ID: 1192449865

View in Genome Browser
Species Human (GRCh38)
Location X:71237626-71237648
Sequence TGTTGCATGGTGCACCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192449859_1192449865 22 Left 1192449859 X:71237581-71237603 CCTATGATTAGAAACTCAAGTCT No data
Right 1192449865 X:71237626-71237648 TGTTGCATGGTGCACCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192449865 Original CRISPR TGTTGCATGGTGCACCACAA GGG Intergenic
No off target data available for this crispr