ID: 1192470782

View in Genome Browser
Species Human (GRCh38)
Location X:71396862-71396884
Sequence GTCTCTACAAAAATTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3100
Summary {0: 2, 1: 117, 2: 621, 3: 1053, 4: 1307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192470776_1192470782 4 Left 1192470776 X:71396835-71396857 CCAGCCTAGGCAATGTGACAAGA 0: 2
1: 18
2: 202
3: 1655
4: 9315
Right 1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307
1192470773_1192470782 19 Left 1192470773 X:71396820-71396842 CCCAGGAGTTAGAGACCAGCCTA 0: 38
1: 1770
2: 19122
3: 34663
4: 31689
Right 1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307
1192470777_1192470782 0 Left 1192470777 X:71396839-71396861 CCTAGGCAATGTGACAAGACCCC 0: 1
1: 5
2: 108
3: 802
4: 4882
Right 1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307
1192470774_1192470782 18 Left 1192470774 X:71396821-71396843 CCAGGAGTTAGAGACCAGCCTAG 0: 64
1: 2988
2: 37546
3: 66703
4: 60330
Right 1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192470782 Original CRISPR GTCTCTACAAAAATTTAGCT GGG Intronic
Too many off-targets to display for this crispr