ID: 1192458043

View in Genome Browser
Species Human (GRCh38)
Location X:71293926-71293948
Sequence GGCCAATGGTCTTTGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192458028_1192458043 29 Left 1192458028 X:71293874-71293896 CCCGCCTCGGCCTCCCAAAATTC 0: 83
1: 4970
2: 104576
3: 245330
4: 247586
Right 1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1192458036_1192458043 15 Left 1192458036 X:71293888-71293910 CCAAAATTCTGGGATTACAGGCG 0: 128
1: 7094
2: 148762
3: 295942
4: 248392
Right 1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1192458031_1192458043 25 Left 1192458031 X:71293878-71293900 CCTCGGCCTCCCAAAATTCTGGG 0: 121
1: 7044
2: 139939
3: 283424
4: 216425
Right 1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1192458035_1192458043 16 Left 1192458035 X:71293887-71293909 CCCAAAATTCTGGGATTACAGGC 0: 287
1: 14652
2: 250269
3: 283245
4: 221131
Right 1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1192458033_1192458043 19 Left 1192458033 X:71293884-71293906 CCTCCCAAAATTCTGGGATTACA 0: 436
1: 20600
2: 328088
3: 267054
4: 197432
Right 1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1192458029_1192458043 28 Left 1192458029 X:71293875-71293897 CCGCCTCGGCCTCCCAAAATTCT 0: 92
1: 5049
2: 105786
3: 197952
4: 135794
Right 1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192458043 Original CRISPR GGCCAATGGTCTTTGTTTTC TGG Intronic
903092699 1:20936344-20936366 AGCCAATGGTCCTTGCTTTAAGG + Intronic
904075721 1:27840680-27840702 GGTCAGTGGTATTTGTTATCTGG + Intronic
905725130 1:40245077-40245099 CGCCTCTGGTCTTTTTTTTCAGG - Intergenic
906538095 1:46563088-46563110 GGCCAAGGGTCTTTGCCTACTGG - Intronic
906671448 1:47658174-47658196 GGACATTGGTCTTTGTCCTCAGG + Intergenic
907792062 1:57676591-57676613 GGCCAATAGTTATCGTTTTCTGG - Intronic
907970467 1:59375977-59375999 GGTCACTGGCCTTTGATTTCTGG + Intronic
910635498 1:89403561-89403583 TGCCAATGGTCTTTATATTTTGG + Intergenic
912117262 1:106421955-106421977 GGCCAGAGATGTTTGTTTTCTGG - Intergenic
913102326 1:115580162-115580184 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
915515841 1:156412210-156412232 GGCCAGTGGTCTTTGTTGAGGGG + Intronic
915639434 1:157212030-157212052 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
917104773 1:171481318-171481340 GGCCAAAGGTTTTTTTTTTGCGG + Intergenic
919487001 1:198157577-198157599 GGCAACAGGTCTTTGGTTTCGGG + Intronic
921312166 1:213855215-213855237 GTCCATTTGACTTTGTTTTCTGG - Intergenic
921506831 1:215982085-215982107 AGCCAATTGTCTTCTTTTTCAGG + Intronic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1070439405 10:76428543-76428565 GGCCAAGTCTCTGTGTTTTCTGG - Intronic
1070892414 10:79951709-79951731 GGTACTTGGTCTTTGTTTTCTGG + Intronic
1074205062 10:111276011-111276033 GGCCAATGTGCTTTGCTATCAGG + Intergenic
1074568456 10:114602688-114602710 GGCCAATCCCCTTTGTTTTATGG - Intronic
1076280453 10:129242224-129242246 GGCCATTGGTCTATGGTGTCAGG + Intergenic
1079368940 11:19833431-19833453 GGCCAACCTTCTGTGTTTTCAGG - Intronic
1080629632 11:34062007-34062029 GTTTAATAGTCTTTGTTTTCTGG + Intronic
1080821215 11:35808353-35808375 GGCCACTGGTCCTTCTTTTAGGG - Exonic
1083633324 11:64106815-64106837 GGCTAAAGGTCTTTATTTTGGGG - Intronic
1086279081 11:85164783-85164805 GGCTTATGATCTTTATTTTCTGG + Intronic
1094641330 12:32278418-32278440 GACCAATGGTTCTTGATTTCAGG + Intronic
1095274453 12:40264259-40264281 GGCTACTTGTCTTTCTTTTCTGG + Intronic
1095709362 12:45271614-45271636 GGCCAATGTTCTATTTTTACTGG + Intronic
1100629871 12:96377400-96377422 GGTCATTGGTCTTTGTTTTCAGG - Intronic
1100665667 12:96750015-96750037 GGCCAATATTCTTTAGTTTCAGG + Intronic
1101898565 12:108774057-108774079 GACAAATGGTGTTTGTTGTCTGG + Intergenic
1103470791 12:121179198-121179220 AGCCAATCGTCTTTGTTTTTAGG - Intronic
1103943270 12:124512438-124512460 GGACACTGGTCTTTGGATTCAGG + Intronic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1104709953 12:130978730-130978752 GGCCAAATGTCTTTCTGTTCAGG - Intronic
1105833383 13:24185957-24185979 GGCCAAATTTCTTTCTTTTCTGG + Intronic
1105983540 13:25543608-25543630 TACAAATGGTCTTTGTTTTCTGG + Intronic
1108757425 13:53520974-53520996 GGACCATGGGCTTTGCTTTCAGG - Intergenic
1109473903 13:62852167-62852189 GTCAAATTGTCCTTGTTTTCAGG + Intergenic
1110554856 13:76848205-76848227 AGCCAAAAGTCTTTTTTTTCAGG + Intergenic
1110594861 13:77308959-77308981 GGCCAAGTGTGTTTCTTTTCAGG + Intronic
1110675895 13:78243916-78243938 GGCAAATTGTTTTTGTTTTCTGG - Intergenic
1111068138 13:83124429-83124451 GGCCATTGTTATTTGTTTTGGGG - Intergenic
1117999845 14:61512787-61512809 GCCCAATTTTCTTTGTTTTGGGG + Intronic
1118483594 14:66192307-66192329 GGCCAACAGCCTTTGTATTCAGG - Intergenic
1118900103 14:69979337-69979359 GCCCATTGGTCCCTGTTTTCTGG - Intronic
1120216416 14:81685216-81685238 GGCCAGTGGTCCTGGTTTTCAGG + Intergenic
1121175488 14:91887806-91887828 GGCCAATGGTCCTCGTTGTAAGG - Intronic
1124576913 15:30917594-30917616 GGTCAAATGTCTTTGTTTTTTGG + Intronic
1125057206 15:35375555-35375577 GCACAATTGTCTTAGTTTTCTGG - Intronic
1126881168 15:53099781-53099803 GGCCAAAGGCCATTCTTTTCAGG - Intergenic
1128098007 15:64973264-64973286 GGCCACTGGGCTTTATTTTAAGG + Intronic
1129190908 15:73937115-73937137 GGCAGATGGTCTTTGTCCTCCGG + Intronic
1131708829 15:95029975-95029997 AGCCATTTGTTTTTGTTTTCTGG - Intergenic
1132762847 16:1519412-1519434 AGCCGATGGTCTCGGTTTTCAGG - Intronic
1132975144 16:2707208-2707230 GGCCTGTGGGCTCTGTTTTCTGG + Intronic
1133799051 16:9070094-9070116 GGCCGATGGTATTTTTTTTAAGG + Intergenic
1137817991 16:51417424-51417446 GGCCAATGCTCTTTATTGACGGG - Intergenic
1138135187 16:54515413-54515435 GGAACATGGTCTTTGATTTCAGG + Intergenic
1140867770 16:79078931-79078953 GGCCAATCATCTTTGATCTCTGG - Intronic
1141514190 16:84532350-84532372 GGCGAATGGTCATTCTTTTCTGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144743722 17:17599122-17599144 CGCCCATGGTATTTCTTTTCAGG - Intergenic
1148331592 17:46817090-46817112 GGCCAAGGGTCTCTGTTTAGAGG - Intronic
1154385724 18:13890258-13890280 GGCCCATGGGCTGTGTTTTTGGG + Intronic
1157022515 18:43803409-43803431 TGCCATTGTTATTTGTTTTCTGG + Intergenic
1158052316 18:53237908-53237930 GTGCTAAGGTCTTTGTTTTCAGG - Intronic
1159473901 18:68892248-68892270 GTACAAGGGTCATTGTTTTCAGG - Intronic
1159775197 18:72597084-72597106 GGTCAATGTTCATTGTTGTCTGG + Intronic
1160971564 19:1769985-1770007 GGCCAGTGGACTCTGTTTTCTGG + Intronic
1161945643 19:7434901-7434923 GGCCTATGGTGTTTCTTTTTGGG - Intronic
1162397391 19:10424867-10424889 GTCCCATGGTCTCTGTTTCCCGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163615317 19:18323751-18323773 GGCGAATGCTATTAGTTTTCTGG + Intergenic
1164915351 19:32047514-32047536 GGCCTGTGATCCTTGTTTTCTGG - Intergenic
1166010192 19:39935755-39935777 GGACAATGGCCTCTGTTTCCTGG + Intergenic
926410571 2:12597951-12597973 AGGCAATGGTCTTTGTTGGCTGG + Intergenic
930429134 2:51251543-51251565 GGGCAGTGGTATTTGTCTTCAGG - Intergenic
930976180 2:57464475-57464497 GGCCAATGCTCCTTTTTTTTTGG - Intergenic
931644103 2:64405889-64405911 GGCCAAGGTTGTTTGTTTTTGGG - Intergenic
932771243 2:74502025-74502047 GGCCAACGGTTTTCCTTTTCAGG + Intronic
933038515 2:77430930-77430952 GGCCAATTTGCTCTGTTTTCTGG + Intronic
935305814 2:101735375-101735397 GGCCAAAGGTCTTTATTTCTTGG + Intronic
935694608 2:105760619-105760641 AACCAAGGGTCTTTGCTTTCTGG + Intronic
937820333 2:126303126-126303148 TGCCCATGGTTTTTGCTTTCCGG - Intergenic
941305456 2:163859579-163859601 TGTCAATAATCTTTGTTTTCTGG - Intergenic
941373417 2:164696650-164696672 GGCAAATGAGTTTTGTTTTCAGG - Intronic
943546630 2:189288146-189288168 GCCCAAACGTCTTTTTTTTCTGG - Intergenic
945343813 2:208688816-208688838 GTCAAATTGTCTTTGTTTGCAGG - Intronic
945619791 2:212121125-212121147 GGCAAATAGTCTCTGCTTTCAGG + Intronic
1169205197 20:3735762-3735784 GGCCCAGAGTCTTTTTTTTCTGG + Intronic
1172912832 20:38422790-38422812 GGCCAAGGGTCTTCTTTTTAAGG - Intergenic
1175339437 20:58218805-58218827 GGCCAATGTTCTTATTTTACAGG - Exonic
1177603177 21:23342314-23342336 TGCCAATGATATTTCTTTTCTGG + Intergenic
1182453052 22:30432570-30432592 GGCCTTTAGTGTTTGTTTTCTGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
949568566 3:5269226-5269248 GGCCTATTGGCTTTGCTTTCTGG - Intergenic
950336292 3:12196645-12196667 GCCCACTGGTCTATATTTTCAGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959890090 3:111545024-111545046 GGCTCATGTTCTTTCTTTTCAGG + Exonic
960592145 3:119376863-119376885 AGCCAATTGTCTTGGTTTCCAGG + Intronic
961891505 3:130134056-130134078 AGCCCATGGTCTTTCTTATCAGG - Intergenic
964141545 3:153407423-153407445 GGCTAATTGTGATTGTTTTCTGG - Intergenic
965356197 3:167676149-167676171 GGCCCAAGGTCTTTTATTTCTGG - Intergenic
966072410 3:175895141-175895163 GTTGAACGGTCTTTGTTTTCTGG - Intergenic
966313910 3:178624862-178624884 GCCCCATGGTCTTTTTTCTCTGG + Intronic
968655247 4:1775762-1775784 GGCCAATGGGCTTTGTGGGCTGG - Intergenic
971566987 4:28157368-28157390 GGCCAGTGGAATTAGTTTTCTGG - Intergenic
972202703 4:36734291-36734313 GGCCATTAATCTTTGTCTTCTGG + Intergenic
975789961 4:77938540-77938562 GGCCACTGGTCTTACTTTTTTGG + Intronic
976395838 4:84554627-84554649 GCCAAATTATCTTTGTTTTCAGG + Intergenic
976444652 4:85116828-85116850 GGCCAATGGTCTGTGTACTTTGG + Intergenic
978320024 4:107482750-107482772 GGTCTTTGGTCTTTGTTTACTGG - Intergenic
978839271 4:113190629-113190651 GGCCATTGGTTTTTGTGTTACGG + Intronic
980381933 4:132033205-132033227 TGCTAATGGTCTTTGTTTAGTGG - Intergenic
982859051 4:160425632-160425654 GGCCAATGGTTTTGATATTCTGG + Intergenic
983091919 4:163514254-163514276 AGCAAATGGGCTTTGTTATCAGG + Intronic
983887300 4:172994680-172994702 TGCAAATTGTCTTTATTTTCAGG - Intronic
986237320 5:5924102-5924124 GGCAAATGGTCTTGGTTCACTGG + Intergenic
987741488 5:21914643-21914665 GGCCAATTTTCTTTCTTGTCAGG + Intronic
989036710 5:37181251-37181273 GGCATATTGTCATTGTTTTCAGG + Intronic
993171587 5:84426540-84426562 GGCAAAAAGTCTTTGTTTCCTGG - Intergenic
993405468 5:87506627-87506649 CATCAGTGGTCTTTGTTTTCAGG + Intergenic
995666379 5:114546550-114546572 GGTCATTGGTCTTTGTATTTGGG - Intergenic
997913515 5:137900544-137900566 GGGCAATGGTCCTTAGTTTCTGG - Intronic
1000543364 5:162568375-162568397 GGCCAATGGTCTGTGTTGCATGG - Intergenic
1000692395 5:164339838-164339860 GGCTAATGGACTATGTTGTCTGG + Intergenic
1004378493 6:15112192-15112214 GGCTAAGGTTCTTTGATTTCTGG - Intergenic
1004775540 6:18840465-18840487 GGCCAATTTTCTTAATTTTCTGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007703031 6:43775317-43775339 GGACAAAGGTCTTTGTTTGCTGG + Intronic
1007757533 6:44109972-44109994 GGCCAAAGGGCTTTATTCTCTGG - Intergenic
1012848288 6:104417588-104417610 GGCCACTGGTTTGTGTTTTGTGG + Intergenic
1016645893 6:146407717-146407739 GGCCAAAAATCATTGTTTTCTGG + Intronic
1017275787 6:152566358-152566380 GGGCAATGTTGTTTCTTTTCAGG + Intronic
1018603292 6:165569867-165569889 TGCCAAAAGTGTTTGTTTTCTGG + Intronic
1019203390 6:170339103-170339125 TGTCAATGGTCTTTATTTTTTGG + Intronic
1021774517 7:24039297-24039319 GGCCCAAGGTCTTTGTGTCCTGG - Intergenic
1024786152 7:52910643-52910665 GGCCAATTGTAATTGTTTTGAGG - Intergenic
1027552038 7:79610824-79610846 GGTCAATGGTCCTTGTTGCCAGG + Intergenic
1032704828 7:134412741-134412763 GGCCAATGGGGTATGTTTGCAGG + Intergenic
1034854157 7:154524863-154524885 CCCCACTGGTCTTTGCTTTCTGG + Intronic
1035660051 8:1340685-1340707 GTCCAATGGTGTTTGTCTTTAGG - Intergenic
1036978866 8:13446171-13446193 GTCAAAAGTTCTTTGTTTTCTGG - Intronic
1037063475 8:14545652-14545674 GGCAAATGGTTTTAATTTTCTGG + Intronic
1038168694 8:25108965-25108987 CCCAAATTGTCTTTGTTTTCTGG - Intergenic
1038701884 8:29856550-29856572 AGCCAATGGTTTTTGTTTGTTGG - Intergenic
1038923664 8:32113919-32113941 GGCCAATGGTCTAAGACTTCTGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1042018418 8:64343064-64343086 GACCATTGGTCCTAGTTTTCAGG - Intergenic
1042111324 8:65384147-65384169 GTCAAATGGTCTCTGTTTGCAGG + Intergenic
1046815026 8:118573462-118573484 GTCAAATGGTATTTGTTTTTTGG + Intronic
1050250930 9:3744137-3744159 TACCAATGGTCATTGTTTTTAGG - Intergenic
1055089825 9:72352147-72352169 GGCTAATGTTTTTTGTTTTTTGG - Exonic
1056466913 9:86866127-86866149 GGCCATTTGTCTTTGTTATTAGG + Intergenic
1057713620 9:97469526-97469548 GGCCTGTGGACTTTATTTTCAGG + Intronic
1059730889 9:117055792-117055814 TCCCAATGGTCTTTGCTTCCTGG + Intronic
1203760112 EBV:8351-8373 GGCCACTTGTCTTTGTTTATGGG + Intergenic
1188007935 X:25029825-25029847 AGCCTAAGGTCATTGTTTTCTGG + Intergenic
1189996988 X:46648307-46648329 GGCCAGTGGTCTTTCTCATCAGG + Intronic
1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG + Intronic
1193364763 X:80619098-80619120 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
1193653354 X:84167191-84167213 GGTTAATGTTCTCTGTTTTCTGG - Intronic
1195031802 X:100933558-100933580 AGGCAAGGGTCTTTGTTCTCAGG - Intergenic
1195137402 X:101922814-101922836 GGCTATTGGTCATTTTTTTCTGG - Intronic
1197601723 X:128539238-128539260 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
1198653020 X:138884471-138884493 GGCAAATGGACTTTGTTATTGGG - Intronic
1199470494 X:148190594-148190616 GGCCAATGTTTTTTTTTTTTTGG - Intergenic
1200119129 X:153782144-153782166 GGACAATGGTCTCTCTTTTGGGG - Exonic