ID: 1192450963

View in Genome Browser
Species Human (GRCh38)
Location X:71244606-71244628
Sequence AAGGTCATCAAAGCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192450963_1192450968 -10 Left 1192450963 X:71244606-71244628 CCAGGAACAGCTTTGATGACCTT 0: 1
1: 0
2: 0
3: 15
4: 119
Right 1192450968 X:71244619-71244641 TGATGACCTTGTGAGATGGGGGG 0: 1
1: 0
2: 1
3: 16
4: 189
1192450963_1192450970 4 Left 1192450963 X:71244606-71244628 CCAGGAACAGCTTTGATGACCTT 0: 1
1: 0
2: 0
3: 15
4: 119
Right 1192450970 X:71244633-71244655 GATGGGGGGAGAGCAAAGTTTGG 0: 1
1: 0
2: 1
3: 18
4: 282
1192450963_1192450971 30 Left 1192450963 X:71244606-71244628 CCAGGAACAGCTTTGATGACCTT 0: 1
1: 0
2: 0
3: 15
4: 119
Right 1192450971 X:71244659-71244681 TATCTCAGTACTTCTAGTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192450963 Original CRISPR AAGGTCATCAAAGCTGTTCC TGG (reversed) Intronic
902461629 1:16581807-16581829 CAGGACACCAAACCTGTTCCTGG - Intronic
912933526 1:113983935-113983957 AAGGGCATCAGAGCCGCTCCTGG - Intergenic
916309386 1:163378147-163378169 AAGGTCATGAAAGTTGTACATGG - Intergenic
917435214 1:175014245-175014267 CAGGTCAGCAAAGCTAGTCCAGG + Exonic
918521570 1:185420617-185420639 AAGCTCATCCAGGCTGGTCCTGG - Intergenic
920207367 1:204302329-204302351 AAGGTCAACAAGGATATTCCTGG - Intronic
920801159 1:209188774-209188796 AAGGTCATCAATCCTGTTGCTGG + Intergenic
923357827 1:233177919-233177941 TACTTCATCAAAGATGTTCCTGG + Intronic
923517445 1:234709581-234709603 AAGGTGCACAGAGCTGTTCCTGG + Intergenic
1063707313 10:8443174-8443196 AAGGTGATCAAAGTTGTTAGAGG + Intergenic
1064739073 10:18413596-18413618 AGGGTCAACAAATCTTTTCCTGG + Intronic
1068037616 10:51780787-51780809 AAGGTCATTAAGTTTGTTCCTGG + Intronic
1070471084 10:76780044-76780066 AAGTCCATCAAAGCTGTGGCAGG + Intergenic
1070939893 10:80335265-80335287 AAAGTCCTCATATCTGTTCCTGG + Intergenic
1072418824 10:95272138-95272160 AAGGACATCAGATCTGTTCGGGG - Intronic
1076227267 10:128789226-128789248 AAGGTGACCAGAGCTGTTCTTGG - Intergenic
1077185054 11:1232116-1232138 GGGGTCCTCAAAGCTGTTCCTGG - Exonic
1081710595 11:45213121-45213143 AGGGTCATCGATCCTGTTCCTGG - Intronic
1083315661 11:61813663-61813685 AAGGGAATAAAAGCTGCTCCCGG + Intronic
1091154267 11:133359097-133359119 AAGGTGATCAGAGCTGTGTCTGG - Intronic
1093844917 12:23958138-23958160 AAGGTCATCAATACTCTTCGTGG + Intergenic
1104952289 12:132446795-132446817 ATTGTCAACAAAGCTGTGCCGGG - Intergenic
1106189024 13:27434368-27434390 AAGGTGAGCAGAGCTGTGCCAGG + Intronic
1107182470 13:37477324-37477346 ATGACCATGAAAGCTGTTCCTGG - Intergenic
1107374152 13:39784136-39784158 AAGGTGATGACAGCTTTTCCAGG - Intronic
1108090433 13:46843715-46843737 AAAGTCATCAAAATTGGTCCAGG - Intronic
1111266775 13:85825675-85825697 AATGTAAGCAAATCTGTTCCAGG - Intergenic
1113385833 13:109846953-109846975 AAGGCCAGCAGGGCTGTTCCAGG + Intergenic
1113861035 13:113487268-113487290 AAGGGCGTCATGGCTGTTCCTGG - Intronic
1115729679 14:36255316-36255338 AATGTCATCTATGCTGGTCCTGG - Intergenic
1117370935 14:55077807-55077829 TAACTCATGAAAGCTGTTCCAGG - Intergenic
1119974368 14:79009010-79009032 TAGGTCCTCAAATCTCTTCCCGG - Intronic
1122314461 14:100817644-100817666 AAGGTCACCAAAGGTCATCCCGG - Intergenic
1202902577 14_GL000194v1_random:51980-52002 TAGCTCCTCAAAGCTGCTCCAGG - Intergenic
1123680549 15:22760100-22760122 AAAGTCATCAAATGTGGTCCAGG - Intergenic
1124332765 15:28834558-28834580 AAAGTCATCAAATGTGGTCCAGG - Intergenic
1125270386 15:37932636-37932658 AAGGTTATCGAAGCTGTTAATGG - Intronic
1125409951 15:39395692-39395714 AAGGAAAGGAAAGCTGTTCCAGG + Intergenic
1126038607 15:44569996-44570018 AAGGACAGCAAAGCCGTTCATGG - Intronic
1128160031 15:65417501-65417523 AGGGACATCACAGCTGTTCTAGG - Intronic
1131149351 15:90037176-90037198 AAAATTATCAAAGTTGTTCCAGG + Intronic
1133406891 16:5531683-5531705 AAGGTACTCAAAGCAGTGCCTGG + Intergenic
1138060552 16:53885541-53885563 AAGGACATTAAAACTTTTCCTGG + Intronic
1140228447 16:73097453-73097475 AAAGTCATGAAAGCTATTCATGG - Intergenic
1142574652 17:898489-898511 AAGAAGATCAAAGCTGTTCCAGG - Intronic
1146616823 17:34363186-34363208 AGGCTCATCAAAGCTGCTCCAGG - Exonic
1147054082 17:37820849-37820871 GATGTCACCAAAGCTGCTCCAGG + Intergenic
1148124476 17:45229793-45229815 AAGGTCAACAGAGCTCTGCCTGG - Intronic
1152117636 17:78398458-78398480 AAGATCATCCAAGCTGGCCCAGG + Intronic
1153120632 18:1722376-1722398 AAGGCCATCTCAGCTGTCCCAGG + Intergenic
1154347088 18:13551264-13551286 AAGGTCAGCACAGCTGTCCCAGG - Intronic
1155932799 18:31724474-31724496 CAGGTAATCAAAGCTCTCCCGGG - Intergenic
1159828552 18:73244640-73244662 AAAGTCATCTTAGTTGTTCCAGG - Intronic
1162181626 19:8873047-8873069 ATGGCCATGAAAACTGTTCCAGG - Intronic
1162829499 19:13275686-13275708 AAAGCCATCGAAGCTCTTCCTGG + Intronic
1165600970 19:37055751-37055773 AAGGTCAACAAAACTGTTTCAGG + Intronic
1167053181 19:47092488-47092510 TAGGTCTTTAAAGCTGTCCCAGG - Intronic
1202678065 1_KI270711v1_random:25554-25576 CAGGACACCAAACCTGTTCCTGG - Intergenic
925100309 2:1238706-1238728 AAGGGCAGCAAGGCTGGTCCAGG - Intronic
925501028 2:4505125-4505147 AAGGGCAACACAGCAGTTCCTGG - Intergenic
928611449 2:32996056-32996078 AAGGCCATAAAAGATGTTCTTGG - Intronic
929981146 2:46681567-46681589 AAGGTTGTGAAAGATGTTCCAGG - Intergenic
934504089 2:94878415-94878437 TAGCTCCTCAAAGCTGCTCCAGG + Intergenic
940779918 2:157922256-157922278 AAGGTAATCAAAAGTCTTCCTGG - Intronic
940982784 2:160022041-160022063 AAGGTCATCAAAGGAGATCCTGG + Intronic
941554549 2:166960426-166960448 AAGGAGATCAAACCTGATCCTGG - Intronic
943206392 2:184902540-184902562 AAGGTCATGAAAGAGGCTCCTGG - Intronic
943735264 2:191347093-191347115 AAGATCATCAAAATTGTCCCTGG - Intronic
943825855 2:192390758-192390780 AAGGTGAGTAAAGCTGTCCCTGG + Intergenic
1169703241 20:8472801-8472823 AAGGTCACCACAGTTCTTCCTGG + Intronic
1171230253 20:23478833-23478855 AAGGTCATCAGAGGTGATCCTGG + Intergenic
1173752722 20:45489554-45489576 AAGGACATGAAGGCTGTTCCTGG - Intergenic
1176621943 21:9066747-9066769 TAGCTCCTCAAAGCTGCTCCAGG - Intergenic
1181977565 22:26741796-26741818 GATGGCTTCAAAGCTGTTCCAGG + Intergenic
957823161 3:85405242-85405264 CAGGCCATCAAAACTGTTCTAGG - Intronic
959159882 3:102710533-102710555 AAGGTCATGAAGCCTGTTACAGG + Intergenic
959451327 3:106506661-106506683 AAGGTCATGACAGCAGTTCTGGG - Intergenic
968561958 4:1288690-1288712 AAGGTCAGGAACGCTGTTACGGG + Intergenic
971379598 4:26084770-26084792 GAGGTCATCATGGCTGATCCAGG - Intergenic
972852851 4:43071962-43071984 AAGGTCACCAAAGAACTTCCTGG - Intergenic
973332742 4:48925893-48925915 AAGGCCATTAAATCAGTTCCTGG + Intergenic
976213485 4:82693900-82693922 ATGGGCATCAAAGCTGTGTCCGG - Intronic
977147271 4:93459399-93459421 AAGGACTTCAAAGCTGATCAAGG + Intronic
977723590 4:100268227-100268249 CATGTTATCAAAGGTGTTCCTGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982194872 4:152900931-152900953 AAGTTCTTCAAAGCAGTTACTGG - Intronic
982198793 4:152939515-152939537 AGGGTCTTCAAAGCTGCCCCTGG - Intronic
986391545 5:7292071-7292093 AAAGTCATCAAATGTGGTCCAGG - Intergenic
992710152 5:79444903-79444925 ATGATCATCAAAGTTATTCCAGG + Intronic
992940135 5:81752183-81752205 AAGGTGTACAAAGCTGTGCCAGG + Intergenic
993908621 5:93652807-93652829 AAAGTCCTCAAAACTGTCCCAGG - Intronic
999702708 5:154242702-154242724 AAGGTCAGCAAGGCTGAGCCAGG - Intronic
1001693154 5:173647610-173647632 GAGGGCATCAAAGCTTTCCCTGG - Intergenic
1001880537 5:175240359-175240381 GAGGTCTTCAAAGATGTTCTTGG - Intergenic
1002654144 5:180729539-180729561 AAGGTCATCAAAGGTATATCAGG + Intergenic
1003147947 6:3524749-3524771 AATGGAATCAAAGCTTTTCCTGG - Intergenic
1006682105 6:35804994-35805016 GAGGTCAGCAAAGCCTTTCCTGG - Intergenic
1009423866 6:63492673-63492695 AAAGACAGCAAAGCTTTTCCAGG + Intergenic
1010085361 6:71910963-71910985 AGGGTGATTAAAGCTGTGCCAGG + Intronic
1012569550 6:100706369-100706391 AAGGTCAACAAAGAACTTCCCGG - Intronic
1012714019 6:102646400-102646422 AAGGTCTTCAGTGTTGTTCCTGG - Intergenic
1017300119 6:152847147-152847169 AAGGTCACCAAACCTGGTCTGGG - Intergenic
1017397055 6:154013727-154013749 AAGGTGATCAAAGCTGACCCTGG + Intronic
1017539413 6:155385124-155385146 CAGGTCATCAAAGGTGACCCAGG - Intergenic
1017895230 6:158673736-158673758 TATGCCTTCAAAGCTGTTCCTGG - Intronic
1022690783 7:32650668-32650690 AAGGTCATAAAAGATGTTGTAGG + Intergenic
1026423700 7:70268219-70268241 AATGTCATCAAAGGTGTTAGAGG - Intronic
1028509464 7:91607870-91607892 AAGGTCATCTCAGATTTTCCAGG + Intergenic
1028846030 7:95481166-95481188 AATGTCAACAAGGCTCTTCCAGG - Intronic
1032736209 7:134694799-134694821 AAAGTCATCAGAGCAGTCCCTGG + Intergenic
1041571359 8:59340586-59340608 AACATCTTCAGAGCTGTTCCAGG + Intergenic
1048044487 8:130760215-130760237 AAGGTCAGGGAAGTTGTTCCTGG - Intergenic
1048393260 8:133988088-133988110 AAGATCAATCAAGCTGTTCCTGG - Intergenic
1048459916 8:134613185-134613207 AATGTGAACAAATCTGTTCCTGG - Intronic
1048488319 8:134868902-134868924 AAGGTGAACTAACCTGTTCCAGG + Intergenic
1049397200 8:142406464-142406486 AAGCTCCTCCAGGCTGTTCCAGG - Intergenic
1049781242 8:144429909-144429931 CAGGTCATCAAAGCCCTTCCTGG + Intronic
1050192012 9:3036205-3036227 GCGGTCATCAGAGCTGTTCATGG - Intergenic
1051435811 9:17030465-17030487 AATGTCAACATAGTTGTTCCAGG + Intergenic
1055085499 9:72309577-72309599 AGGGTCATGAAAGCTGATGCAGG - Intergenic
1056255444 9:84794915-84794937 AATCTCATCAAAGCTGTGACTGG + Intronic
1058274878 9:103027680-103027702 AAGGTCATCAACGATCTTCCTGG + Intergenic
1060506121 9:124199556-124199578 AAGGCCAGCAGGGCTGTTCCTGG + Intergenic
1060542155 9:124438337-124438359 CAGGTCAGCCAAGCTGTTCCGGG + Intergenic
1203745130 Un_GL000218v1:37169-37191 TAGCTCCTCAAAGCTGTTCCAGG - Intergenic
1203564980 Un_KI270744v1:82315-82337 TAGCTCCTCAAAGCTGTTCCAGG + Intergenic
1191198600 X:57752308-57752330 AAGGTCATCAATGAGGTACCTGG - Intergenic
1192450963 X:71244606-71244628 AAGGTCATCAAAGCTGTTCCTGG - Intronic
1192638936 X:72845466-72845488 AGACTCACCAAAGCTGTTCCTGG + Intronic
1192642776 X:72875342-72875364 AGACTCACCAAAGCTGTTCCTGG - Intronic
1193635881 X:83948627-83948649 AAGGGCATGTGAGCTGTTCCTGG - Intergenic
1197598995 X:128505028-128505050 AAGCTCAGAAAAGCTGTTCAGGG + Intergenic
1199403690 X:147430290-147430312 AAGTTTTTCAAAGCTGTTCTGGG - Intergenic
1199575034 X:149305846-149305868 AACTTCTCCAAAGCTGTTCCAGG + Intergenic
1201158461 Y:11152204-11152226 TAGCTCCTCAAAGCTGCTCCAGG - Intergenic