ID: 1192440416

View in Genome Browser
Species Human (GRCh38)
Location X:71169833-71169855
Sequence GGAGCTGGCAGCATTACAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192440409_1192440416 5 Left 1192440409 X:71169805-71169827 CCCCGGAGTTGGGAGCTGCTCCA 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1192440403_1192440416 25 Left 1192440403 X:71169785-71169807 CCCTCAGCGGGGAGCCGGGGCCC 0: 1
1: 0
2: 0
3: 11
4: 210
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1192440411_1192440416 3 Left 1192440411 X:71169807-71169829 CCGGAGTTGGGAGCTGCTCCAGA 0: 1
1: 0
2: 1
3: 18
4: 157
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1192440399_1192440416 30 Left 1192440399 X:71169780-71169802 CCTAGCCCTCAGCGGGGAGCCGG 0: 1
1: 0
2: 3
3: 24
4: 189
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1192440404_1192440416 24 Left 1192440404 X:71169786-71169808 CCTCAGCGGGGAGCCGGGGCCCC 0: 1
1: 0
2: 2
3: 28
4: 301
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1192440408_1192440416 11 Left 1192440408 X:71169799-71169821 CCGGGGCCCCGGAGTTGGGAGCT 0: 1
1: 0
2: 3
3: 30
4: 358
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1192440410_1192440416 4 Left 1192440410 X:71169806-71169828 CCCGGAGTTGGGAGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 303
Right 1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192440416 Original CRISPR GGAGCTGGCAGCATTACAAC TGG Exonic
902825453 1:18970467-18970489 AGAGCTGGCAGAATTGGAACAGG + Intergenic
903632939 1:24790635-24790657 GGAGGTGGCCTCATTACCACTGG + Intronic
904910119 1:33928319-33928341 GGAGTTGTGAGGATTACAACAGG + Intronic
911470850 1:98316423-98316445 GGAGTTGGCAGCAGTACACAGGG - Intergenic
912321675 1:108719686-108719708 GGACTCTGCAGCATTACAACTGG + Intronic
916424158 1:164664806-164664828 AGATCTGACAGTATTACAACGGG - Intronic
917510629 1:175666548-175666570 GGAGCTTGCAGCATTATACTGGG - Intronic
918396609 1:184119523-184119545 GAGGCTTGCAGCATTTCAACAGG - Intergenic
920553697 1:206887500-206887522 TGAGATGGCAGCATTATTACAGG - Intergenic
1065979107 10:30873433-30873455 AGAGCTGGCAGCATTATTAATGG - Intronic
1067463384 10:46475053-46475075 GGAGATGGCAGCAGTTCAAGAGG + Intergenic
1067623811 10:47909585-47909607 GGAGATGGCAGCAGTTCAAGAGG - Intergenic
1068724724 10:60288510-60288532 GGAGGAGGCAGGATTTCAACAGG + Intronic
1068850083 10:61728367-61728389 AGAGCTGCCAGCATTACAGTTGG + Intronic
1070164656 10:73888570-73888592 GGAGCTGGCACCATAGCACCAGG - Intergenic
1071183448 10:83013571-83013593 GGAACTGGCAGCCTTCAAACGGG - Intergenic
1071874657 10:89831858-89831880 GGAGTTGGCTGTCTTACAACTGG + Intergenic
1072571200 10:96658751-96658773 AGATCTGGCAGCATTCAAACAGG - Intronic
1073201099 10:101736585-101736607 GGGGGTGGCAGCATAAGAACTGG - Intergenic
1073419075 10:103409381-103409403 GGAACTGCCAGCCTGACAACTGG - Intronic
1073432108 10:103493723-103493745 GCAGCTGTCACCATAACAACCGG + Intergenic
1078603594 11:12755572-12755594 GGAGCTGTCAGTATTTCAAAAGG - Intronic
1080294518 11:30710795-30710817 GGAACTGGTAGCATCAGAACTGG - Intergenic
1083784740 11:64937568-64937590 GGTGCAGGCAGCATAGCAACAGG + Intronic
1085455928 11:76665366-76665388 GGAGATGGCAGCATTTGATCTGG + Intronic
1090242836 11:125196139-125196161 GGAGCTGGCAACAGTACAGGTGG + Intronic
1091382012 12:67713-67735 GGAACTGACAGCATTTAAACGGG + Intronic
1092237188 12:6817540-6817562 GGAACTTGTAGAATTACAACTGG - Intronic
1093415623 12:18917244-18917266 CAAGCAGGCAGGATTACAACAGG - Intergenic
1095189807 12:39244493-39244515 GGAGGTGGCAGTATTCAAACTGG - Intergenic
1098135194 12:67394731-67394753 AGAGCTGGCGTCATTAGAACAGG + Intergenic
1101173257 12:102121230-102121252 GGAGCTGGCTGCACAAAAACAGG - Intronic
1104810928 12:131620022-131620044 GGGGCTGGCAGCATCAGGACAGG + Intergenic
1107693019 13:42971075-42971097 GGAGGTGGCTGCATTGCAAATGG - Intronic
1109852252 13:68081011-68081033 GGAACTGGTAGCATTTCACCTGG + Intergenic
1113127854 13:107000182-107000204 GGAGCTGTCAGAACTAGAACTGG - Intergenic
1113448578 13:110389181-110389203 AGCGCTGGCAGCATGAGAACAGG + Intronic
1113801906 13:113091087-113091109 GGAGGAGGCAGAAATACAACCGG - Intronic
1118923477 14:70170839-70170861 GGTGCTGGGGGCATCACAACAGG + Intronic
1122946549 14:105013321-105013343 GGAGCTGGGAGGATGACAGCTGG + Intronic
1128296626 15:66526101-66526123 GGAGATGATAGCATTTCAACTGG + Intronic
1137466944 16:48718378-48718400 GGAGCTTGCAGCATGCTAACAGG - Intergenic
1138508688 16:57494580-57494602 GGAGGTGGCTTCATTACTACTGG + Intergenic
1138639561 16:58373422-58373444 GGAGCTTGCAGTATAGCAACAGG + Intronic
1138756186 16:59488514-59488536 GCAGCAGGCAGCAACACAACAGG + Intergenic
1139717493 16:68825272-68825294 GGGGCTGGTAGAATTCCAACAGG + Intronic
1141685200 16:85566166-85566188 GCAGCTGGGAGCATGACAGCTGG - Intergenic
1146467900 17:33101158-33101180 GGACCTGGCACCATGACAAGAGG + Intronic
1147588158 17:41664970-41664992 GGACCTGAGAGCATTAGAACTGG - Intergenic
1148103544 17:45107288-45107310 AGAGCGGGCAGCATTCCCACGGG - Exonic
1148214812 17:45828728-45828750 GGAGCAGGCGGCATTGCAGCAGG + Intronic
1148518480 17:48245112-48245134 GGAGCTGCCAGCAGTACTTCAGG - Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1152519720 17:80848177-80848199 GGAGCTGGGATCATAACACCAGG - Intronic
1153655712 18:7280361-7280383 GGAACTGGGAGCATAACAAATGG + Intergenic
1153829904 18:8912800-8912822 GGGGCTGTCACCATAACAACAGG + Intergenic
1156219029 18:35032712-35032734 AGAGCTGGAAGCATGAGAACAGG - Intronic
1159843407 18:73427278-73427300 GGATCTGGCAGAACTAGAACTGG + Intergenic
1160021611 18:75185840-75185862 GGACCTGGCAGCTTTACCAGTGG - Intergenic
1160067205 18:75586787-75586809 GGAGTTGGGAGCATCACAGCGGG + Intergenic
1161921401 19:7268876-7268898 GGAGGAGGCAGCATTTGAACTGG - Intronic
1164574500 19:29397823-29397845 GGAGCTGGCAGTATTCCTGCAGG + Intergenic
1164952486 19:32349047-32349069 GGAGCTAGCAGCATTAGGAGAGG + Intronic
1167455756 19:49596145-49596167 GGAGCTGGCAGCTATGCAGCCGG + Exonic
1168393968 19:56032776-56032798 GGGGCGGGCAGCCTTACATCAGG - Exonic
1168689866 19:58369678-58369700 GGAGCTGGCAGCTGAGCAACGGG - Intronic
925259484 2:2517312-2517334 GGAGCTGTCAGCATTCCGAGGGG + Intergenic
925359320 2:3266636-3266658 GGTGGTGCCAGCATCACAACAGG + Intronic
931069695 2:58631235-58631257 GTAGCTGTCAAAATTACAACAGG - Intergenic
933881395 2:86673535-86673557 GGAGGTGGCAGAATCACAGCTGG - Intronic
934152011 2:89155845-89155867 GGAGCCTGCAGACTTACAACAGG + Intergenic
934215244 2:90026062-90026084 GGAGCCTGCAGACTTACAACAGG - Intergenic
935634065 2:105236718-105236740 GGGGTTGGCAGCCTTACACCAGG + Intergenic
936073604 2:109387542-109387564 GGAGCTGGCCCCATCACATCTGG - Intronic
937541158 2:122955931-122955953 ACAGCTGGGAGCATTACATCAGG - Intergenic
937863515 2:126731505-126731527 GGAGCTGTCACCAATGCAACAGG + Intergenic
943117931 2:183696311-183696333 GGAGCAGGCAGCATCCCAATGGG - Intergenic
947719651 2:232362775-232362797 GGAGGTGGCAGCCTTACCAGAGG + Intergenic
1170647652 20:18211275-18211297 GGATTTGGCACCAATACAACAGG - Intergenic
1171467242 20:25338366-25338388 GGTGCTGACAGCATTAGAACAGG - Intronic
1172858226 20:38024915-38024937 GGAGGTGGCATCATTACCACTGG - Intronic
1176283189 20:64327120-64327142 GGAACTGACAGCATTTAAACGGG - Intergenic
1178715366 21:34959639-34959661 GGAGCTGGAAGCATCTCATCCGG + Intronic
1180088887 21:45523896-45523918 GGTGCTGGCAGCAGTCCAGCTGG - Intronic
1181094278 22:20495372-20495394 GGAGCGGGCGGCCTTGCAACAGG - Intronic
1182516495 22:30861976-30861998 TGAGGTGGCAGCTTTACAGCTGG - Intronic
1182761083 22:32722779-32722801 GGAGCTGTCAGCATTCCAGTTGG + Intronic
1183093303 22:35538321-35538343 GGAGGTGGCAGTTTTAGAACAGG + Intergenic
952906444 3:38142037-38142059 GGAGCTGAGAGCATGACCACAGG - Exonic
959278515 3:104307879-104307901 GGAGCTGGTACCATTACTTCTGG + Intergenic
962382612 3:134909808-134909830 TGAGCTTCCAGCATTACAAGAGG + Intronic
962704149 3:138027146-138027168 AGATCTGGCAGCATTACACTGGG + Intronic
964030682 3:152135667-152135689 GGATTTTGCAGCATTACAAAAGG - Intergenic
965038433 3:163472662-163472684 GGAGCTGGCACCATTCCTTCTGG - Intergenic
973250051 4:48050985-48051007 GGAGCTGGAAGGATGATAACAGG + Intergenic
973556143 4:52085112-52085134 GGAGCTAGCATTATTGCAACAGG - Intronic
978674071 4:111289251-111289273 GGAGCTGCGAGCATCACAAGAGG - Intergenic
981345215 4:143667683-143667705 AGTGCTGGCAGGATTACAGCTGG - Intronic
982058845 4:151582218-151582240 GAAGCTCGCAGCATAACACCTGG - Intronic
983180323 4:164640846-164640868 GGAGAGGCCTGCATTACAACTGG - Intergenic
984919110 4:184748387-184748409 GGCGCTGGCAGCAGCACAGCAGG + Intergenic
985364777 4:189216845-189216867 GGAGTAGGCACCCTTACAACCGG + Intergenic
986016207 5:3759479-3759501 GGAGCTGGGAGGTTTAGAACAGG + Intergenic
987425876 5:17772335-17772357 GGAGGTGGCTTCATTACCACTGG + Intergenic
994881717 5:105506476-105506498 AGAGCTGGCAGCAGTACACTGGG - Intergenic
996131287 5:119784498-119784520 GGAGTTGGCAGCAGTACAAAGGG + Intergenic
996749913 5:126878127-126878149 GGAGCTGGCAGCCTCACAGCTGG - Intronic
997837717 5:137209475-137209497 GAAGCAGGCAGCATTACCATTGG + Intronic
1000432490 5:161167162-161167184 GGAGCTGGCATGATTACACTGGG - Intergenic
1001940279 5:175735319-175735341 GCAGCAGGAAGCATTACAGCAGG + Intergenic
1002307738 5:178293696-178293718 GAAGCTGGCAGGATTCCAGCTGG + Intronic
1003456176 6:6284783-6284805 GGAACTGGGAGCATTCCAAGAGG - Intronic
1003610993 6:7614893-7614915 GGAACTGGCAGCATGATGACAGG - Intergenic
1004829300 6:19460391-19460413 GGAGCAGGTAGCATTAACACTGG - Intergenic
1005998404 6:30946442-30946464 GGAGCTGGCAGCAATGCAAAGGG - Intronic
1006501783 6:34464027-34464049 GGAGGAGGCAGCATTCCAACAGG - Intergenic
1012637783 6:101567601-101567623 GAAGCTGGCAGCATTATAGCTGG - Intronic
1012986580 6:105882636-105882658 CGACCTGGCTGCATTTCAACTGG - Intergenic
1013082369 6:106823808-106823830 CAAGTTGGCAGCATTATAACTGG - Intergenic
1016910742 6:149196249-149196271 CGAGCTGTCAGCAACACAACTGG - Intergenic
1020086567 7:5313638-5313660 GGAGCTGGCAGCTCTGCAAATGG + Exonic
1021296823 7:18918315-18918337 GGAGCTGGCAGCTTGACATGGGG + Intronic
1022638070 7:32155932-32155954 GGAGCAGGGAGCAGCACAACTGG + Intronic
1024879235 7:54067040-54067062 GGAGTTGGCACCATGACACCTGG - Intergenic
1025207746 7:57003500-57003522 GGAGCTGGCAGCTCCACAAATGG - Intergenic
1025664190 7:63573372-63573394 GGAGCTGGCAGCTCCACAAATGG + Intergenic
1034302965 7:150032254-150032276 GGAGGTGACAGCATTAGAATGGG + Intergenic
1034803081 7:154065014-154065036 GGAGGTGACAGCATTAGAATGGG - Intronic
1037208140 8:16350360-16350382 GGAGCTGACAGCCTAACAGCAGG - Intronic
1044291350 8:90474480-90474502 GGTGCTGGCAACATTTCAAATGG - Intergenic
1046721919 8:117629813-117629835 GGTGCTGGCAGCATGACACAAGG - Intergenic
1048767672 8:137862482-137862504 GGAGCTGGAATCACTACAAGAGG + Intergenic
1051469783 9:17424741-17424763 GGAACTGGTAGCTTTATAACAGG + Intronic
1051914134 9:22187151-22187173 GGAGCTGTCATCATTATGACAGG + Intergenic
1057150927 9:92795051-92795073 TGACCAGGCATCATTACAACTGG - Intergenic
1058947892 9:109875905-109875927 GGAGCTGGCAGCTGGACAAAGGG - Intronic
1061538399 9:131263940-131263962 GCAGCAGGCAGGATGACAACAGG + Intronic
1186055472 X:5644985-5645007 GAAGCTGTCAGCATGACACCTGG - Intergenic
1188782126 X:34298425-34298447 GGAGCAGACAGCATTTAAACTGG + Intergenic
1189770922 X:44426292-44426314 GTAGCTTGGAGCATTACAAATGG + Intergenic
1190779637 X:53580980-53581002 GGAGCTGGTAGCACTACCTCTGG - Exonic
1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG + Exonic