
1076771047 10:132665040-132665062 GGACCTGCCCTGCACAGGCGGGG - Intronic
1080458047 11:32432778-32432800 AGACCTGCCCTGAAAAGGGCTGG + Intronic
1080554836 11:33406609-33406631 AGACCTGCCCTGAATTTCAGGGG - Intergenic
1081753775 11:45530592-45530614 GGACCTGCAATGAAAATAAATGG - Intergenic
1083537989 11:63489821-63489843 GGAGCTCTACTGAAAATGAGGGG - Intronic
1086403033 11:86476246-86476268 GAAACAGCCCTGAAAATGAAAGG + Intronic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1090922900 11:131222417-131222439 GGGCCTGCCCTGGGAAGGAGAGG - Intergenic
1091148441 11:133302203-133302225 GGTCCTGCCCTGGAAATGAGGGG - Intronic
1091980596 12:4860997-4861019 GGAACTGCTCTGAAAATAACTGG + Intergenic
1092497667 12:9012747-9012769 GGACCTGCCCTGAGTCAGAGGGG + Intergenic
1094373148 12:29760178-29760200 GGACATGTTCTGAGAATGAGTGG - Intronic
1095227552 12:39695340-39695362 GGACCTGCCCTGGACCAGAGGGG + Intronic
1095965859 12:47866596-47866618 GAACCTGCCCAGAAAAAGAAGGG + Intronic
1097224569 12:57469739-57469761 GGACCTGCCCTGAGGTTGAGAGG + Intronic
1100269547 12:93011526-93011548 GGTTCTGCCCTGAAAGTGAGGGG - Intergenic
1103016433 12:117498307-117498329 GGCCCTGCCCTGAATTTGGGGGG - Intronic
1103855558 12:123967297-123967319 TGACCTTCCTTGAAAATGACAGG + Intronic
1104466906 12:128997930-128997952 GGCCCTGCCCTCAACATGTGGGG - Intergenic
1105608333 13:21945724-21945746 GGTCCTGCCCTTAACATGTGAGG + Intergenic
1106645501 13:31629704-31629726 GGACCTGCCCTGGACCAGAGGGG - Intergenic
1109513156 13:63405435-63405457 GGACCTGCCCTTGATATGTGGGG + Intergenic
1114783715 14:25570058-25570080 GGACCTGCCCTGGGACAGAGGGG - Intergenic
1116045758 14:39740606-39740628 GGACCTGCCCTGATCCAGAGGGG + Intergenic
1116121985 14:40732181-40732203 GGACCTGCCCTGGGCAAGAGTGG - Intergenic
1117264903 14:54076707-54076729 GGACCTGCCCTGGGACAGAGGGG - Intergenic
1118025912 14:61768955-61768977 GGACCTGGACTGAAGATGTGTGG + Intronic
1121434458 14:93910015-93910037 GGTCCTCCCCTGAAAATCAAAGG + Intergenic
1122048757 14:99041242-99041264 AGACCTGCCCTGAATGGGAGGGG - Intergenic
1124188690 15:27552383-27552405 GGACCTTCCCTATAAATGTGAGG - Intergenic
1129030602 15:72615110-72615132 GGGCCTGCCCTGAGACAGAGGGG - Intergenic
1129209626 15:74060202-74060224 GGACCTGCCCTGAGACAGAGGGG + Intergenic
1130521056 15:84660820-84660842 GGACATGCACAGAAAATGTGAGG + Intergenic
1132679775 16:1134948-1134970 GGACGGGCCCTGAAATTGGGAGG - Intergenic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1132923250 16:2411274-2411296 GGAGCTGCCCTGGAAATCAGTGG - Intergenic
1133149623 16:3817939-3817961 TGCCCTTCCCTGAAAATGAGGGG - Intronic
1133747888 16:8701428-8701450 GGCCCTGCCCTTAGAAGGAGAGG + Intronic
1142695313 17:1629709-1629731 GGACCTTCCCTGAAAGGGACGGG - Intergenic
1145746577 17:27324574-27324596 GGACCTCACCAGAAAATGAGGGG + Intergenic
1149626205 17:58082839-58082861 GGACCTTCCCGGAAGGTGAGGGG + Intergenic
1151599068 17:75095145-75095167 GGTCCTGCCCTCAAACTGGGAGG + Intronic
1151799000 17:76366459-76366481 GCACCTGCCCTGAAAGAAAGAGG + Intronic
1152024680 17:77801242-77801264 GGACCTGGCCTTAAAATGGGGGG + Intergenic
1157296615 18:46449561-46449583 GGTCCTGCCCTTAACATGTGGGG - Intronic
1157325469 18:46665644-46665666 GCTCCTGCCCGGAAAAGGAGGGG - Intergenic
1158231199 18:55257266-55257288 GAACATGACCTGAAAATGGGTGG + Intronic
1159097023 18:63914755-63914777 GTACCTGGCCTGAAAATGACAGG - Intronic
1159954111 18:74507439-74507461 GGAGCAGCCCAGAAAAGGAGTGG - Intronic
925188497 2:1865222-1865244 GGACCTGCACTGGATGTGAGAGG + Intronic
925794829 2:7530406-7530428 GGTCCCTCCCTCAAAATGAGAGG + Intergenic
925830854 2:7894260-7894282 GGTCCTGCCCTTGACATGAGGGG - Intergenic
929008643 2:37419549-37419571 GGACCTACCCTTAAAGTAAGGGG + Intergenic
930230654 2:48840967-48840989 GGAACTGCCCTGAACCAGAGGGG - Intergenic
931600827 2:64001275-64001297 GGACCTGCCCTGGACCAGAGGGG - Intronic
937115897 2:119404743-119404765 GGACCTGCAATGAAAATGCAGGG + Intergenic
937736193 2:125293674-125293696 GGACCTGCCCTCAATCTGGGTGG + Intergenic
937884528 2:126890770-126890792 GGACCTGCCCTGAGGAGAAGTGG - Intergenic
938377647 2:130819264-130819286 GGTGTTGGCCTGAAAATGAGGGG + Intergenic
940425417 2:153525790-153525812 GGACCTGCCCTGGACCAGAGAGG + Intergenic
942382132 2:175403024-175403046 GAGCCTGCCATGAAAATGAGCGG - Intergenic
942972241 2:181970976-181970998 GGACCTGTCCTGAAATAGAGGGG - Intronic
942988164 2:182166270-182166292 AGACCTACCCTGAATATGGGCGG + Intronic
943235792 2:185317701-185317723 GTACATGCCTAGAAAATGAGGGG - Intergenic
943237221 2:185337941-185337963 GGACCTGCCCTGGACCAGAGGGG - Intergenic
947505310 2:230704043-230704065 GGACCTGCCCTGGACCAGAGGGG - Intergenic
948016924 2:234698758-234698780 GTAAGTGCCCTAAAAATGAGTGG - Intergenic
1170243373 20:14194353-14194375 AGACCTGACTTGAAAATGATGGG + Intronic
1172344956 20:34190878-34190900 AGACATTCCCTGAAAAAGAGAGG - Intergenic
1172414061 20:34749958-34749980 GGACCAGCCCAGATAATGAGGGG - Exonic
1172657336 20:36545120-36545142 GGAGGTGCCCTGTAAATGATTGG - Intronic
1173004138 20:39126809-39126831 GGACCTGCCCTGGACCAGAGAGG - Intergenic
1174837328 20:53869836-53869858 GGCCCTCACCTGAAAATGAAGGG - Intergenic
1175379296 20:58551831-58551853 GGGCCTGCCCTGAAAGGGAATGG - Intergenic
1177761461 21:25406870-25406892 GGACCTGCCCTGAGCCAGAGCGG - Intergenic
1179080647 21:38167481-38167503 GGAGCTGCCCTGTACATTAGAGG - Intronic
1179585137 21:42370013-42370035 GGCCCCCCACTGAAAATGAGGGG - Intergenic
1181329098 22:22075240-22075262 GGACATGCCCTGGACATGGGAGG - Intergenic
1182405947 22:30130548-30130570 AGACCTGTCCTGAAAGTGTGTGG - Intronic
1182718192 22:32376733-32376755 GGACCTGCCCTGGACGTGGGAGG - Intronic
949845040 3:8361359-8361381 GGACCAGCCCTGGAAGTGGGAGG + Intergenic
950970476 3:17181698-17181720 AGACATGCCCTGAAAATCTGTGG - Intronic
954371996 3:50173945-50173967 GGGCCAGCCCTTACAATGAGGGG - Exonic
956439720 3:69268239-69268261 GAGACTGCCCTGGAAATGAGAGG + Intronic
959189850 3:103097377-103097399 GGACCTTCCCTGAGACAGAGGGG - Intergenic
959191179 3:103113301-103113323 GGACCTGCCCTGGGACAGAGAGG + Intergenic
959926482 3:111927224-111927246 GGACCTCCCTTAAAAATGACTGG + Intronic
960541174 3:118864281-118864303 GGACCTGCCCTGGGAAAGAAGGG - Intergenic
961870590 3:129984882-129984904 GCACCTTCCCTGAATGTGAGAGG - Intergenic
963898101 3:150707094-150707116 GGTCCTGCCCTCAACATGTGGGG + Intergenic
965250848 3:166342446-166342468 GGACCTGCCCTGAGTCAGAGGGG + Intergenic
966170749 3:177077381-177077403 AGATCTCACCTGAAAATGAGGGG + Intronic
967018632 3:185503466-185503488 GGGCCTGTGCTGTAAATGAGTGG - Intergenic
968090979 3:195898003-195898025 GGAGCTGCCCTGTAAATGTCTGG - Intronic
969456619 4:7303864-7303886 GGACCTGTCCTGAGAGTGTGGGG + Intronic
969840421 4:9877665-9877687 GGCCCTGCCCTGCAAGTGAAAGG - Intronic
970041430 4:11801407-11801429 GGCCCTGCCCTTGAAATGTGGGG + Intergenic
971012685 4:22456352-22456374 GGACCTGCCCTCAGTATGGGTGG + Intronic
972430997 4:38982065-38982087 AGACCTGCCCTCAATCTGAGTGG + Intronic
976427933 4:84928065-84928087 AGATCTGCCCTCAATATGAGTGG + Intronic
976431432 4:84966586-84966608 GGACCATCCCGGAAAGTGAGGGG + Intergenic
978676682 4:111327000-111327022 GGACCTGCCCTGAACCAGAAAGG - Intergenic
980264187 4:130493800-130493822 GGACCTGCCCTTGACATGTGGGG + Intergenic
980712761 4:136591564-136591586 GGACCTGCCCTGAACCAGAAAGG + Intergenic
981937216 4:150250702-150250724 GGACCTTCCCAGAGGATGAGAGG - Intronic
982142811 4:152344242-152344264 GGACCAGCCCTGAAAATAAAGGG + Intronic
983456300 4:167968867-167968889 GCACCTGCCCTGGAACAGAGGGG + Intergenic
986063318 5:4212171-4212193 GGAGCTTCCCTGAAGAAGAGTGG - Intergenic
987477465 5:18408996-18409018 GGTCCTGCCCTCAGAATGTGTGG + Intergenic
989192933 5:38689071-38689093 GGAGCTGCCTAGAAAATGAAGGG - Intergenic
989504816 5:42215405-42215427 GGACCTGCCCTGAGCCAGAGGGG - Intergenic
991018648 5:61957998-61958020 GGACCTGCCCTGGACCAGAGGGG - Intergenic
995436593 5:112143228-112143250 CTAACTGCCCTGAAACTGAGTGG - Intronic
997104724 5:131005788-131005810 GGACCTGCCCTGGGACAGAGGGG + Intergenic
997194526 5:131969657-131969679 GGACCTGACGTGTAAAGGAGAGG + Intronic
997816710 5:137026429-137026451 TGACCTCCCCTGAAAAAGAGGGG + Intronic
998400557 5:141846600-141846622 AGACCTGTCCTGAAACTGGGAGG + Intergenic
999643779 5:153698287-153698309 GGGAATGCCCTGAAAATGAGAGG + Intronic
1000618730 5:163459688-163459710 GCACCTGCCCTGAAGAGGCGGGG + Intronic
1002786323 6:403149-403171 GGTTCTGCCCTTAGAATGAGAGG - Intronic
1006451691 6:34109183-34109205 GGTCCTGTCCAGACAATGAGGGG + Intronic
1008017880 6:46541749-46541771 GGACCTGCCCTGCACCAGAGGGG + Intergenic
1008191300 6:48461668-48461690 GGTCCTGCCCTTGACATGAGGGG + Intergenic
1009292105 6:61895230-61895252 GGACCATCTCTGAAACTGAGCGG + Intronic
1010560260 6:77340574-77340596 GGACCTGCCCTGGACCAGAGGGG - Intergenic
1010775368 6:79879000-79879022 GGACCTGCCCTGGACCAGAGGGG + Intergenic
1011660478 6:89590036-89590058 GGAGATGCACTGAAAATGATTGG + Intronic
1015118153 6:129671866-129671888 GAACCTGCCCTGCAAATGATGGG + Intronic
1017969583 6:159299871-159299893 GGACCTGGCCTGAGACTGGGTGG - Intergenic
1018059393 6:160078818-160078840 GGAGGTGCCCTGGAATTGAGAGG + Intronic
1020083453 7:5298263-5298285 GGAACTTCCCTGACCATGAGAGG - Intronic
1020121365 7:5505622-5505644 GGATATGTCCTGAAAATAAGGGG + Exonic
1021355096 7:19644550-19644572 AGACCTACCCTCAATATGAGTGG + Intergenic
1021957151 7:25837012-25837034 AGATCTGCCCTGAAAAAAAGGGG + Intergenic
1026124697 7:67569331-67569353 GGACATGTCCTGGAAATGGGAGG - Intergenic
1027721392 7:81746330-81746352 GCACCTGAACTGTAAATGAGTGG + Intronic
1027985846 7:85288805-85288827 GGAACTGCCCGGAAAAAGTGAGG - Intergenic
1030408301 7:109143055-109143077 GGACCTGCCCTGGGCCTGAGGGG - Intergenic
1030629476 7:111879562-111879584 GGACCTGCCCTGGATGAGAGGGG + Intronic
1031553342 7:123142345-123142367 GGACCTGTCCTGGGAAGGAGGGG - Intronic
1033689693 7:143724807-143724829 CCACCTCCCCTGGAAATGAGAGG + Exonic
1035084502 7:156246820-156246842 GGACCTGCCCTGAGCCAGAGGGG - Intergenic
1035493014 7:159296261-159296283 AGGGCTGCCCTGCAAATGAGAGG + Intergenic
1035866918 8:3093887-3093909 GGAGATGCCCTGCAAAAGAGTGG + Intronic
1036604722 8:10294958-10294980 AGACCTTCCCTGAAACTGGGAGG + Intronic
1038531283 8:28319820-28319842 GGAGCCGTCCTGACAATGAGTGG + Intronic
1041298381 8:56386026-56386048 GGACCTGCCCTGAGAAAATGTGG + Intergenic
1041417013 8:57622002-57622024 AGGCCTACCCTGAAAATGATTGG - Intergenic
1044128823 8:88494536-88494558 GGACCTGACTTGAAATAGAGAGG + Intergenic
1044193047 8:89342432-89342454 GGACCTGCCCTGAGCCAGAGGGG - Intergenic
1048029863 8:130621159-130621181 AGACCTGCCCTGAATAGGAAGGG - Intergenic
1049175763 8:141191729-141191751 CTACCGGCCCTGAAAGTGAGCGG - Intronic
1050442746 9:5682776-5682798 GTACCTGACCTGAAAGTGACGGG - Intronic
1050456214 9:5836933-5836955 GGACCAGCCCAGAATTTGAGGGG - Intergenic
1051921781 9:22275158-22275180 GGACCTGCCCTGGGCAAGAGGGG + Intergenic
1053440556 9:38112829-38112851 GGACCAGCCCTGCAAACTAGGGG + Intergenic
1056180396 9:84076892-84076914 GGACCTGCCCTGGAGCAGAGGGG + Intergenic
1057416449 9:94867917-94867939 AGACCAGCCAGGAAAATGAGAGG + Intronic
1058142706 9:101375048-101375070 GGCCCTGCCCTTAACATGTGGGG - Intronic
1058522785 9:105828543-105828565 GGACCTGCCCTGGCACAGAGAGG - Intergenic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1187588462 X:20689874-20689896 GGACCTGCCCTGGGAAAGAGGGG - Intergenic
1188715643 X:33456586-33456608 GGACCTGCCCTGAGACAGAGGGG + Intergenic
1188854224 X:35172095-35172117 GGACCTGCCCTGGGAAAGAAGGG - Intergenic
1189013431 X:37070809-37070831 GGACCTGCCCTGGGCAAGAGGGG - Intergenic
1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG + Intronic
1194023565 X:88723807-88723829 GGACCTTCCCTGAGACAGAGGGG + Intergenic
1195821153 X:108946521-108946543 GAACCTGCCCTGAGCAAGAGGGG - Intergenic
1196531533 X:116792720-116792742 GGACCTGTGAGGAAAATGAGTGG - Intergenic
1199032262 X:143014124-143014146 AGACCTGCCCTGCAACTGAGAGG + Intergenic
1199081228 X:143578989-143579011 GGACCTGCCCTGTGACAGAGGGG - Intergenic
1199845285 X:151688449-151688471 GGACCTGCCCTGAGCCAGAGGGG + Intergenic
1200250758 X:154552617-154552639 GGGCCTGTCCTGGAAATGGGCGG + Intronic
1200281762 X:154783026-154783048 AGACATTCCATGAAAATGAGAGG + Intronic
1200304323 X:155008742-155008764 GGGCCTGTCCTGGAAATGGGCGG - Intronic
1200555403 Y:4631184-4631206 GGACCTGCCCTGAGACAGAGAGG - Intergenic
1201640972 Y:16176516-16176538 GGTCCTGCCCTTAACATGTGGGG - Intergenic
1201661844 Y:16408810-16408832 GGTCCTGCCCTTAACATGTGGGG + Intergenic