ID: 1192474910

View in Genome Browser
Species Human (GRCh38)
Location X:71432041-71432063
Sequence AGAGAGAAGACCAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 1, 1: 0, 2: 8, 3: 108, 4: 1076}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192474908_1192474910 -6 Left 1192474908 X:71432024-71432046 CCAACAGGTCAGGTGTTAGAGAG 0: 1
1: 0
2: 0
3: 8
4: 245
Right 1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG 0: 1
1: 0
2: 8
3: 108
4: 1076
1192474903_1192474910 27 Left 1192474903 X:71431991-71432013 CCAAGAGAAGAGGACTTCAAAGA 0: 1
1: 0
2: 1
3: 40
4: 577
Right 1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG 0: 1
1: 0
2: 8
3: 108
4: 1076

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192474910 Original CRISPR AGAGAGAAGACCAAAGAGGA TGG Intronic
900034563 1:396276-396298 AGAAAAGAGTCCAAAGAGGAAGG + Intergenic
900055394 1:626164-626186 AGAAAAGAGTCCAAAGAGGAAGG + Intergenic
900166718 1:1246900-1246922 AGTGAGGAGGCCAGAGAGGACGG - Intergenic
900343092 1:2197803-2197825 AGAGATAAGTCCACAGAGAAAGG + Intronic
900522285 1:3111496-3111518 AGAGGGAAGACCAGAGAAGGAGG + Intronic
900853260 1:5160621-5160643 AGAGAGGAGAGGAAAGAGGCAGG + Intergenic
901411550 1:9087829-9087851 AGAGAGAAGAGGAAGGAAGAGGG - Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902097508 1:13958796-13958818 AGAGAGGAGACCAATGTGGCTGG + Intergenic
902497890 1:16887110-16887132 AGTGAGAGGACCAAGGAGGGCGG - Intronic
902882646 1:19382937-19382959 AGAGAGAAGTCCAGTGAAGATGG - Intronic
903179751 1:21599239-21599261 AGAGAGGAGACTAGAGAGGAAGG + Intronic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903207307 1:21792264-21792286 AGGAAGAAGACCTAAGAAGAGGG + Intergenic
903365782 1:22804838-22804860 AGAGAGAGAAACAGAGAGGAGGG - Intronic
903664028 1:24995860-24995882 ACAGAGAAGGCCAAAGATGCAGG - Intergenic
904235522 1:29114183-29114205 AGACTGCAGCCCAAAGAGGATGG + Intronic
904290520 1:29482813-29482835 AGCAAGAAGACCAGGGAGGAAGG - Intergenic
904725660 1:32545734-32545756 AGAGAGAGCACCAAATGGGAAGG - Intronic
904820995 1:33244261-33244283 AGACAGAAGACTAAAGAGTTGGG - Intergenic
904879007 1:33680444-33680466 AGAGAGAGGCCCCAAGACGACGG - Intronic
904963437 1:34352669-34352691 AGGGAGAAAACCAAGGTGGAAGG + Intergenic
905097677 1:35487950-35487972 AGTGAGAAAACCACAGAAGAGGG - Intronic
905323168 1:37131895-37131917 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
905387357 1:37613914-37613936 GGAGAGAAGGACAAGGAGGAGGG + Intronic
905703696 1:40038916-40038938 AGAGAGAAGAGGAAGCAGGAAGG - Intergenic
905867958 1:41386541-41386563 AGAGAGAAGACGGGAGGGGAAGG - Intergenic
906255883 1:44349790-44349812 AAAGTGAAGCCCAGAGAGGAAGG + Intronic
906635010 1:47403615-47403637 AGAGAAAAGAGCACAGAGGCAGG - Intergenic
907080251 1:51615347-51615369 AGAAAGAAGAGCAGAGAGTATGG - Intronic
907383547 1:54110757-54110779 GGACAGAAGACCAGAGAGGCTGG - Intronic
907413979 1:54301623-54301645 GGAGAGAAGAACAAATGGGAAGG + Intronic
907668041 1:56450387-56450409 AGAGGGAAGACCAGATAAGAGGG + Intergenic
907804855 1:57808157-57808179 AGAGAGAAAAAGAAAGAGAAAGG - Intronic
908640684 1:66219772-66219794 AGAAACAAGATCAAAGAGTAGGG + Intronic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909681951 1:78301485-78301507 GGAAAGAATACTAAAGAGGAGGG - Intergenic
909699776 1:78510415-78510437 AGAGAGAGTAAGAAAGAGGAAGG + Intronic
909891984 1:81018750-81018772 AGAGATAAGATCATAGAGAAAGG + Intergenic
909900886 1:81133292-81133314 AGAAATAAGACCAAAGGGAAAGG - Intergenic
909949665 1:81704589-81704611 AGAAAGAGGACCAAAGAAGAAGG - Intronic
910165761 1:84325835-84325857 AGGAAGAGGACCAAAGAGCAGGG + Intronic
910509963 1:87992555-87992577 AGAGAGAGGCCAAAAGAGAAGGG + Intergenic
910668979 1:89753914-89753936 AGGGAGAAGAGCTAAGAGGCTGG + Intronic
910864801 1:91778435-91778457 AGAGGGAAGACCAAAAAAGAGGG + Intronic
911205733 1:95090180-95090202 AGAGAGAAGAGAAAAGGAGAAGG - Intergenic
911210251 1:95131561-95131583 AGAGTGAAGAACAAATTGGAGGG - Intronic
911247209 1:95531713-95531735 AGAGAGAGAAAGAAAGAGGAGGG + Intergenic
911452594 1:98083884-98083906 AGGGGGAAGACGGAAGAGGAAGG - Intergenic
911468356 1:98283441-98283463 ACAGAGAAGACCAAAAAGAATGG - Intergenic
911935507 1:103965216-103965238 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
911965502 1:104364454-104364476 AGAAAGAAGAACAAAGCAGAAGG + Intergenic
912548946 1:110471881-110471903 AGAGAGAAAAGCAGAGGGGAAGG - Intergenic
912567205 1:110596547-110596569 GTAGAGAAGACCAAAGAGACAGG - Intronic
912903301 1:113676021-113676043 AGAGAGAAGAGAAGATAGGAGGG - Intronic
912973931 1:114310822-114310844 AGTGAGAAGACAAGAGGGGAAGG + Intergenic
912997814 1:114549253-114549275 ACCGAGAAAACCAAGGAGGAAGG - Intergenic
913073179 1:115319166-115319188 TGAGAGATGACCAGAGAGAAGGG + Intronic
913123604 1:115765087-115765109 GGAGAGTAGAGGAAAGAGGAAGG - Intronic
913193092 1:116430247-116430269 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
913251162 1:116912750-116912772 CCAGAGAAGACCAGAGGGGAGGG - Intronic
913264105 1:117027620-117027642 AGAGATGAGACCAGTGAGGAGGG + Intronic
914006716 1:143738574-143738596 AGCGAGAGGACCAAGGAGGGCGG + Intergenic
914095727 1:144543153-144543175 AGCGAGAGGACCAAGGAGGGCGG + Intergenic
914302793 1:146390816-146390838 AGCGAGAGGACCAAGGAGGGCGG - Intergenic
914426959 1:147586492-147586514 GGCGAGAAGGCCAAAAAGGAAGG - Intronic
914645540 1:149649059-149649081 AGCGAGAGGACCAAGGAGGGCGG + Intergenic
914813094 1:151043846-151043868 AGACAGAAGACAAAAGAGCTGGG - Intronic
914987073 1:152470057-152470079 AGAAAGAAGACCAAGGGGGAAGG - Intergenic
915015986 1:152734317-152734339 AGAGAGAAAAGAAAAGAGGAAGG - Intergenic
915241409 1:154524939-154524961 GGACAGAGGACCAGAGAGGAAGG - Intronic
915294590 1:154911067-154911089 TGAGAGGAGACAAAAGAGCAGGG + Intergenic
915329573 1:155102004-155102026 AGAGAAATGGCCAAAGAGGCCGG + Intergenic
915334871 1:155135346-155135368 AGAGGGAGGGCAAAAGAGGAAGG + Intronic
915640135 1:157218544-157218566 AGGGAGAGGACCACAGAGGTGGG - Intergenic
916319406 1:163486733-163486755 AGACGGAATACCAAAGAGAAAGG - Intergenic
916368634 1:164062506-164062528 GGAGATAAGTGCAAAGAGGAAGG - Intergenic
916801844 1:168223233-168223255 AGAGATGAACCCAAAGAGGAAGG + Intergenic
917090005 1:171343337-171343359 ACAGAGCAGAGCAAAGATGATGG + Intergenic
917191642 1:172424685-172424707 AGAGATAAGAACAAGGAGGCCGG - Intronic
917213404 1:172653878-172653900 AAAGAGAAAAACAAAAAGGAGGG + Intergenic
917229090 1:172816710-172816732 AGAGAGAAGAGCAAGGAAGTGGG + Intergenic
917268615 1:173248660-173248682 AGAGAAAAGACAAGAGAGGCAGG + Intergenic
917736673 1:177927410-177927432 AGATTGCAGACCAAAGAGGAAGG - Intronic
917948038 1:179997206-179997228 AGAAAGAAGAACAAAGAAGCAGG - Intronic
918305858 1:183245557-183245579 AGAGAAAAGAACATGGAGGAAGG + Intergenic
918521208 1:185416800-185416822 AGACAGAAGAGCACAGAGGCAGG + Intergenic
918707330 1:187682170-187682192 AGAGAGATAATAAAAGAGGATGG + Intergenic
918726288 1:187928600-187928622 AGAGAGAAGAAACAAGGGGAGGG - Intergenic
919195441 1:194278926-194278948 AGAGAGAACAAGAAAGAGAAAGG + Intergenic
919948865 1:202343847-202343869 GGATAGAAGACAAAAGAGGAAGG + Intergenic
920131201 1:203733153-203733175 AGAGAGGTGAAGAAAGAGGAAGG - Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920577560 1:207072682-207072704 AGAGAGAAGATCCAAGAGTGTGG - Exonic
920734848 1:208523975-208523997 AGAGAGAAGAGAAAAGAAGAAGG - Intergenic
920746155 1:208630811-208630833 AGAGAGAAGAGCAGATGGGAGGG + Intergenic
920777010 1:208948711-208948733 AGAGAGAAGAGGAGAGGGGATGG + Intergenic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
921840744 1:219825722-219825744 AGGGAGAAGGCCAGAGAGGTGGG + Intronic
921924910 1:220703401-220703423 AGAGAGAGGGCTGAAGAGGATGG + Intergenic
922256920 1:223900483-223900505 AGAAAAGAGTCCAAAGAGGAAGG + Intergenic
922961236 1:229647284-229647306 AGAGAACAGACCCAAGAGGAAGG - Intronic
923340893 1:233006084-233006106 ACATAGAAGACCAAAGACTATGG + Intronic
923498261 1:234543449-234543471 GGAGAGAAAAACAAAAAGGAAGG - Intergenic
923508449 1:234627442-234627464 AGAGAGAAAACCGAAGAGCAGGG - Intergenic
923784136 1:237051335-237051357 GGAGAGAAGACGAGAGGGGAGGG - Intronic
923822615 1:237462275-237462297 AGAGAGAAAACCAAGAAGGTGGG + Intronic
924027313 1:239847929-239847951 AAAGAGAAGAGAAGAGAGGAGGG + Intronic
924338116 1:243003296-243003318 AGAAAAGAGTCCAAAGAGGAAGG + Intergenic
924502387 1:244649888-244649910 AGAGAGAAGAGCACCGAAGATGG + Intergenic
924609565 1:245562595-245562617 AGAGAGAAGAGCATGGGGGAAGG - Intronic
924627845 1:245710600-245710622 AGAGACAGGATCAAAAAGGATGG - Intergenic
924628061 1:245711923-245711945 AGAGGGGAGAGCACAGAGGATGG - Intergenic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
1062990559 10:1810562-1810584 AGAGAGGAGAAAAAAGAGGGAGG + Intergenic
1063022360 10:2142318-2142340 AGAGAGAAAACCAGAGAAAATGG - Intergenic
1063964552 10:11336879-11336901 AGAAAGGGGACCAAAGAGAAAGG + Intergenic
1064173528 10:13054659-13054681 AAAGAGAGGAGCAGAGAGGAGGG - Intronic
1064244070 10:13655613-13655635 AGACAGCAGGGCAAAGAGGAAGG - Intronic
1064460560 10:15531261-15531283 AGAGAGAAAATTAAAAAGGAAGG - Intronic
1064591088 10:16891439-16891461 AGAGAGAAAACCAAGGAGGAAGG + Intronic
1064785249 10:18887849-18887871 AGAGAGGAGAGAAGAGAGGAAGG + Intergenic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065298516 10:24299854-24299876 AGAGAGAAGTCTAAATGGGAGGG - Intronic
1065361594 10:24894350-24894372 AGAGAGAAAAGAAAATAGGAGGG + Intronic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065741373 10:28800136-28800158 TGAGAGAAGAGCAAAGGGGAGGG - Intergenic
1065790364 10:29254763-29254785 AGGGAGCAGACCACAGAGGCAGG + Intergenic
1065866561 10:29919860-29919882 AAAGAGAAGAGGAAAGAGAAGGG - Intergenic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066420099 10:35257235-35257257 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1066542122 10:36458690-36458712 AGAGAGAAGTGCAGAGAGAAGGG + Intergenic
1069007815 10:63337488-63337510 AGAAAGAAGAGAAAAGAGAAGGG + Intronic
1069300206 10:66898390-66898412 AGAGAGAAGAACAAAGATTGAGG + Intronic
1069378915 10:67822225-67822247 AGAAAGCAGCCCAAAGAGGCTGG + Intronic
1070843383 10:79503439-79503461 AGAGAGAAGATGAGAGAGAAGGG - Intergenic
1071086450 10:81873664-81873686 AAAGTGAAAACCGAAGAGGAGGG - Intergenic
1071371581 10:84957046-84957068 AGAGGAAAGGACAAAGAGGAAGG - Intergenic
1071409512 10:85375039-85375061 AGAAAGAAGATAAAAGAGGGAGG - Intergenic
1071554886 10:86594348-86594370 AGAAAGAAAACGAAAGAGGGAGG + Intergenic
1071862707 10:89690672-89690694 AGAGAGAATCCCAGACAGGATGG - Intergenic
1072810546 10:98458049-98458071 GGAGATTAGACCAAAGAGGAGGG - Intronic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073055852 10:100700768-100700790 AGAGGGAACAGCAAAGTGGATGG - Intergenic
1073418685 10:103406093-103406115 AGACAGAAGAACAAAGGTGAGGG + Exonic
1073901093 10:108221973-108221995 AGAGAGAAGAGCTGGGAGGATGG - Intergenic
1073985188 10:109200154-109200176 AAAGTGAAGAACAAAGAGGAAGG + Intergenic
1074232067 10:111547468-111547490 AGAGAGATGAGCACAGAGGCAGG - Intergenic
1074307101 10:112289026-112289048 AGATAGAAGCCCAGAGAGGTTGG - Intronic
1074513517 10:114141604-114141626 AGAGAGGAAACTACAGAGGAGGG - Intronic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074953780 10:118367470-118367492 AGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1075259576 10:120950758-120950780 ATAGTGAAGAACAAAGAAGAGGG - Intergenic
1075377032 10:121986807-121986829 AGAGAGAAGTCCAAAACGGGAGG - Intergenic
1076284524 10:129280213-129280235 ACAGAGAAAGCCAAACAGGATGG + Intergenic
1076303192 10:129443327-129443349 AGATAGAAGACGAAAGAGGGAGG + Intergenic
1078025166 11:7688153-7688175 AAAGGGAAGACCAAAGAAAAAGG - Intergenic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078326164 11:10382893-10382915 GGGGAGAAAACCAAAGAGGGAGG - Intronic
1078371990 11:10755597-10755619 AAAGTGAAAACCAAATAGGAAGG - Intronic
1078728589 11:13955361-13955383 AGGAAGCAGACTAAAGAGGATGG - Intergenic
1078986527 11:16604413-16604435 AGAGAGAAGACCCTAGTGGGCGG + Intronic
1079288930 11:19168304-19168326 AGAGAGAAGAGAAGAGAGGCAGG - Intronic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079515480 11:21262850-21262872 AAAGAGAAGACCAAGGAAAAAGG - Intronic
1079624915 11:22605626-22605648 AGAGAGAACAGCAATGAGGCAGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079916812 11:26379223-26379245 AGAGAAAAGATCAAAGATGTAGG + Intronic
1079987626 11:27215517-27215539 TGACAGAAGAACAAAGATGAAGG + Intergenic
1080432101 11:32208838-32208860 CAAGCGAGGACCAAAGAGGATGG + Intergenic
1080437630 11:32260866-32260888 AGATATAAGACAAAAGAAGAAGG - Intergenic
1080514388 11:33006602-33006624 AGCAAGAAGACCAATTAGGAAGG + Intergenic
1080741693 11:35070624-35070646 AGAAAGAGGATCAAAAAGGACGG + Intergenic
1080774202 11:35370654-35370676 AGAGCTAAGAGCAGAGAGGAGGG + Intronic
1080808342 11:35677360-35677382 AGAAAGAAGACCAAAGAGAAGGG - Intronic
1081384009 11:42449252-42449274 AGAGAGAAGAGCAAATACAAGGG - Intergenic
1081424686 11:42912671-42912693 GGAGAGAAGACCAAAGACTTTGG - Intergenic
1081578538 11:44334879-44334901 AGAGAGAAGCTTCAAGAGGACGG - Intergenic
1081596922 11:44465930-44465952 AGAAAGAAGAAAAAAGAAGAAGG - Intergenic
1081668690 11:44931437-44931459 AGAGGGAGGACCCAAGAGAAAGG + Exonic
1081862996 11:46344947-46344969 AGAGAAATGAGCAATGAGGATGG - Intronic
1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG + Intergenic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1083814481 11:65124898-65124920 AGAGAGAAAACCCAAGAGCTTGG + Intronic
1083874784 11:65516251-65516273 AGAGAGGAGAGGAGAGAGGAGGG + Intergenic
1084085292 11:66852317-66852339 ACGAAGAACACCAAAGAGGAAGG - Intronic
1084145484 11:67262970-67262992 AGAAGGAAGACCAGAGAGGCTGG + Intergenic
1084195355 11:67521464-67521486 TGACATAGGACCAAAGAGGAAGG - Intronic
1084270791 11:68028078-68028100 AGAGGGAAGACCCAGGAGGGAGG - Exonic
1084563597 11:69917576-69917598 AGAGAGAAGAGAAGAGAGAAGGG - Intergenic
1085051114 11:73380756-73380778 GGAGAGAGGACCAGAGAGGAAGG + Intronic
1085170346 11:74444515-74444537 GGAGAAAAGACAGAAGAGGAAGG - Intergenic
1085325008 11:75599852-75599874 AAAGGGAAGCTCAAAGAGGAGGG - Intronic
1085837194 11:79969731-79969753 GGAGAGAAGAGAAAAGAAGATGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086482814 11:87261568-87261590 AGAGAGAAGTACAAAGAGGGAGG - Intronic
1087043565 11:93825099-93825121 AGAAAGAAGAACAAAGCTGAAGG - Intronic
1087055825 11:93935077-93935099 TGAGAGAAGACCAAATACAAAGG - Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088517604 11:110655754-110655776 ACAGAGATGACCAAAAAAGAGGG + Intronic
1088618089 11:111653475-111653497 AAAGAGAAGATCCAAGAAGATGG + Intronic
1088767016 11:112992078-112992100 AGAGAGGAGACTGTAGAGGATGG + Intronic
1088771646 11:113041919-113041941 AGAGAGAAGAGAAAAGCTGAGGG - Intronic
1088810948 11:113391778-113391800 AGGGAGAAGAGCAGAGAAGAAGG + Intronic
1088850373 11:113699030-113699052 TTAGAGAAGAACAAAGAGAAAGG + Intronic
1089293295 11:117451264-117451286 AGAGACAGGCCCAGAGAGGAGGG - Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089933134 11:122334568-122334590 AGAGAAGAAAGCAAAGAGGATGG + Intergenic
1090125245 11:124077410-124077432 AGAGAGAAAAAGAAAGAAGATGG - Intergenic
1090144807 11:124310302-124310324 AGAGAGAAAGCCCAAGAAGAAGG + Exonic
1090589961 11:128255852-128255874 GGACAGAATACCAGAGAGGAGGG + Intergenic
1090657404 11:128856467-128856489 AGAGAGAGGACCGCAGAAGAGGG + Intronic
1090703371 11:129315642-129315664 GGAGTGAAGACCCAGGAGGAAGG - Intergenic
1091418782 12:316059-316081 AGAGAGAAGGCCAAAGGCAAAGG + Intronic
1091481732 12:839479-839501 AGAGAGAAGGCCAAAGTGGATGG + Intronic
1091812086 12:3408207-3408229 AGAGAGGATAGGAAAGAGGAAGG - Intronic
1091819066 12:3460912-3460934 GAAGAGAAGACAGAAGAGGAGGG + Intronic
1092092325 12:5813059-5813081 GGAAGGAAGACGAAAGAGGAAGG + Intronic
1092520535 12:9268004-9268026 AAAGCGAAGGTCAAAGAGGAGGG - Intergenic
1092601605 12:10072183-10072205 AGAGAGAACACAAAAGAGAAGGG - Intronic
1092830612 12:12441000-12441022 TGAGACAAGATCAAAGATGAAGG + Intronic
1092998241 12:13971380-13971402 AGAGAGTAAGCCAAAAAGGAAGG + Intronic
1093208058 12:16274717-16274739 AAAGGGATGTCCAAAGAGGAGGG + Intronic
1093397588 12:18702564-18702586 AGAGGGAAGACCCAAGATGATGG - Intronic
1093410166 12:18855769-18855791 AGAGAGAAGGACAAAGATGGAGG + Intergenic
1093525383 12:20099157-20099179 AGAGAGAATTCCAAGGAAGAGGG + Intergenic
1093700447 12:22214176-22214198 AAAGAGTAGACAAAAAAGGAAGG + Intronic
1093711025 12:22330099-22330121 AGAGAGAACAGCAAAGATCAAGG - Intronic
1093818560 12:23582188-23582210 AGGTAGAAGACGAAAGAGAAAGG - Intronic
1093885003 12:24449315-24449337 AGAGAGAAGACTAATGTGGTTGG - Intergenic
1094033260 12:26038014-26038036 AGACAACACACCAAAGAGGAGGG - Intronic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094820838 12:34222984-34223006 AAACAGAAGAGCAAAGATGAGGG - Intergenic
1095616208 12:44192386-44192408 AGGGAGAAGACCAAATAAAATGG + Intronic
1095876140 12:47080821-47080843 AGAGAGAGAACGAAAGAGAAAGG - Intronic
1096685958 12:53288472-53288494 AGAAGGAAGAACAAAGAGAATGG + Intronic
1096999961 12:55868194-55868216 AGAGAGAAGACCCAAAAAAAGGG + Intergenic
1097613866 12:61860588-61860610 AGAGCAAAGAGCAAAGAGGATGG - Intronic
1097757649 12:63425128-63425150 AGAGAGAAGACCCTTGTGGATGG + Intergenic
1097832866 12:64244031-64244053 AGAGAGAAGACCAATGTGGTGGG + Intergenic
1097984846 12:65772127-65772149 AGAAATAAGACAAAAGAGTAAGG + Intergenic
1098652853 12:72995610-72995632 AAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1098792829 12:74847559-74847581 AGAGAGAAGAATATAGAGAAAGG - Intergenic
1098857339 12:75667744-75667766 AGAGAGAAGAACAAATACAAAGG - Intergenic
1099085027 12:78235275-78235297 AGAGAGAAGACCAAGGGCAAAGG + Intergenic
1099171960 12:79375656-79375678 ATAGAGAATAACAAAGAGCAAGG - Intronic
1099938399 12:89155684-89155706 AGAGAGAAGAAGAAATAGAAAGG + Intergenic
1099944227 12:89225604-89225626 GCAGAGAAAACCAAAGAGGGGGG + Intergenic
1100022790 12:90090201-90090223 AAAGAGAAGAGAAAAGAGGCCGG - Intergenic
1100950704 12:99846274-99846296 ACAGAGAAGAGAGAAGAGGAGGG - Intronic
1101008890 12:100429942-100429964 AGAGAGCAGAAGAAAGAGAAGGG - Intergenic
1101201202 12:102438221-102438243 AGAAAGAAGACCGCAGAGGAAGG - Intronic
1101392428 12:104314134-104314156 TGAGATGAGACCAGAGAGGAAGG + Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1101830954 12:108256102-108256124 AGAGAGAAGAGAAAGAAGGAAGG - Intergenic
1102772038 12:115486447-115486469 CTAGAGAAGAGCAGAGAGGAGGG + Intergenic
1102925138 12:116820766-116820788 AGAGAGAGGCTCAAAGAGGCAGG - Intronic
1103688567 12:122752357-122752379 AGAGAGAAAAGAAGAGAGGAAGG + Intergenic
1104578713 12:129992968-129992990 AGAGTGAAGAACACTGAGGAAGG - Intergenic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1105237910 13:18577660-18577682 TGAAAGAAGAACAAAGATGAAGG + Intergenic
1105671782 13:22626696-22626718 GGAGAGAAGTACAAAGAGGTAGG + Intergenic
1106075363 13:26456238-26456260 AAAAAGAAAAACAAAGAGGATGG + Intergenic
1106085504 13:26538360-26538382 TAAAAGAAGACCAAAGAGAAGGG + Intergenic
1106470454 13:30049650-30049672 AGAGACAAGACAAAAAAGGCTGG + Intergenic
1106547511 13:30743464-30743486 ACAGACAAGGCCAAAGAGGGAGG - Intronic
1106712514 13:32353257-32353279 AGAGATAAGTGAAAAGAGGAGGG - Intronic
1106713278 13:32360956-32360978 ATTGAGAAGACCAAAGATGGAGG + Intronic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1106774061 13:32991486-32991508 AGCGGGAAGACCAGTGAGGAGGG + Intergenic
1106834197 13:33616153-33616175 AGAGAGAGAAGCAAAGAGGAGGG + Intergenic
1108342632 13:49513138-49513160 AGAAAGAAATCCAGAGAGGAAGG + Exonic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108463542 13:50692137-50692159 AGAGAAAAGGTCAGAGAGGATGG - Intronic
1108476875 13:50828886-50828908 AGAGAAAAGAACAAAAAGTATGG - Intronic
1109230025 13:59745202-59745224 AAAGAGAAGGCAAAAGAGAAGGG + Intronic
1109363083 13:61322079-61322101 AGAGAGAAGAACAAAGTTGGAGG + Intergenic
1109428124 13:62194503-62194525 AGTGAGAAGGACATAGAGGATGG - Intergenic
1110516292 13:76416659-76416681 AGAGAGAAGATGAGATAGGATGG - Intergenic
1111364923 13:87230486-87230508 AGAGAGAAGGACAGAAAGGAAGG - Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111670271 13:91321112-91321134 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1111836757 13:93397755-93397777 AGAGAAAAAAAAAAAGAGGAGGG - Intronic
1112039621 13:95533826-95533848 AGAGAGAAGATCAGAGTGGAGGG - Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112617085 13:101016861-101016883 AGAGAGAAAACAAGAGATGAAGG + Intergenic
1112832358 13:103468897-103468919 AGAGTCAAGACCAAAAAGGAGGG - Intergenic
1112979969 13:105371459-105371481 AGAGAAAAGAGCAAAGCTGAAGG + Intergenic
1113258040 13:108528778-108528800 AGAGAGAAGAGAGAAGAGGGAGG - Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114385244 14:22247398-22247420 AGAGATAAGAACCAACAGGAAGG + Intergenic
1114430526 14:22656805-22656827 AGAGAGAATAACAAGGAGGGGGG + Intergenic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114709681 14:24765909-24765931 AGAGGGATGAGAAAAGAGGATGG - Intergenic
1114930035 14:27454957-27454979 AGAGAGAAGACACAGGAGTAAGG + Intergenic
1115158797 14:30369586-30369608 AGAGAGAACTCCATAGATGAGGG + Intergenic
1115623225 14:35162059-35162081 AGAAAGAAGAAAAAAGAGAAGGG - Intronic
1115782638 14:36786747-36786769 AGAAAGAAGACCAAAAAATATGG + Intronic
1115906827 14:38210348-38210370 TGAGAGAAAGCCATAGAGGATGG - Exonic
1116153594 14:41174232-41174254 AGAAAGAAGAGCAAAGTGGAGGG + Intergenic
1116289770 14:43018478-43018500 AGAGAGATGACTGAAGAGAATGG + Intergenic
1117116343 14:52517152-52517174 AAAGAGAAGACCAGAGCGGGAGG - Intronic
1117312139 14:54537835-54537857 AGAGATAAGACTACAGAGTACGG - Intronic
1117434152 14:55700317-55700339 AGACAGAAAACCAAGCAGGAGGG + Intronic
1117591654 14:57275455-57275477 AGAGAGAAGAGAAAAGAGAGAGG + Intronic
1117795845 14:59393738-59393760 AGAGAGATGACCATAGAAGAAGG - Intergenic
1117955968 14:61123851-61123873 AGAAGGAAGACCATAGGGGAGGG - Intergenic
1117994520 14:61466483-61466505 AGAGAGAGGAACAAAGACTAGGG + Intronic
1118112063 14:62732912-62732934 AGAGAGAATAGAAGAGAGGAGGG - Intronic
1118329764 14:64806140-64806162 AGAGAGAAAAGGATAGAGGAGGG + Intronic
1118349793 14:64965570-64965592 AGAGAGAAGAGCCAAGGAGAGGG + Intronic
1118392159 14:65304524-65304546 AGAGAGAAGAGCTAGGTGGAAGG - Intergenic
1118467033 14:66040339-66040361 AGAAAGAAAACCACAGAGGTGGG - Intergenic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1119084867 14:71730431-71730453 AGAGAGAGGGCAAATGAGGAAGG - Intronic
1119282837 14:73424974-73424996 AGAAAGAAGAACAAAAAGGAGGG - Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120117885 14:80641844-80641866 AGAGAGAAGGCCAAGGCGGGTGG + Intronic
1120213594 14:81658531-81658553 AGAGAGAAACACAAAGAGGGAGG - Intergenic
1120953258 14:90061335-90061357 AGAGAGGAGACCAGAAAGGGAGG - Intergenic
1121408881 14:93735667-93735689 AGAAAGAAAACCAAAGTGGATGG - Intronic
1121478582 14:94238960-94238982 AGAGAAAAGATCAAAGATGATGG - Intronic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121550520 14:94796150-94796172 AGAGGGATGGTCAAAGAGGAAGG + Intergenic
1121710696 14:96037673-96037695 AGAGTGAATACTAAATAGGATGG + Intergenic
1121742269 14:96262572-96262594 AGAGAAAAGAAAAAAGAGAAAGG - Intronic
1122662698 14:103308717-103308739 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1122777715 14:104129489-104129511 AGAGAGAAGGAAAAAAAGGAAGG - Intergenic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1124227397 15:27905581-27905603 GGAGGAAAGAGCAAAGAGGAAGG + Intronic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1124396274 15:29304734-29304756 AGAGAGGGGATCATAGAGGAAGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124803682 15:32860133-32860155 AGAGAGAAAGAAAAAGAGGAAGG + Intronic
1124810968 15:32937614-32937636 AGAGAGAAGACAAAAGTGGCTGG + Intronic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125368329 15:38942924-38942946 AGGGAGAAGAGCAGGGAGGAAGG + Intergenic
1125542022 15:40475085-40475107 AGAGAGAAGAAGGAATAGGAAGG + Intergenic
1126117777 15:45224697-45224719 AGTGAGCAGACAAAAGAGGCTGG - Intergenic
1126868380 15:52960876-52960898 AAAGAGAAGAACAAAGTAGAAGG - Intergenic
1126882453 15:53113954-53113976 AGAGAGAAAACCTAGGAGGTTGG - Intergenic
1127205969 15:56719378-56719400 AGAGAGGAAGCGAAAGAGGAGGG - Intronic
1127219146 15:56859434-56859456 AGAGAAGAGACCAAAGTGGTAGG - Intronic
1127502845 15:59570753-59570775 AGAAAGAAGAAAAAAGATGAGGG - Intergenic
1127561210 15:60138172-60138194 CCAGAGAAGAACAAAGAAGAAGG + Intergenic
1127944110 15:63732639-63732661 AGAGAGAAGAATAATGAGCAAGG - Intronic
1128095710 15:64953343-64953365 AGAAAGAAGAACTAAGAAGAAGG - Intronic
1128678798 15:69631327-69631349 TGGGAGCAGAGCAAAGAGGAGGG + Intergenic
1128789636 15:70423628-70423650 AGAGTGAAGACCAGAGAGTGTGG - Intergenic
1129093864 15:73182328-73182350 AGAGGGCAGATCAAAGTGGAAGG + Intronic
1129107992 15:73322443-73322465 AGAGAAAAGAAGAAAGAAGAGGG + Exonic
1129119523 15:73387514-73387536 AGGGGGAAGAGCAAACAGGAGGG + Intergenic
1129451500 15:75653620-75653642 AGCCAGAAGGCGAAAGAGGAGGG + Intronic
1129542836 15:76364874-76364896 AGAGCTAAGACTAAAGAGGCAGG - Intronic
1129896130 15:79107334-79107356 AGACAGAATACCAAAGAAAAGGG - Intergenic
1130323659 15:82860976-82860998 AGAGAGAAAGCGAAAGAGAAAGG + Intronic
1130390432 15:83449258-83449280 AGAGAGAAGACCATCATGGAAGG + Intronic
1130624108 15:85495785-85495807 TGAGAGAAAACAAGAGAGGAAGG - Intronic
1131014224 15:89043857-89043879 AGAGAAAAATACAAAGAGGAGGG - Intergenic
1131651925 15:94409700-94409722 AGAGAGAGGAGGAAAGAGGGAGG - Intronic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131856700 15:96604896-96604918 AGAGTGTAGGGCAAAGAGGAGGG + Intergenic
1131869649 15:96749369-96749391 AGACAGAAGAACATAGAGGAAGG + Intergenic
1131979781 15:97983568-97983590 ACAGAGAGGACTGAAGAGGAAGG - Intergenic
1132078654 15:98845546-98845568 CGAGAGAAGAGGAGAGAGGAGGG - Intronic
1132251773 15:100340560-100340582 AGAGAGAAGACTCAAAAGGAAGG + Intronic
1132460671 16:52924-52946 AAAGACAAGACCAATGAGTAAGG + Intronic
1133282236 16:4673361-4673383 AAAGAGAAGTCCAGAGGGGAGGG - Intronic
1133523680 16:6583046-6583068 GGAGTGAACACCAAAGAGAAGGG - Intronic
1133526121 16:6607479-6607501 AGAGAGAGGAAGAAAGAGTAAGG - Intronic
1133906195 16:10025002-10025024 AGAGAGGAGAGAAAAGAAGAGGG + Intronic
1133915305 16:10104273-10104295 AGAGAAAAGAGAAAAGTGGATGG + Intronic
1133922416 16:10165664-10165686 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1134125658 16:11614266-11614288 AGAAAGAAGAGGAAAGAAGAAGG - Intronic
1134228613 16:12411746-12411768 AGAGAAAGGAACAAGGAGGAGGG + Intronic
1134384188 16:13756657-13756679 AGAGACAAATCCAAAGAGAAAGG - Intergenic
1134569380 16:15278458-15278480 AGAGAGAAGAGGAAAATGGAGGG - Intergenic
1134596288 16:15498623-15498645 AGAGAAAGGAAGAAAGAGGAAGG + Intronic
1134732997 16:16477587-16477609 AGAGAGAAGAGGAAAAGGGAGGG + Intergenic
1134934441 16:18234386-18234408 AGAGAGAAGAGGAAAATGGAGGG - Intergenic
1135065320 16:19304839-19304861 TGAAAGAAGATCAGAGAGGAAGG + Intronic
1135066558 16:19314969-19314991 AGAGGGAAGAAGAGAGAGGAAGG + Intronic
1135678605 16:24438348-24438370 AGAGAGAAGACTTAAGAGGGAGG + Intergenic
1135732228 16:24904613-24904635 AGAGAGAAGTGCAAATAGGGAGG - Intronic
1135853546 16:25986066-25986088 AGAGAGTAAAACCAAGAGGATGG - Intronic
1135881607 16:26263175-26263197 GCAGAGAAGATCAAAGGGGAAGG + Intergenic
1135971980 16:27078897-27078919 AGAGAAGGGAGCAAAGAGGAGGG + Intergenic
1136418960 16:30120576-30120598 AGTGAGAAGTCCTAAGAAGAAGG + Intronic
1137932061 16:52598214-52598236 GGAGAGAAGCCCAAAGAGGGGGG + Intergenic
1138103595 16:54274464-54274486 AGAGAGAATAAGAGAGAGGAAGG - Intergenic
1138814014 16:60183573-60183595 AGAGAGAAAAGCAAATAGAAAGG - Intergenic
1138818243 16:60227485-60227507 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139194408 16:64902340-64902362 AGAGGAAAGACCAAGTAGGAGGG - Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140235912 16:73158455-73158477 AGAAAGAAGAGAAAAGAGAAGGG - Intergenic
1140684733 16:77422535-77422557 AGAGTGAAAAAAAAAGAGGAAGG + Intronic
1141064569 16:80903470-80903492 AGAGATAAGACCCATGAGCATGG - Intergenic
1141255204 16:82395767-82395789 AGAGAGAAGACCTAGGGGGCTGG - Intergenic
1141318781 16:82987162-82987184 ATATTGAAGACCACAGAGGAGGG - Intronic
1141473501 16:84255498-84255520 TCAGAAAGGACCAAAGAGGATGG - Intergenic
1141984653 16:87571940-87571962 AGAGGGAAGACGAATGAGGCAGG + Intergenic
1142720586 17:1773170-1773192 AGACAGAAGAGCAGAGAGGGAGG + Intronic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143312430 17:6003059-6003081 ACAGAGAGGAGCACAGAGGAGGG + Intronic
1143487707 17:7263541-7263563 GGGGAGATGACCAAAGATGAAGG - Intronic
1143490653 17:7283609-7283631 AGAGATGATACCAATGAGGAAGG - Exonic
1144046407 17:11458349-11458371 AGAGTGAAGAACAAAGAGAGAGG - Intronic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144335223 17:14262571-14262593 TGAAAGTAGACCAAAGAGAAGGG + Intergenic
1144733502 17:17541964-17541986 AGAAAAAAGAAAAAAGAGGAAGG - Intronic
1145885555 17:28380313-28380335 AGAGAGAGGAGCAAGGATGAAGG - Intronic
1145887483 17:28392671-28392693 AGAAAAAAGCCCAGAGAGGAAGG - Intronic
1146156927 17:30532292-30532314 AGGTAGAAGACCAAAGGGCAAGG + Intergenic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1146543174 17:33715446-33715468 TGAGACAAGCACAAAGAGGATGG + Intronic
1146618169 17:34373231-34373253 AGAGAGAAGAGCAAAGTGCCTGG - Intergenic
1146664064 17:34685194-34685216 AGAAAGAAGTCCAAGAAGGAGGG - Intergenic
1146687608 17:34852039-34852061 AGAGAGAAGCCCACAGATGTGGG + Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147002848 17:37377175-37377197 AGAAAGAAGACAGAATAGGAGGG + Intronic
1147049969 17:37786873-37786895 AGTGAGAAGACAAAAGGGGTAGG + Intergenic
1147762136 17:42805607-42805629 AGAGACAAGACTGAAGATGAAGG + Intronic
1147773838 17:42886474-42886496 AGAAGGAAGAGGAAAGAGGAAGG - Intergenic
1147868405 17:43569741-43569763 AGAGAGGAGCCCACAGAGGTGGG - Intronic
1148378475 17:47172819-47172841 AGAGGCAACAACAAAGAGGATGG + Intronic
1148481769 17:47964410-47964432 GGAGAGGAGAGAAAAGAGGAAGG - Intergenic
1148556145 17:48579727-48579749 AGATAGAGGAATAAAGAGGAAGG + Exonic
1148560795 17:48604861-48604883 AGAGAGAGGACGAGAGAGGGGGG - Exonic
1148579491 17:48733955-48733977 AGAGAGAGGAAAAAAAAGGAAGG - Intergenic
1148829790 17:50424236-50424258 AGAGTGAAGACACAAGAGGAAGG + Intergenic
1148864060 17:50619464-50619486 AGAGGGAAGGCGAAGGAGGAAGG - Intronic
1148893431 17:50824485-50824507 AGAGAGAAGGCCAATAAGGCTGG + Intergenic
1149115889 17:53096415-53096437 AGAAAGAAGAAGAAAGATGAAGG + Intergenic
1149540891 17:57467361-57467383 AAAGGGAAGAGAAAAGAGGAAGG + Intronic
1150142037 17:62738456-62738478 AGAGAGGAGAACAAAGCGGGGGG - Intronic
1150278127 17:63912911-63912933 AGAGAGAGAGACAAAGAGGAAGG - Intronic
1150631742 17:66884956-66884978 AGGGAGAAGACAGCAGAGGATGG - Intronic
1150931814 17:69592965-69592987 AGAGAGAAGAAAAAAATGGAGGG - Intergenic
1150993427 17:70287494-70287516 AGAGAGAAAACCAAGAACGAAGG - Intergenic
1151026206 17:70679878-70679900 AGACAGAAGACCACAGAAGCAGG + Intergenic
1151055375 17:71024724-71024746 AGAGAGAAGACCAAACAATCAGG + Intergenic
1151076793 17:71282619-71282641 GAAGAGAAGACAAGAGAGGAGGG + Intergenic
1151484573 17:74390407-74390429 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1151604118 17:75125460-75125482 AGAGGGAAGAACAGACAGGACGG + Intronic
1151900314 17:77008061-77008083 AGAGAGGAGACCAGAGGGAAGGG - Intergenic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152168511 17:78726970-78726992 AGAGAGAACTGGAAAGAGGATGG - Intronic
1152175435 17:78783710-78783732 AGGAAGGAGACCAAAGAGAAAGG - Intergenic
1152226427 17:79094906-79094928 AGAGAGAGGGTCAACGAGGAGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152386222 17:79976416-79976438 AGAGAGAAGAGGATGGAGGAAGG + Intronic
1152913032 17:83016451-83016473 AGAGAGAAGAGAATAAAGGAGGG + Intronic
1153086181 18:1290691-1290713 AGAGAGAGGACAAAAGAAGGGGG - Intergenic
1153610021 18:6874855-6874877 ACAGAGCAGCCCAAAGAGGCTGG + Intronic
1153864754 18:9254801-9254823 TCAGAAAAGACCAGAGAGGAGGG + Exonic
1154325192 18:13385553-13385575 AGAGAGAAAACCAAACTGCAGGG - Intronic
1155406008 18:25487833-25487855 AGAGAGCACCCCAAACAGGAAGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155628515 18:27863896-27863918 AAAGAGAACAGCAAAGAGTAAGG - Intergenic
1155810960 18:30234432-30234454 AGATAGAAAAGCAAAGTGGATGG - Intergenic
1155868729 18:30998704-30998726 ACAGAGAAAACCAAAGTGGCAGG + Intronic
1155904912 18:31438719-31438741 AGAGAGAAAACCCTAGATGAGGG + Intergenic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1157270711 18:46273894-46273916 AGACAGATAACCAAAGAGAATGG + Intergenic
1157424934 18:47576836-47576858 AGAGTGGAGACCAAGGAGGCTGG + Intergenic
1157890474 18:51411255-51411277 AGAGAGAAGGCCAATGGGGCTGG + Intergenic
1158087797 18:53673662-53673684 AGAGAATAGACCAAGGAGGATGG + Intergenic
1158333094 18:56384384-56384406 TGAAAGAAGACCAACAAGGAAGG - Intergenic
1158669935 18:59465327-59465349 AGAGAGAAGAAGAAAGAGAAAGG - Intronic
1158998521 18:62948467-62948489 AGAGAGAAGACAACAGGGGAAGG - Intronic
1159025910 18:63182064-63182086 AGAGAAAGGAGGAAAGAGGAAGG - Intronic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1160035477 18:75297746-75297768 ACAGAGAAGATAGAAGAGGAAGG + Intergenic
1161289786 19:3487255-3487277 AGAGAGGAAACCAAGGAGGCAGG + Intergenic
1161320726 19:3639724-3639746 AGTGAAAAGAACAAAGAGGCTGG - Intronic
1161415799 19:4145666-4145688 AGGGAAAAGGCCAAGGAGGAGGG + Intergenic
1161560763 19:4971354-4971376 GGAGAGAAGGACACAGAGGACGG - Intronic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162082248 19:8225172-8225194 AGAGAAAACAGCAGAGAGGAGGG + Intronic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162874826 19:13613286-13613308 AGAGAGAACAAGAGAGAGGAGGG - Intronic
1163083136 19:14957930-14957952 AGAGAGAAGACCAATGTGGCTGG + Intronic
1163168590 19:15515014-15515036 AAAAAAAAGACCAAACAGGAAGG + Intronic
1163228384 19:15980535-15980557 ACAGAGAACACCAACCAGGAGGG + Intergenic
1163276081 19:16285185-16285207 AGAAAGAAGAAGAAAGAGAAGGG + Intergenic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1164455303 19:28401899-28401921 AGGGAGAAGACAAAAGAAAACGG - Intergenic
1164634122 19:29780246-29780268 AGAGAAAAGGCCAGAGAGGCTGG - Intergenic
1164736418 19:30544618-30544640 TGAGTAAAGACCAAAGAGGTAGG - Intronic
1165054744 19:33167732-33167754 GGAGAGAAGAGAAAAGAGGAGGG - Intronic
1165313751 19:35042568-35042590 AGAGAAAAGAGCACAGAGGGCGG - Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166175141 19:41062685-41062707 AGAGAGAAGAACAGAGAGACTGG - Intergenic
1166344338 19:42156039-42156061 AGAGAGAAGGCCTCAGAGAACGG - Intronic
1166974947 19:46600591-46600613 AGAGACAAGACCACGGAGGGCGG + Intronic
1167165548 19:47797527-47797549 AGACAGAAGAAAAAAGTGGAAGG + Intergenic
1168651877 19:58097245-58097267 AGAGAGAAGACAGGAGAGGAAGG + Intronic
925373123 2:3361983-3362005 AGGGAGCATGCCAAAGAGGAAGG - Intronic
925696247 2:6582916-6582938 AGAGAGAAGGGGAAAGAGAATGG + Intergenic
925907417 2:8547699-8547721 AGACAGAAGACAAAAAGGGAAGG - Intergenic
926069787 2:9877832-9877854 AGAGAGAGGAGAAAAGAGGGAGG - Intronic
926402936 2:12517745-12517767 AGAGGGAAGTCCAAAGAGCAAGG + Intergenic
926421196 2:12701582-12701604 ACAGAGAAGAGCAAAGAAGAAGG - Intergenic
926471656 2:13267273-13267295 AGAGAGAAGAGCAGAGCGAAGGG - Intergenic
926877974 2:17506449-17506471 AAAGAGAATAGCAAAGAAGAGGG + Intergenic
926883492 2:17574968-17574990 AGAGAAAAGAAAAGAGAGGAAGG - Intronic
926935031 2:18078399-18078421 AGAGATAAGATAATAGAGGAAGG - Intronic
927438447 2:23090575-23090597 GGAGAGGAGAGCAAAGGGGAGGG + Intergenic
927541057 2:23911580-23911602 AGAAAGAAGAGAACAGAGGAAGG + Intronic
927731820 2:25480262-25480284 AGAGGGCAGACCAGAGAAGAAGG - Intronic
927757613 2:25721912-25721934 AGAGAGGACACCAAAGAAGCAGG + Intergenic
927867310 2:26598457-26598479 AGAGAGAAGGTCAAAGAAGATGG + Intronic
928202483 2:29257181-29257203 TGAGAGAAGAGGAAAGAGGCAGG - Intronic
928256750 2:29729340-29729362 AGAGAAAAGAAGAGAGAGGAAGG + Intronic
928427030 2:31187791-31187813 AGATAGAAGACCAAAATGAAAGG - Exonic
928538641 2:32263660-32263682 AGAGAAAAGGCCAAGGAGGGAGG + Intronic
929164215 2:38864809-38864831 AGAGAGAAGAGGAAAGAAAATGG - Intronic
929731898 2:44504002-44504024 AGAGAGAAAACGAAACGGGAAGG + Intronic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930021702 2:47005582-47005604 AGAGAGAGGAACATTGAGGAAGG + Intronic
930270572 2:49251571-49251593 AGAGAGAAGGGAAAAGAGAAGGG - Intergenic
930288652 2:49466516-49466538 ACAGAGAAGACAAAACAGAAAGG - Intergenic
930352682 2:50277525-50277547 AGAGAGAAGAAGAGAAAGGAAGG - Intronic
930678306 2:54228703-54228725 AGAGAAAAGAAAAAAAAGGAAGG + Intronic
931122780 2:59238873-59238895 AGAGAGAAGGCTGAAAAGGAAGG - Intergenic
931206363 2:60149396-60149418 ACAAAGGAGACCACAGAGGATGG - Intergenic
931503336 2:62895789-62895811 AGAGAGAAGACTACAGAATAGGG + Intronic
931835881 2:66097937-66097959 GAAGAGAAGCCCACAGAGGAGGG + Intergenic
931839555 2:66134041-66134063 AGCAAGAAGACGAAAGAAGAAGG + Intergenic
931987415 2:67755256-67755278 AGAGAGAGGACTGCAGAGGAGGG + Intergenic
932011433 2:67981613-67981635 ACAGAGAAGAACAAAGAGACTGG - Intergenic
932772170 2:74506622-74506644 AGGCAGAAGGCCAAAGATGAGGG - Intronic
932992720 2:76808020-76808042 AGAAAGAAAAGAAAAGAGGAAGG - Intronic
933186879 2:79288577-79288599 AGAGAGAAAAACAAAGAGAGAGG - Intronic
933338319 2:80988227-80988249 ACAGAGGAGACAAAAGAGAAAGG + Intergenic
933338320 2:80988243-80988265 AGAAAGGAGACAAAAGAGAAAGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933739810 2:85524630-85524652 AGAGACAAGAGCAGAGAGCAGGG + Intergenic
934111732 2:88749765-88749787 AGAAAGAAGGCCAAAGTGGGAGG + Intronic
934600919 2:95657721-95657743 AGAGAGAAGACAGAAGATGGAGG - Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
935210403 2:100934997-100935019 AGAGAGAAGAGGGAAGAAGACGG - Intronic
935293587 2:101629492-101629514 AGAGAGGGAAACAAAGAGGAGGG - Intergenic
935485841 2:103652406-103652428 AGAGAAATGAGTAAAGAGGAAGG - Intergenic
935692056 2:105740841-105740863 AGAGGAAAGACCCAAAAGGAAGG - Intergenic
935797312 2:106657295-106657317 AGAGAGAAAACAAAGGAGTAGGG - Intergenic
936439132 2:112534958-112534980 AGAGAGAGGAAGAAAGAGAAAGG + Exonic
936475808 2:112838680-112838702 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
936582520 2:113715503-113715525 AGAGTGAAGACTAGGGAGGATGG - Intronic
936664149 2:114575184-114575206 GGAGAGAAAACCGAAGAAGAAGG + Intronic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937052829 2:118906277-118906299 AGAAAGAAGACCAATGTAGAAGG + Intergenic
937248937 2:120511342-120511364 AGAGAGAAAAGGGAAGAGGAGGG - Intergenic
937477363 2:122227448-122227470 AGAAAGAAGACCCAGGAGGGAGG + Intergenic
937677621 2:124609194-124609216 ATAGAGATAAGCAAAGAGGAGGG + Intronic
937776212 2:125779024-125779046 ACAGAGAAGACCTATGAGGTAGG + Intergenic
938264637 2:129918503-129918525 AGAAAAAAGAGAAAAGAGGAAGG + Intergenic
938510930 2:131942736-131942758 TGAAAGAAGAACAAAGATGAAGG + Intergenic
938910624 2:135882350-135882372 AGAGAGCAGAACTAATAGGAGGG - Intergenic
939095921 2:137833253-137833275 AGAGAGAAGGATAGAGAGGAAGG - Intergenic
939171272 2:138699310-138699332 GGAGAAAAGAGCAAAGAGGAAGG + Intronic
939845022 2:147232401-147232423 AGAAACAATATCAAAGAGGATGG + Intergenic
940046531 2:149416119-149416141 AGAGAGAACTCAGAAGAGGAAGG + Intronic
941332779 2:164199876-164199898 AGAAAGAAGAACAAAGCTGAAGG + Intergenic
941343719 2:164340342-164340364 GGAGAGAAGGACAGAGAGGAAGG - Intergenic
941652833 2:168112023-168112045 AGAGCGAGGACCAATTAGGATGG + Intronic
941918741 2:170828880-170828902 AGAGTGAGGACCACAGAGGGAGG - Intronic
941999711 2:171633784-171633806 AGAGAGAGGAAGGAAGAGGAGGG - Intergenic
942053293 2:172161094-172161116 AGAAAGAAGAACAAAGCTGAAGG - Intergenic
942198876 2:173551078-173551100 AGAAAGAAGAGCAAAGTGAAAGG + Intergenic
942421534 2:175813301-175813323 AGAGATAAGACCACAGAGACTGG - Intergenic
942421616 2:175813911-175813933 AGAGATAAGACCACAGAGACTGG - Intergenic
942491053 2:176490274-176490296 AGAGGGAGGGCCAAAGAGGACGG - Intergenic
942494662 2:176527120-176527142 AGAGAAAAGAGGAAAAAGGAGGG - Intergenic
942514941 2:176742099-176742121 AGTGAGAAGACCCCAGTGGAAGG + Intergenic
942654932 2:178205265-178205287 AGAGAGGAAGCCAAAGATGAAGG + Intronic
942845216 2:180416210-180416232 AGAGATACCACTAAAGAGGAAGG - Intergenic
942901926 2:181130392-181130414 AGAAAGAATACAAAAGAGAATGG - Intergenic
942903483 2:181152321-181152343 GGAGACAAGACAAAAAAGGATGG - Intergenic
942989273 2:182179674-182179696 AGAGGGAGGACGAGAGAGGAGGG - Intronic
943178962 2:184517715-184517737 AGAAAGAAGAACAAAGCTGAAGG - Intergenic
943785243 2:191870339-191870361 AGAGAGAAGAGAAAAGAGTTAGG + Intergenic
944079426 2:195770399-195770421 AGAGAGAAGACGCCAGAGGCTGG - Intronic
944256208 2:197625751-197625773 AGAGAGGAGAGAAAAGAGAAGGG - Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944589558 2:201204170-201204192 GGAGAGAAGAAGCAAGAGGAGGG + Intronic
945228583 2:207559090-207559112 AGAGAGAAAACAACAGAGGCAGG - Intronic
945406991 2:209460615-209460637 AGAGAAAAAAATAAAGAGGAAGG - Intronic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945570835 2:211465495-211465517 AGAGAGAAGATAATAGGGGAAGG + Intronic
945865411 2:215169124-215169146 ACAGAGAGCCCCAAAGAGGAGGG + Intergenic
945981849 2:216318595-216318617 AGAGGGAAGACCAGACAGGGAGG + Intronic
946490317 2:220143230-220143252 AGTGAGAAGGCAAAAGATGATGG - Intergenic
947139728 2:227009745-227009767 AGAGAGAAGAGAAGAGGGGAGGG + Intronic
947182919 2:227428068-227428090 AAAGAGAAGAGAAAAGAAGAAGG - Intergenic
947264653 2:228265237-228265259 AGAGAGATGACTGAAGAGAATGG - Intergenic
947534653 2:230933217-230933239 AGAGTGAAGAGCAGAGAGGCAGG - Intronic
948430588 2:237916037-237916059 AGAGAGAAGGCCACAGAGATTGG + Intergenic
948622099 2:239242202-239242224 AGAGAGAGGACGAGAGAGGAAGG + Intronic
949062172 2:241967528-241967550 AGAAAGAGGACCAACGACGATGG + Intergenic
949069568 2:242015978-242016000 AGAGAGAGGACTTAAGGGGAAGG - Intergenic
1168771053 20:417227-417249 GGAGAGAAGACAGAAGAGGTTGG + Intronic
1168811261 20:706251-706273 AGAGAGAAGGCCAAGGTGGCTGG + Intergenic
1168840453 20:906775-906797 AGAGAGGAAAACAATGAGGAAGG - Intronic
1169001627 20:2171994-2172016 AGAGAGAAGAGAAAGAAGGAAGG + Intronic
1169044975 20:2527977-2527999 AGAGAGAATACAGAAGAGGCTGG + Intergenic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169276229 20:4235405-4235427 AGAGAGAAGGGAGAAGAGGAGGG - Intronic
1169321135 20:4634279-4634301 AGAGAGATGACAGCAGAGGAGGG - Intergenic
1169525989 20:6426259-6426281 AGAGAGAAGAAGAAAGAGAAGGG - Intergenic
1169586041 20:7086313-7086335 AGAAAGAAGAAAAAACAGGAAGG - Intergenic
1169729797 20:8774291-8774313 AGAAAGAAAAGCAAAGAGGCTGG - Intronic
1169732433 20:8801125-8801147 AGAGAGTATATCAAGGAGGAAGG - Intronic
1169905550 20:10599723-10599745 AGAGAGTTGAACAAAGTGGAAGG - Intronic
1170032272 20:11955891-11955913 AGTGGGAAGAGAAAAGAGGATGG + Intergenic
1170378885 20:15734246-15734268 AGAGAGAAGAACAGGGTGGAAGG + Intronic
1170399864 20:15970239-15970261 AGATAGAAGGCCAAAGATAAAGG + Intronic
1170857653 20:20071809-20071831 GGAGAGAACACAAAAGATGAGGG - Intronic
1171422419 20:25026087-25026109 AGAGGGAAGACAAATGAAGAGGG + Intronic
1172197116 20:33099561-33099583 AGAGAGGAGGCCAGAGAGCAAGG - Intronic
1172210958 20:33198225-33198247 ACAGAGGAGAACAAAGAGGCCGG - Intergenic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1172737309 20:37136864-37136886 AGAGAGAGGATCAAACAGGATGG - Intronic
1172872265 20:38143142-38143164 AGAGAGGAGAGGAAAGAGGGAGG + Intronic
1173028990 20:39336969-39336991 GGAGAGTAGACAAAAGAGGATGG - Intergenic
1173063256 20:39682038-39682060 AGAGGGAGGAATAAAGAGGAAGG - Intergenic
1173114716 20:40230289-40230311 AGAAAGGAGAGCAAAGAGAAAGG + Intergenic
1173114763 20:40230785-40230807 AGAGAGAGAAGCAAAGAGGGAGG + Intergenic
1173354150 20:42271164-42271186 AGAGACAAGACCAGAGGGGTGGG - Intronic
1173835288 20:46121230-46121252 AGACTGAGCACCAAAGAGGAGGG - Intronic
1173906407 20:46632838-46632860 AGAGAGAAAAGGAGAGAGGAAGG - Intronic
1173924273 20:46769134-46769156 AGAGGAAAGCCCAGAGAGGAGGG - Intergenic
1174111882 20:48202845-48202867 GGAGAGAAGGCCCAGGAGGAGGG + Intergenic
1174124916 20:48297272-48297294 AGAAGGAAAACCAAAAAGGAAGG - Intergenic
1174143212 20:48431683-48431705 AGAGTGAAGACCCGAGAAGAAGG + Intergenic
1174283994 20:49459463-49459485 AGGAAGAAGAGCAAAGAGAAAGG + Intronic
1174437853 20:50523981-50524003 AAGGTTAAGACCAAAGAGGAAGG - Intronic
1174553371 20:51377389-51377411 AGAGGGAAGGCCCATGAGGAAGG + Intergenic
1174607364 20:51770489-51770511 CAAGAGAAGACCAAGGAGGCCGG + Intergenic
1174833849 20:53837898-53837920 AGAAAGAAAACCAAAAAAGACGG - Intergenic
1175116860 20:56688985-56689007 TCAGAGAAGGCCAGAGAGGATGG + Intergenic
1175473450 20:59250926-59250948 AGAGAGAAGACAAAACAGAAGGG + Intronic
1175791719 20:61744237-61744259 GGAGAGAATAACAGAGAGGAAGG + Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176781895 21:13205942-13205964 TGAAAGAAGAACAAAGATGAAGG + Intergenic
1176871698 21:14087745-14087767 AAACAGAAGAGCAAAGATGAGGG - Intergenic
1176891653 21:14326797-14326819 CGAGAGAAGAGAGAAGAGGAGGG + Intergenic
1176984096 21:15416169-15416191 AGAGAGAAAAACAAAAAGGGAGG + Intergenic
1177516966 21:22165695-22165717 AAAAAAAAAACCAAAGAGGAGGG - Intergenic
1177532009 21:22372804-22372826 AGAAAGAAGAACAAAGCTGAAGG - Intergenic
1177532077 21:22373605-22373627 AGAAAGAAGAACAAAGCTGAAGG + Intergenic
1177756598 21:25356147-25356169 CAAGAGAAGACAGAAGAGGAGGG + Intergenic
1177980541 21:27909370-27909392 TGAAAGAAGAACAAAGATGAAGG - Intergenic
1178151007 21:29793544-29793566 AGAGAGAGGAATAAACAGGAAGG - Intronic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1179156384 21:38854644-38854666 AAAGAGAACACCAAGCAGGATGG + Intergenic
1179255095 21:39709058-39709080 AGACTGAAAACCAAAGAGTAGGG - Intergenic
1179358304 21:40682626-40682648 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
1179714117 21:43279050-43279072 AGAGAGAGCACCAAGGTGGAGGG - Intergenic
1179815210 21:43901337-43901359 AAAGAGAAGAGAAAAGAGAAGGG + Intronic
1181963790 22:26642539-26642561 AGAGAGAAGAGAAAAATGGAGGG + Intergenic
1182062372 22:27407425-27407447 AGAGAGAGAAGCAAAGAGGAAGG + Intergenic
1182296652 22:29314193-29314215 AGAGGGGAGACCAAGGATGAAGG - Intronic
1182890523 22:33814765-33814787 AGAGAAATGACCCAATAGGATGG - Intronic
1183000007 22:34849005-34849027 AGAAAGAAAAAAAAAGAGGAAGG + Intergenic
1183020905 22:35024942-35024964 AAAGAGAAGACAAAGCAGGAAGG + Intergenic
1184349054 22:43931452-43931474 GGAGTGAAGACCAAGGAGGAAGG - Intronic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
1184788241 22:46682264-46682286 AGAGAGTTGAGCAGAGAGGATGG - Intergenic
1184930675 22:47678932-47678954 AGAGAGACGAGCTAAGAGGTTGG - Intergenic
1185144322 22:49122123-49122145 AGAAAGAAAACCTAAGAGAATGG + Intergenic
1185160307 22:49222714-49222736 AAAGAGAAGAACAAAGTTGAAGG + Intergenic
949108639 3:231292-231314 AGAGAGGAGAGGAAGGAGGAAGG - Intronic
949967990 3:9375429-9375451 AGAGAGAAGGGCAAAGGAGAAGG - Intronic
950712601 3:14823425-14823447 AGAGAGAAGAACCATGAGTAGGG - Intronic
950764592 3:15264018-15264040 AAAAAGAAGGCCACAGAGGAAGG + Intronic
950897630 3:16467841-16467863 AGGGAGCAGACCCCAGAGGAAGG + Intronic
951129248 3:19022423-19022445 AGAAAGAAGGTCAAACAGGAAGG - Intergenic
951473410 3:23079916-23079938 GGAGAGAAGACCAGAGAGTGTGG + Intergenic
951518976 3:23593616-23593638 AGATGGGAGACCAAACAGGAGGG + Intergenic
951640668 3:24830741-24830763 TGAGAGAAGAGGAAAGAGGTAGG + Intergenic
951992792 3:28694478-28694500 AGAAAGAAGGCCAGAGAAGATGG + Intergenic
952033890 3:29176759-29176781 AGAAAGAAGAGCAAAGAGTCTGG - Intergenic
952068336 3:29600393-29600415 AGAGAGAAGGTCAAAGTGGCAGG - Intronic
952735388 3:36685649-36685671 AGAAAGAAGAACAAAGCTGAAGG + Intergenic
952786191 3:37157553-37157575 AGAGAGAGGGGAAAAGAGGAAGG + Intronic
953113340 3:39966110-39966132 AGAGAGAAGACAGAACAGGCTGG - Intronic
953380125 3:42464065-42464087 AGAGAGAGGACCAAGGAGAATGG - Intergenic
953442066 3:42926903-42926925 AGAGGGAATAGCAAATAGGAAGG + Intronic
953721073 3:45355606-45355628 AGAGGGAAGCCCAAAGCTGATGG - Intergenic
954672651 3:52299030-52299052 AGAGAGAAGAGGAGAGGGGAGGG + Intergenic
954705489 3:52478410-52478432 AGAGAAGGGACCAAAGGGGATGG + Intronic
955176308 3:56617445-56617467 AGAGAGAAGAAAAAAAAGTAAGG + Exonic
955666587 3:61355742-61355764 AGAGATTGGACCAAAGAGGGAGG + Intergenic
955821890 3:62905315-62905337 AGAGGAAAGACCACAGAGGGAGG - Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
955907252 3:63820167-63820189 AGAGAGAAGCCCAAAGAAATTGG - Intronic
955963639 3:64365868-64365890 AGACAGAAGGCCAAGGAGGGTGG + Intronic
955990723 3:64624277-64624299 AGAAAGAAAAGGAAAGAGGAAGG + Intronic
956874377 3:73447505-73447527 AGAGGGCAAACCAAAGAGAATGG - Intronic
957181670 3:76886779-76886801 AGAGATGAGACTAGAGAGGAAGG + Intronic
957271365 3:78034392-78034414 AGAGAGAAGAACAGAGAGCTGGG - Intergenic
957544938 3:81624981-81625003 ACAGGGAAGACAAAAGAGTAGGG + Intronic
958001745 3:87759453-87759475 AAAGAGAAGAACAAAGTGGGAGG + Intergenic
958038734 3:88200738-88200760 AGAGAGAACACAAGAGAGAAAGG + Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959418858 3:106109672-106109694 AGAGAGAAAGAAAAAGAGGAAGG - Intergenic
959598680 3:108154929-108154951 AAAAAGAAGAACAAAGTGGAGGG - Intergenic
959886313 3:111505263-111505285 AGAATGAAAACCAAAGAGAAAGG + Intronic
959943473 3:112103845-112103867 AGAGATAAGGCTAAAAAGGAAGG + Intronic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960590077 3:119357183-119357205 AGAGATAAGAACACGGAGGAAGG + Intronic
960684408 3:120282713-120282735 AGAGGGAAGAGCAAGGACGATGG + Intronic
961579875 3:127872006-127872028 AGAAAGAAGACCAAGTAGAAAGG + Intergenic
962135925 3:132731912-132731934 AGAGAGAAGATGAAAGAACAGGG - Intergenic
962385986 3:134933173-134933195 AGAGAGAGGAGAAAAAAGGATGG - Intronic
962454368 3:135551645-135551667 AGAGAGTAGAGCAAGGAGAAAGG - Intergenic
962478766 3:135780464-135780486 AGAGAGAAGAACAAGGAGAGGGG - Intergenic
962830724 3:139136835-139136857 AGAGAGATGAACAGAGAGTAGGG + Intronic
963051075 3:141144489-141144511 AGAAAGAAGAGCCAAGAGAATGG + Intronic
963179204 3:142336418-142336440 AAAGAGAAGAGGAAAAAGGAAGG + Intronic
963258913 3:143174808-143174830 AGAGAGAGGAGCAAAGGTGAGGG + Intergenic
963371582 3:144407794-144407816 TGAGAGAAGAACAAAGAAAATGG - Intergenic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
963924243 3:150934765-150934787 AGAGAGAGAACCAAAAAAGAGGG - Intronic
963987347 3:151612053-151612075 AAGGGGAAGACCAAAGAGAAAGG - Intergenic
964023375 3:152041892-152041914 AGAGAGATGACCGAATAGAATGG + Intergenic
964698482 3:159536697-159536719 GGAAAGAAGACAAAATAGGAAGG + Intronic
964769194 3:160206739-160206761 AGAGAGAAAACAACAAAGGATGG + Intergenic
965565422 3:170111379-170111401 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
965594869 3:170400591-170400613 AGAGAGAAAAGAAAAAAGGAAGG - Intergenic
965813358 3:172613989-172614011 AGAGAGGAGACCCTAGAGTAGGG + Intergenic
967473408 3:189889210-189889232 AGAGCGAAGATTAAAAAGGAAGG + Intronic
967476860 3:189931989-189932011 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
967525924 3:190492737-190492759 AGAAAGAATAGCAAAGAGAAAGG + Intergenic
967861998 3:194159453-194159475 AGGGAGGAGACAAAAGAGGTAGG - Intergenic
968106486 3:196005447-196005469 AGAGAGGAGACCATAGGCGAGGG - Intergenic
968107129 3:196009232-196009254 AGAGAGAGGACTTAAGGGGAAGG + Intergenic
968344598 3:197991049-197991071 AGAAAGAATACGAGAGAGGAGGG + Intronic
969327703 4:6453333-6453355 AGACAGATCCCCAAAGAGGAAGG + Intronic
969551257 4:7869175-7869197 AAAGAGAAAAGAAAAGAGGAAGG + Intronic
970419751 4:15894549-15894571 AGAGAGAACAGCACAAAGGAAGG - Intergenic
970698969 4:18711926-18711948 AGAGAGAAATCAAGAGAGGATGG - Intergenic
971048112 4:22828958-22828980 AGAGAGAAGTGCAAAGAGAAGGG - Intergenic
971124567 4:23739283-23739305 ACAGAGAAGAATAAAAAGGAAGG + Intergenic
971172799 4:24250608-24250630 AGAGAAAAGAAGGAAGAGGAAGG + Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971694502 4:29881952-29881974 AGAAAGTATACCTAAGAGGAGGG - Intergenic
971697602 4:29926604-29926626 ACAGAAAAACCCAAAGAGGAAGG - Intergenic
972366267 4:38378021-38378043 AGAGAAAAAGCCAAAAAGGAGGG + Intergenic
972466571 4:39362847-39362869 AGAGAGAAAATCAGAGAGGTAGG + Intronic
972515470 4:39807078-39807100 AGAGAGAAAAAGAAAAAGGAAGG + Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974813391 4:66974761-66974783 AGAGACAAGACCAACTCGGATGG - Intergenic
975454294 4:74572058-74572080 AGAGAGATGACAAAAGAAGAAGG + Intergenic
975516734 4:75256223-75256245 TGATAGAAGACCAAAAAGGCGGG - Intergenic
975561466 4:75711771-75711793 AGAGATGGTACCAAAGAGGATGG + Intronic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
975668390 4:76755496-76755518 GGAAATAAGACAAAAGAGGAGGG + Intronic
976031010 4:80753684-80753706 AAACTGAAGAGCAAAGAGGAGGG - Intronic
976105545 4:81613312-81613334 AGAGCCAAGACCAATGAGAAGGG - Intronic
976491618 4:85677183-85677205 AGAGAGAAGAGCAAAGCAAAAGG - Intronic
977429368 4:96912210-96912232 AGAAAGAAAAAGAAAGAGGATGG + Intergenic
977745745 4:100545005-100545027 ATTGAGAAGACCAAAGATAAAGG + Intronic
978444256 4:108765428-108765450 AGAGTGAAGAGAAAAGAAGAGGG - Intergenic
979239007 4:118431994-118432016 AGAAAAGAGTCCAAAGAGGAAGG - Intergenic
979402129 4:120261691-120261713 AGAGATAAGACTAAAGGGCATGG + Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
980715816 4:136627224-136627246 ATAGACAAGACCAAATATGAAGG - Intergenic
981363413 4:143873481-143873503 AGAGAGAAGAGCCATGAGAAGGG + Intronic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981374151 4:143994282-143994304 AGAGAGAAGAGCCATGAGAAGGG + Intergenic
982009645 4:151094345-151094367 AGAGGGAGAAGCAAAGAGGAGGG - Intergenic
982142008 4:152332595-152332617 AGAGAGAAATGCAAAGAAGAGGG - Exonic
983351246 4:166592904-166592926 AGAGAGGAAAAGAAAGAGGAGGG - Intergenic
984153183 4:176160247-176160269 AGAAAGAAGGCCAGGGAGGAGGG - Intronic
984229320 4:177075245-177075267 AGAGAGAGGAGCTAAGAGCAGGG + Intergenic
984950501 4:185004398-185004420 AGAGAGCAGACAAAGGAGGGAGG - Intergenic
985368245 4:189256896-189256918 AGAGAAAACATCAAGGAGGAAGG + Intergenic
985721261 5:1490440-1490462 GGAGAGAAGGCCAATGATGAAGG + Intronic
985890660 5:2713039-2713061 AAAAAGATGAGCAAAGAGGAAGG - Intergenic
986035336 5:3931850-3931872 AGAGAGAAATCCACAGAGGCTGG - Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
986563524 5:9087003-9087025 AGAGAGAAGTCCACAGAAGTGGG - Intronic
986619377 5:9655838-9655860 AAAGAGAAAACCACAGAGGCAGG - Intronic
986843143 5:11721541-11721563 AGATAGAGGACCAAAGCAGATGG - Intronic
986989579 5:13535901-13535923 AGATTGCAGACCAAGGAGGAAGG + Intergenic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
987057978 5:14213222-14213244 AGAGTGAAAAGAAAAGAGGAGGG - Intronic
988066523 5:26232882-26232904 AGAGAGAGGACCTAAAGGGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
989085135 5:37668111-37668133 AGAGAGAAAGCCCAAGAGCAAGG - Intronic
989209113 5:38842693-38842715 AGATGGAAGATGAAAGAGGATGG + Intergenic
989507642 5:42245987-42246009 AAAGAGAAGAGCAAATAAGAAGG - Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990577265 5:57135464-57135486 AGAGAGAAGACAAACTGGGAGGG - Intergenic
990759717 5:59114973-59114995 AGATACAGGATCAAAGAGGAAGG + Intronic
990794387 5:59523876-59523898 AGAGAGAAGTGCAGAGTGGAGGG - Intronic
990935442 5:61142876-61142898 AGAAAGAAGAAAAAAGAGGGAGG - Intronic
991278356 5:64879503-64879525 AGAAAGAATATCAAAGAGGTAGG + Intronic
992065917 5:73108015-73108037 AAAAAGAAGACCAAAGCTGAAGG - Intergenic
992132977 5:73713264-73713286 AGAGAGAAGACCTAGGAGAATGG - Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992417613 5:76566821-76566843 TGGGAGATGACCAAGGAGGAGGG + Intronic
992502699 5:77357790-77357812 AGAGAGAAGGCAAAAGAGGGAGG - Intronic
992763674 5:79974505-79974527 AGAAAAAAGACCAAAAAGAAAGG - Intergenic
992908539 5:81372456-81372478 AAACAGAAGAGCAAAGAGAAAGG - Intronic
992917071 5:81467080-81467102 AAAAACAAAACCAAAGAGGAGGG + Intronic
992938453 5:81737323-81737345 AGAGAGAAGACTTAACTGGAAGG - Intronic
993090968 5:83426128-83426150 AGACAGAATACCATATAGGACGG - Intergenic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
993397991 5:87414139-87414161 AAAGAGAAGATCAAAGGGCATGG + Intergenic
993704706 5:91156368-91156390 AGAAAGAAAAACAAAGAGGAAGG + Intronic
993712701 5:91242940-91242962 AGAAAGAAGAGCAATGAGAAAGG - Intergenic
993759530 5:91775514-91775536 AGAGAGAAAAACAAAGGGGAAGG - Intergenic
993900760 5:93582958-93582980 AGAAAGAAAGCAAAAGAGGAGGG + Intergenic
994151944 5:96457591-96457613 AGAGAGAAGAGCAAGGGCGAAGG - Intergenic
994279451 5:97884366-97884388 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
994403569 5:99315011-99315033 AGAGAGAAGAACACAGGGAAGGG + Intergenic
995093294 5:108206523-108206545 GGAGAGAGGAACAAAAAGGAAGG - Intronic
995244570 5:109921574-109921596 GGAGCCAAGACCAAAGGGGAAGG + Intergenic
995470472 5:112496508-112496530 AGAAAGAATACCAGAGAGGAAGG + Intergenic
996391851 5:122970858-122970880 ACAGAGATGAGAAAAGAGGAGGG - Intronic
996437050 5:123445978-123446000 AGAGAAAAGAAAAAAGGGGAGGG + Intergenic
996582409 5:125046451-125046473 AGAGAGAAAACCAGACAGTATGG - Intergenic
997549436 5:134738894-134738916 AGAGAGGAAATCAAAGAGCAAGG - Intronic
997737144 5:136221744-136221766 AGAGATCAAAGCAAAGAGGATGG - Intronic
997902602 5:137781055-137781077 AGAGAGAAGACCAAGGGCCAGGG - Intergenic
997933438 5:138090499-138090521 AGAGAGAACACAAAAGAGAATGG - Intronic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
998238488 5:140421139-140421161 AGAGGTAAGACCGAAGAGGAAGG + Intronic
998495823 5:142588470-142588492 AGAGAGAAGAGAGAAGAGGGAGG - Intergenic
998514470 5:142740128-142740150 AGATAAAAGAAGAAAGAGGAAGG - Intergenic
998894744 5:146787557-146787579 AAAGAGAAGACAAGAGAGAAGGG - Intronic
998910636 5:146956334-146956356 AGATAGGAGAACAAAGAGCATGG - Intronic
999308077 5:150533517-150533539 TGAGAGAGCCCCAAAGAGGAAGG - Intronic
999689115 5:154130297-154130319 AAAAGGAAGAACAAAGAGGAAGG + Intronic
999707121 5:154283675-154283697 AGGAAGGAGTCCAAAGAGGAGGG + Intronic
999837476 5:155390087-155390109 AGAAAGAAAAGCAAAGAGAAGGG + Intergenic
1000150700 5:158497862-158497884 TGTGAAAAGACCAAAGATGAGGG - Intergenic
1000239575 5:159397066-159397088 AGAGAGAAAAGAAAAGAGAAGGG - Intergenic
1000462315 5:161537923-161537945 AGAAAGAATAACATAGAGGAGGG - Intronic
1000901598 5:166918143-166918165 AGAAAGAAGAGCAAAGTGCAAGG + Intergenic
1000992904 5:167929003-167929025 AGAGAGAAAAAGAAAGAGAAAGG + Intronic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1001135421 5:169098807-169098829 AGAGAAAAGTACAAAGAGGTTGG - Intronic
1001164244 5:169349130-169349152 AGAAAGAAGGCCAAAGTGGCTGG - Intergenic
1001511093 5:172322455-172322477 AGAAAGAAGAAGGAAGAGGAGGG - Intergenic
1001702939 5:173720773-173720795 AGAGAGCAGAACAGAGGGGAGGG + Intergenic
1001776150 5:174330599-174330621 AGAAATAAGAAGAAAGAGGACGG + Intergenic
1001853623 5:174991453-174991475 TGAAAGAAGACCAGAGAGGCTGG - Intergenic
1001898701 5:175404255-175404277 AGAGAGGAAACAAAAGAGAATGG - Intergenic
1002108752 5:176893880-176893902 AGACAGAAGAGCAAGGAGAAAGG + Intronic
1002441696 5:179267600-179267622 GGAGAGCAGCCCACAGAGGAGGG + Intronic
1002739256 5:181422592-181422614 AGAAAAGAGTCCAAAGAGGAAGG - Intergenic
1003160416 6:3629690-3629712 AGAGAGAAGCACAAAGGAGAGGG - Intergenic
1003270912 6:4607113-4607135 AGACAGCAGAGCAATGAGGATGG - Intergenic
1003333901 6:5152756-5152778 ACAGAGGAGGCCCAAGAGGAAGG - Intronic
1003376652 6:5584520-5584542 GGAGAGAAAAAGAAAGAGGAAGG - Intronic
1003737770 6:8896814-8896836 AGAGAGAGGAAAAAAGAGGAAGG - Intergenic
1003959257 6:11193811-11193833 AGAAAGAAGACATAACAGGAAGG + Intronic
1004051779 6:12088756-12088778 AGACAGAAGACAGAAAAGGATGG - Intronic
1004149123 6:13098329-13098351 AGAGAGAAGGAAAAACAGGAAGG - Intronic
1004489187 6:16098017-16098039 CGAGAGAAGGCCCTAGAGGATGG - Intergenic
1004639030 6:17496105-17496127 AGTGAGACAACCAGAGAGGAAGG + Intronic
1004703218 6:18098546-18098568 AGAAAGAACACCAAAGAAGAGGG + Intergenic
1004721567 6:18272303-18272325 AGAGAGAAGAGTGAAGATGAAGG + Intergenic
1004816733 6:19319221-19319243 AGAAAGAAGAAAAGAGAGGAAGG - Intergenic
1005111391 6:22285706-22285728 AGGGGGTAGAACAAAGAGGAAGG - Intergenic
1005278360 6:24243864-24243886 AGAGAGATGAACAAACATGAGGG + Intronic
1005394125 6:25363920-25363942 AGAGAGAAGAGAAGAGAGAAAGG - Intronic
1006059033 6:31405357-31405379 AGAGAGAAAACCAAGGTAGAGGG - Intronic
1006061342 6:31422165-31422187 AGAGAGAAGAGCAAAGTAAAAGG + Intergenic
1006071518 6:31500242-31500264 AGAGAGAAAACCAAGGTAGAGGG - Intronic
1006262053 6:32883143-32883165 AGAGAGAACAGGAAAGAAGATGG + Intergenic
1006572474 6:35017308-35017330 GGAGAGAAGAAGAGAGAGGAAGG - Intronic
1007303866 6:40889513-40889535 AGAGAGAAAATAAAAGAGCAAGG + Intergenic
1007364007 6:41377396-41377418 AGAAAGAAGAGAAAAGAAGAAGG + Intergenic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1007950050 6:45863817-45863839 AGAGAGAAGAGAAAAGAGAGAGG - Intergenic
1008189219 6:48433601-48433623 AGTGAGTAGCCCAAAGAGAAAGG + Intergenic
1008213244 6:48752193-48752215 TGACAGAAGGCCAAAGAGCAAGG - Intergenic
1008228674 6:48956013-48956035 ACAGAGAAGACCAAACAGGAAGG - Intergenic
1008302883 6:49863652-49863674 AGAGGAAAGATCAAAGATGAGGG + Intronic
1008477407 6:51947257-51947279 AGAAAGAAAAACAAAGAGGCTGG - Intronic
1008733585 6:54514171-54514193 AGAAAGAAAAGAAAAGAGGAAGG - Intergenic
1008790123 6:55221231-55221253 AGAAAGAAGAGCAAAGTAGAGGG + Intronic
1008800473 6:55362894-55362916 AGAGGGAAGAGAAAACAGGAAGG + Intronic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009548908 6:65060512-65060534 AGAGAGAAGACCAAGAAGGAAGG - Intronic
1009630768 6:66197553-66197575 ATAGAGTAGACCTATGAGGATGG - Intergenic
1009906617 6:69877030-69877052 ACACAGAATACCAAAGAAGATGG + Intronic
1010335256 6:74674039-74674061 AGAGAGGAGAAGAGAGAGGAAGG - Intergenic
1010800387 6:80168348-80168370 AGAGAGGAGAGGAGAGAGGAAGG + Intronic
1010943379 6:81946570-81946592 AGAGAGAGGAGGACAGAGGAAGG + Intergenic
1011324564 6:86135657-86135679 AGAAAGAAAAGAAAAGAGGAAGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012138956 6:95596711-95596733 ATAGAAAAGACCAAAAAGAAAGG - Intronic
1012849846 6:104433311-104433333 TGACAGAAGAACAAGGAGGAAGG + Intergenic
1013269662 6:108534225-108534247 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1013759008 6:113494510-113494532 AGAGTCAAGACAAAAGAGAAGGG - Intergenic
1014073285 6:117207554-117207576 AGACAGAAGAGCAGAGGGGAAGG - Intergenic
1014079744 6:117272278-117272300 AGAGAGAAGATAAAAGAGAGAGG - Intronic
1014215171 6:118746089-118746111 AGAAAAAAGACAAAAGAGAAAGG + Intergenic
1014281022 6:119442545-119442567 AGAGGAAAGAACAAAGAGAAAGG + Intergenic
1015021220 6:128478282-128478304 AGTGAGAAGGCAAAAAAGGAAGG - Intronic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1015599166 6:134895609-134895631 AGATTGAAGACAAAAGAGAAAGG - Intergenic
1015861754 6:137688558-137688580 AGAGGGAAAGTCAAAGAGGAAGG - Intergenic
1015961632 6:138656007-138656029 AGAAAGAAGAGGAAAGAGGGAGG - Intronic
1016087547 6:139933032-139933054 GGAGATAAGGCCACAGAGGAAGG - Intergenic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1016300110 6:142621074-142621096 AGACAGAAGAGCAAAGAAAAGGG - Intergenic
1016534514 6:145095446-145095468 AGAGAGAGGATCAGAGGGGAGGG + Intergenic
1016604535 6:145905224-145905246 AGAAAGAAGAGAAAAAAGGAAGG + Intronic
1016617474 6:146068529-146068551 AGAGAGAAGACCAAGGAATGTGG + Intronic
1016649148 6:146444141-146444163 AGAGGGAAGACAAAAGGGAAGGG + Intergenic
1016897335 6:149066339-149066361 AGAGAAAAGATGAAAGAGGGAGG + Intronic
1017046236 6:150349477-150349499 AGATCGAAGATCAAAGAGAATGG + Intergenic
1017138835 6:151171968-151171990 AGAGAGAAAAAGAGAGAGGAAGG - Intergenic
1017192478 6:151668903-151668925 AGAGAGAAGAGCAAGGAGAATGG + Intronic
1017226139 6:152022991-152023013 AGAGAGAAAAAGAAAAAGGATGG + Intronic
1017291631 6:152744678-152744700 AATGAAAGGACCAAAGAGGAGGG - Intergenic
1017551940 6:155518512-155518534 AGAGAGAAGAACCACAAGGAAGG + Intergenic
1017681184 6:156865615-156865637 AGAGAGAAGAGTAAAAATGAAGG - Intronic
1018040762 6:159919776-159919798 AGAGGGAAGACATAAGAAGATGG + Intergenic
1018219834 6:161566751-161566773 ACAGAGCAAAACAAAGAGGAAGG - Intronic
1018468966 6:164079879-164079901 AGACAGAAGACAGAAGAGGCTGG - Intergenic
1018644273 6:165932941-165932963 AGAGGCAGGACCAAAGAGGAGGG + Intronic
1018895229 6:168011935-168011957 ACAGACTAGACCAAATAGGAAGG - Intronic
1019092268 6:169548603-169548625 AAAGAGAAGAACAAAGTTGAAGG + Intronic
1019116225 6:169764714-169764736 AGGGAACACACCAAAGAGGAGGG - Intronic
1019244366 6:170698151-170698173 AGAAAAGAGTCCAAAGAGGAAGG - Intergenic
1019293678 7:262704-262726 AGAGAGTGGACGAACGAGGAGGG + Intergenic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019623608 7:2004173-2004195 AGAGAGCAGCCCAAACAGGGGGG + Intronic
1019770000 7:2877536-2877558 AGAGAGGAGACGAAAAAGGAAGG - Intergenic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020400442 7:7770557-7770579 AGAGAAAAGACCAGTTAGGAGGG + Intronic
1020429302 7:8103399-8103421 AAACAGAAGACAACAGAGGAAGG - Intergenic
1020454870 7:8360320-8360342 AGAGAGGAGATCAGAGTGGAAGG + Intergenic
1020945639 7:14601901-14601923 AGAAAGAAGACCATAGAGAGAGG - Intronic
1021315736 7:19145200-19145222 AGAGGGAAGACCCAGGAGGATGG - Exonic
1021362096 7:19728183-19728205 AGAGAGAGAAAGAAAGAGGAGGG - Intronic
1021885784 7:25137338-25137360 AGAATGAAAACCAAAGAGAAAGG - Intronic
1022094306 7:27129591-27129613 AAATAGAAGGCCAAGGAGGAGGG + Intronic
1022115967 7:27260801-27260823 AGAGAGAAGAGAAAAAAGAAAGG + Intergenic
1022355318 7:29609249-29609271 AGAGTGAAGAACAATAAGGACGG + Intergenic
1022532450 7:31075558-31075580 AGTGAGAAGAGCATGGAGGAAGG - Intronic
1022950897 7:35337009-35337031 AGAGAGGAGACAGAAAAGGACGG - Intergenic
1023032522 7:36103103-36103125 AGTGAGAAGACAAGAGAAGAAGG + Intergenic
1023248049 7:38227635-38227657 TGAGAGAAGACCAAAGTAGGGGG - Intronic
1023389668 7:39697377-39697399 AGCGAGAAGACAAGAAAGGAGGG - Intronic
1023615171 7:42012381-42012403 AGAGAGAAGAAGAAAAGGGAGGG - Intronic
1023641987 7:42268381-42268403 AAAGAGAAGGCCTTAGAGGAAGG - Intergenic
1023841489 7:44100994-44101016 AGAGGGAAGAACAAAAAGGAAGG + Intergenic
1024102889 7:46050889-46050911 AGGGAGAAGGGCAAACAGGAAGG + Intergenic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024481096 7:49864251-49864273 AGAAAGAAGACAAAGAAGGAGGG + Intronic
1024607100 7:51030910-51030932 CTAGGGAAGACCAAAGAGAAAGG + Intronic
1024728984 7:52233823-52233845 TGAGAGAAGGCAATAGAGGAAGG + Intergenic
1024852569 7:53737817-53737839 AGAAAGAAAAACAAAGGGGAAGG + Intergenic
1025247500 7:57328402-57328424 AGAGAGAAGAAAACAGAGGGAGG - Intergenic
1026192236 7:68140086-68140108 AGAGAGAAAGCAAAAGAGGGAGG + Intergenic
1026672366 7:72401375-72401397 AGAGAGAAAGCCAAAAAGCAGGG - Intronic
1026837580 7:73648645-73648667 AGAGAGAGAAAGAAAGAGGAGGG - Intergenic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027744913 7:82061253-82061275 AGAGGGAAGAACAAATTGGATGG - Intronic
1027995467 7:85420825-85420847 AGAGAGAGAACAAGAGAGGAAGG - Intergenic
1028744294 7:94309766-94309788 AGAGGGATGGCCAGAGAGGAAGG - Intergenic
1029204901 7:98863736-98863758 AGAGAGAAAAGAAAAGAGAAAGG - Intronic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1030022519 7:105289956-105289978 AGTAGGAAGGCCAAAGAGGAGGG + Intronic
1030636317 7:111953336-111953358 AATGAGAAGAGCTAAGAGGATGG + Intronic
1030702200 7:112653262-112653284 AGAGAGAAGAGCAAAGTTGGAGG + Intergenic
1030866894 7:114710943-114710965 AGAGGGAATTCCAAAGATGAAGG - Intergenic
1031151680 7:118061296-118061318 GGAGGGAAGAGCAAAGATGAGGG - Intergenic
1031469151 7:122148183-122148205 AGAGAGAAAACCAAAGTAGGTGG - Intergenic
1031588042 7:123556509-123556531 AAAGAGAAAGCCAAAGAGTAGGG + Intronic
1032285054 7:130533453-130533475 TGGGAGGAGACCAAAGTGGAAGG + Intronic
1032937716 7:136752603-136752625 AAAGAGAAGAACAAAGAGTCAGG + Intergenic
1033169573 7:139071716-139071738 AGAGAGAAGAGCAACAAGGAGGG + Intronic
1033277646 7:139984695-139984717 AGAAAGAAAAAGAAAGAGGAAGG + Intronic
1033547748 7:142417093-142417115 AAAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033550496 7:142442778-142442800 AGAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033653791 7:143360821-143360843 AGAGAGAAGACAGAAGATGGTGG + Intronic
1033735335 7:144215993-144216015 AGAAAGGAGAACAAAGAAGAGGG - Intergenic
1033747720 7:144334976-144334998 AGAAAGGAGAACAAAGAAGAGGG + Intergenic
1034532418 7:151704657-151704679 AGAGAGATGAGGAAAGGGGAGGG + Intronic
1034621662 7:152461849-152461871 AGAGAGAAGAGGGAAGGGGAGGG + Intergenic
1035081947 7:156223564-156223586 AGTGAGAATACGAAAGAAGATGG - Intergenic
1035503759 8:110021-110043 AGAAAAGAGTCCAAAGAGGAAGG + Intergenic
1035534810 8:382795-382817 AGAGACAAGAACAGAGAGGGAGG + Intergenic
1035746095 8:1962915-1962937 TGACAGAAAACCAAAGAGCATGG - Intergenic
1035974321 8:4290365-4290387 GGAGAGAAGCCCAAAGACGTAGG + Intronic
1036464988 8:8988510-8988532 AGAGAGAATCCCCAAGATGATGG - Intergenic
1037521730 8:19686446-19686468 AGCGAGCAGTGCAAAGAGGAAGG - Intronic
1037555753 8:20020549-20020571 ACAGAAAAGACCATAGAGAAAGG - Intergenic
1037806428 8:22060126-22060148 AGAGAGAGCACCACAGAGGAAGG - Intronic
1038634201 8:29272265-29272287 AGAAAGAAGACAAAAGAGTCGGG + Intergenic
1038820895 8:30951107-30951129 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1039197335 8:35047333-35047355 AGAGACAAGACCACAGAGGTAGG + Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1039439383 8:37584246-37584268 AGAGGGAAGACTGAAGAGGAAGG + Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039834404 8:41245344-41245366 AGAGAAAAGAAAAAAGAGAAAGG - Intergenic
1040592885 8:48811418-48811440 AAAGAGAAGAGAAAAGAAGAAGG + Intergenic
1040595486 8:48834259-48834281 GGAGAGAGGACCACAGAAGAGGG - Intergenic
1040678100 8:49775651-49775673 AGAGTGAAGAACCAAGAGAATGG + Intergenic
1041307732 8:56480145-56480167 AAAGAGAAGAACAATAAGGACGG - Intergenic
1041405949 8:57499455-57499477 AGAGAGATGAACAAAGTTGATGG + Intergenic
1041877231 8:62703660-62703682 AGAGAGAAAACCAAGCAAGAGGG - Intronic
1041909451 8:63072858-63072880 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1043116902 8:76268099-76268121 AGAGAGAAGCCTAAATATGAGGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043603951 8:81976677-81976699 AGAGAGAAGTGCAAAGTGAAGGG + Intergenic
1043643927 8:82493109-82493131 AGAGTGCAGACCACAGAGAAGGG - Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044364490 8:91326928-91326950 GGAGAGAAGAACAAACAGCAGGG - Intronic
1044516365 8:93143320-93143342 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1044643117 8:94406363-94406385 AGAAAGGAGAATAAAGAGGAGGG + Intronic
1044729750 8:95220357-95220379 AGAGAGAAGGGCAAGCAGGAAGG - Intergenic
1044787590 8:95810942-95810964 AGAGAGAAGAGAAAAGAGAGAGG + Intergenic
1045003773 8:97900264-97900286 AGTAAGAACATCAAAGAGGAAGG + Intronic
1045555793 8:103213452-103213474 AAAGAGAAGACCAGAGTGGTTGG + Intronic
1045910770 8:107407030-107407052 AGAATGAACACCAAAGAGGAAGG - Intronic
1045961465 8:107973799-107973821 AGAGTAAAGAGCAAACAGGAAGG - Intronic
1046151990 8:110239590-110239612 AGAGAGAAAACCACACAGAAAGG - Intergenic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046687623 8:117244817-117244839 TGTGTCAAGACCAAAGAGGATGG + Intergenic
1046823594 8:118662460-118662482 ATAGAGAACAGCAAAGCGGATGG + Intergenic
1046927972 8:119813599-119813621 CCAGAGAAGGACAAAGAGGATGG + Intronic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047250761 8:123180656-123180678 ACAGACCAGACCAGAGAGGAAGG + Intronic
1047363472 8:124190965-124190987 AGAGAGAAGAAGAAAAAAGAAGG + Intergenic
1047625998 8:126656761-126656783 AGAGAAAAGATCAAAGAGAGAGG + Intergenic
1047955693 8:129973605-129973627 TGAGAGGAGACGAAAGAGGAAGG - Intronic
1048579072 8:135716073-135716095 AGACTGAAGACCAAGCAGGATGG + Intergenic
1049056166 8:140239128-140239150 AGAGGGAAGAACAACGAAGACGG + Intronic
1049108690 8:140629535-140629557 AGTGAGAAGATGAAAAAGGAGGG + Intronic
1049825789 8:144666932-144666954 AGGGACAGGACCAAGGAGGAGGG - Intergenic
1050909705 9:11053592-11053614 AGTGACAACACCAAAGGGGATGG + Intergenic
1050984103 9:12060109-12060131 AGAGAGGAGAATAAAGAAGATGG - Intergenic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1052000624 9:23275157-23275179 AAAGAGAAGATCAAAGATCACGG + Intergenic
1052667224 9:31510618-31510640 AGAAAGAAGCCCAAATAAGAGGG - Intergenic
1052847858 9:33353168-33353190 AGAGAAAAAAAGAAAGAGGAAGG - Intronic
1053277672 9:36795471-36795493 AGAGAGAGGAGCAGAAAGGACGG - Intergenic
1053437327 9:38084777-38084799 AGAGAAAGGAAAAAAGAGGAAGG - Intergenic
1053601181 9:39611105-39611127 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053611223 9:39714932-39714954 AGAGAAAAGACAGAAGAGAAGGG - Intergenic
1053858830 9:42364903-42364925 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053869262 9:42472980-42473002 AGAGAAAAGACAGAAGAGAAGGG - Intergenic
1054087031 9:60756226-60756248 AGAGAAAAGACAGAAGAGAAGGG + Intergenic
1054242297 9:62627458-62627480 AGAGAAAAGACAGAAGAGAAGGG + Intergenic
1054252355 9:62731334-62731356 AAGGAGAAGACCAAAGAGCAGGG + Intergenic
1054556423 9:66661976-66661998 AGAGAAAAGACAGAAGAGAAGGG + Intergenic
1054566470 9:66765833-66765855 AAGGAGAAGACCAAGGAGCAGGG + Intergenic
1054738322 9:68779420-68779442 AGAAAAAAGGCCAGAGAGGATGG - Intronic
1054740266 9:68799445-68799467 AGAAAGAAGAGCAAAGTTGAAGG + Intronic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055903549 9:81267863-81267885 AGAGACAAGAACAAGGAGGTGGG - Intergenic
1055912473 9:81368217-81368239 GGAGAGAAGAGGAAAGGGGAGGG + Intergenic
1055945631 9:81689133-81689155 AGAAAGAAGACCGAGGAAGAAGG - Exonic
1055985159 9:82051349-82051371 AGAGAGAATGAAAAAGAGGAGGG - Intergenic
1056069847 9:82974789-82974811 AAAGAGAAGACAGGAGAGGAAGG - Intergenic
1056422501 9:86442979-86443001 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1056832335 9:89927393-89927415 ATTGAGAACACCAAACAGGAGGG - Intergenic
1057290372 9:93802506-93802528 AGACAGCAGACAGAAGAGGATGG + Intergenic
1057394482 9:94667535-94667557 ACAGAGAAACCAAAAGAGGACGG + Intergenic
1057502030 9:95603587-95603609 AGAGAGAAGAGCAGAGAGCGGGG - Intergenic
1057553829 9:96071984-96072006 AGAGAGAAGAACAAACATAAGGG - Intergenic
1057769264 9:97952764-97952786 AGAGAGATGTCTAAACAGGATGG + Intergenic
1058019509 9:100072438-100072460 AGAGAAAAGACCAACAAGCAGGG + Intronic
1058105866 9:100971186-100971208 GGAAAAAAGAACAAAGAGGAGGG + Intergenic
1058367134 9:104221445-104221467 ATAAAAAAGACAAAAGAGGATGG - Intergenic
1058646482 9:107135771-107135793 AAGGAGTAGACCAAAGAGCAAGG - Intergenic
1059352903 9:113678151-113678173 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059658961 9:116382476-116382498 ACAGTGAAGACCAAAAAGGTAGG + Exonic
1060045797 9:120339158-120339180 GGAGGGAAGAAAAAAGAGGAAGG + Intergenic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1060530364 9:124344139-124344161 AGAGAGAAGGGCACAGAAGAGGG - Intronic
1060561447 9:124548127-124548149 AGAAAGAAGAGCAAGGGGGAGGG + Intronic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1061132043 9:128713735-128713757 AGACTGACGACCAGAGAGGAGGG + Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061894498 9:133640119-133640141 AGAGAGAAAGCCAAGGAGGATGG + Intronic
1062314543 9:135960355-135960377 AGAGAGAAGTCCCAGGAGTAGGG - Intronic
1203604554 Un_KI270748v1:47377-47399 AGAAAAGAGTCCAAAGAGGAAGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1185619531 X:1444982-1445004 AGAGAGAAGAGGGAAGAAGACGG - Intronic
1185683974 X:1911695-1911717 AGAGAGAGGAAGAGAGAGGAGGG - Intergenic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1186019420 X:5237400-5237422 AAAGAGATGACCACAGAGGGAGG - Intergenic
1186289983 X:8086612-8086634 AGAGAGAAGTGCCAAGAGAAGGG + Intergenic
1186335502 X:8582637-8582659 TGAGAGAGGACTAAAAAGGAGGG + Intronic
1186363026 X:8862580-8862602 AGAGAGAAGAGGAGAGAAGAAGG + Intergenic
1186498625 X:10032540-10032562 AGAGAGAGGACCAAATCGCAGGG - Intronic
1186911048 X:14166092-14166114 AAAAAGAAGAGCAAAGAGGGAGG - Intergenic
1186989793 X:15055212-15055234 AGAGAGAAGTACCAAGAGAAGGG - Intergenic
1187319577 X:18227696-18227718 AGAGAGAAAAAGAGAGAGGAGGG + Intergenic
1187413468 X:19071320-19071342 AGAGAGAGGTTAAAAGAGGAGGG - Intronic
1187740466 X:22350000-22350022 AAAGATAATACCAAAGAGGATGG - Intergenic
1187800962 X:23062186-23062208 AGAAGGAAGACCAGAGAGGGAGG + Intergenic
1187942596 X:24396454-24396476 GGAGAGAAGATCAAAGCGAAAGG + Intergenic
1188211624 X:27432424-27432446 AGGGAGAAAACAGAAGAGGATGG + Intergenic
1188606689 X:32040323-32040345 AGAGAGAAGAAAAAATATGAAGG - Intronic
1188735570 X:33710407-33710429 AGAGAGAAGAGGAAAGAAGTAGG + Intergenic
1188801085 X:34530762-34530784 AGAGAGAAAAAAAGAGAGGAGGG + Intergenic
1189000304 X:36937146-36937168 AGAGAGAAAAGAAAAGAGGAAGG + Intergenic
1189000315 X:36937251-36937273 AGAAAGAAAAGAAAAGAGGAAGG + Intergenic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1189400879 X:40667527-40667549 AGAGAGGACACCAGAGAGGTTGG + Intronic
1189708195 X:43780757-43780779 GGAGACAAAACCAAAGAGCAAGG - Intronic
1189718439 X:43889164-43889186 AGAGAGAAGAACAAAGCTGGAGG - Intergenic
1189850345 X:45171070-45171092 AGAGAGAAGACCCAACAAGGAGG - Intronic
1189874399 X:45420759-45420781 GGAGAGGAGAGCAAAGAGTAAGG - Intergenic
1190079030 X:47340804-47340826 AGATAGAAGAACAAAGTAGAAGG - Intergenic
1191671331 X:63751315-63751337 AGAGAGAAGGCAGAGGAGGAAGG + Intronic
1191730094 X:64324385-64324407 AGAGAAGAGAAGAAAGAGGACGG + Intronic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191830100 X:65407163-65407185 AGAAAGAAGACCGAGGAAGAAGG + Intronic
1191996592 X:67102205-67102227 AGATATAAGACCAAAGAGAAAGG - Intergenic
1192052849 X:67742997-67743019 AGAGAGAAGAGGAAAGAGATAGG - Intergenic
1192201303 X:69068432-69068454 AGGCAGAAGGGCAAAGAGGAGGG + Intergenic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1193568338 X:83108356-83108378 GGAGAGAAGAGAAGAGAGGAGGG - Intergenic
1194005998 X:88492428-88492450 AGAAAGAAGACCATAGATGAGGG - Intergenic
1194065234 X:89253001-89253023 GGAGAGAAGAGGAAAGAGGGGGG + Intergenic
1194070957 X:89325481-89325503 AGAGAGAAAAAAAAACAGGATGG - Intergenic
1194254089 X:91614693-91614715 AGAGAGAAGAGCCAAGAGAAAGG + Intergenic
1194266600 X:91761108-91761130 AGAGAGAAATCCAAAGAACAAGG - Intergenic
1194354742 X:92869139-92869161 GGAGAGTACACTAAAGAGGAGGG + Intergenic
1194659537 X:96614476-96614498 AGAAAGAAGACCAAATAGAAGGG - Intergenic
1194699451 X:97095617-97095639 AGATAGAAGACAAAAAAGAAAGG + Intronic
1194827139 X:98577501-98577523 AGAGAGAAAAACAAAGAGACAGG - Intergenic
1195021656 X:100834226-100834248 AGAGAGAAGTACGCAGAGGAAGG - Intronic
1195170170 X:102259691-102259713 AGAGTGAAGAGCAAAGATAAAGG + Intergenic
1195188687 X:102427409-102427431 AGAGTGAAGAGCAAAGATAAAGG - Intronic
1195235578 X:102894232-102894254 AGCTAGAAGACCAAATGGGAGGG + Intergenic
1195620746 X:106952100-106952122 AGTGACAAGATCAAAGATGAAGG - Intronic
1195706338 X:107740595-107740617 AGAGAGAAGATCCAAGAGCTTGG + Intronic
1195716202 X:107820685-107820707 AGAAGGAAAACCACAGAGGATGG - Intergenic
1195967388 X:110440797-110440819 ACAGAGAAGAGCAAACAGTAGGG + Intronic
1196136143 X:112211720-112211742 AGAGAGGGAAGCAAAGAGGAAGG - Intergenic
1196514058 X:116548831-116548853 AGACAGAAAACCCAAGAAGAAGG - Intergenic
1196685965 X:118510562-118510584 AAAGAAAAGAGCAAAGAGGTAGG + Intronic
1196715653 X:118808455-118808477 AGACAGAGGAACAAGGAGGATGG - Intergenic
1197176578 X:123492759-123492781 AGAGTGAGGACAAAAGGGGAGGG - Intergenic
1197263005 X:124336646-124336668 AGAGAACACGCCAAAGAGGAAGG - Intronic
1197985655 X:132264262-132264284 AGAGATAAGACAGAAGAGGCAGG - Intergenic
1198063341 X:133070038-133070060 AGAGACAAGAGGAAAGATGAGGG + Intronic
1198557762 X:137813976-137813998 AGAGATAAGAACAAGCAGGATGG + Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199855525 X:151756094-151756116 AGAGAGAAGCACAAAAAGAAAGG - Intergenic
1199869625 X:151886677-151886699 GGAGAGGAGACCCAAGGGGAAGG + Intergenic
1199924882 X:152451574-152451596 AGAGGGAAGCCCAGAGAGAAAGG + Intergenic
1200303627 X:155003650-155003672 TCAGAGAATACCAAAGAAGATGG + Intronic
1200572876 Y:4854270-4854292 AGAGAGAAGAGCCAAGAGAAAGG + Intergenic
1200583805 Y:4982022-4982044 AGAGAGAAATCCAAAGAACAAGG - Intergenic
1200663105 Y:5986156-5986178 GGAGAGTACACTAAAGAGGAGGG + Intergenic
1200719405 Y:6587085-6587107 GGAGAGAAGAGGAAAGAGGCGGG + Intergenic
1200904290 Y:8465666-8465688 AGACAGAAGAATAAAGAAGAAGG - Intergenic
1201038447 Y:9805921-9805943 AGAAAGAAATCCAAAGACGATGG - Intergenic
1201428051 Y:13875661-13875683 TGAGAGAGGACTAAAAAGGAGGG - Intergenic
1201523657 Y:14905832-14905854 AGAAGGAAGACCAAACATGAAGG + Intergenic
1202386765 Y:24333790-24333812 AGAAAAGAGTCCAAAGAGGAAGG - Intergenic
1202484020 Y:25336338-25336360 AGAAAAGAGTCCAAAGAGGAAGG + Intergenic