ID: 1192475775

View in Genome Browser
Species Human (GRCh38)
Location X:71441173-71441195
Sequence GAAAATATACAGATGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 1, 2: 8, 3: 63, 4: 495}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192475775_1192475780 6 Left 1192475775 X:71441173-71441195 CCAAGCCCCATCTGTATATTTTC 0: 1
1: 1
2: 8
3: 63
4: 495
Right 1192475780 X:71441202-71441224 GAAGTGACTGTTCATTTCTTTGG 0: 1
1: 0
2: 13
3: 192
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192475775 Original CRISPR GAAAATATACAGATGGGGCT TGG (reversed) Intronic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
901487001 1:9571006-9571028 GAAAATCATCTGATGGGGCTGGG - Intronic
902344310 1:15804791-15804813 TAAAAAACACAAATGGGGCTGGG - Intergenic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
904612647 1:31733831-31733853 GAAAAAAAGCAGATGGGGCCTGG + Intronic
905753101 1:40483520-40483542 GAAAGTGTACAGTTTGGGCTGGG - Intronic
905958967 1:42027296-42027318 GATAAAATACAGTTGTGGCTTGG - Intronic
906387822 1:45386945-45386967 AAAAAACTACATATGGGGCTGGG - Intronic
907673565 1:56498448-56498470 GAAAATGTGGAGCTGGGGCTGGG - Intronic
908095056 1:60729034-60729056 GAAAAATTACAGCTAGGGCTGGG - Intergenic
908118703 1:60965605-60965627 GCAAAGATACAGATGGGGTGTGG - Intronic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
908912615 1:69089593-69089615 GGACATATACAGATGGACCTAGG - Intergenic
909612591 1:77568758-77568780 GAAAATATAAAGATGGGATTGGG - Intronic
910548288 1:88445182-88445204 AAAAATATACAGAATTGGCTTGG - Intergenic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
911622259 1:100078772-100078794 GAAAATTTACTGATGAGGCTGGG + Intronic
912476463 1:109940017-109940039 TAGAAAATACACATGGGGCTGGG + Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
915939224 1:160108148-160108170 AAAAAAATACCGATGCGGCTGGG + Intergenic
916572467 1:166039640-166039662 GAAACTCTACAGGTGGGGCCTGG + Intergenic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
917089621 1:171339793-171339815 GAAAATAAACAGATGGCCTTGGG + Intronic
917658334 1:177151124-177151146 GAAAATATACATCTTTGGCTTGG - Intronic
917834884 1:178933628-178933650 GGAAATATACAGTTGAGGCTGGG + Intergenic
917839606 1:178967012-178967034 GAAAATAGAGAAATGTGGCTGGG + Intergenic
917874918 1:179277619-179277641 GAAAATACAAATATAGGGCTGGG - Intergenic
917918159 1:179725462-179725484 AAAAATATTAAGTTGGGGCTGGG - Intergenic
918023547 1:180718960-180718982 TAAAACATACAGATCCGGCTGGG - Intronic
918403456 1:184188216-184188238 TAAAATATAAAAATGGGTCTTGG - Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919951868 1:202372164-202372186 GAAAATATAATGAAGGGGCTGGG - Intronic
920992009 1:210948531-210948553 GAAAATATCTAGATGGAGGTGGG + Intronic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922972596 1:229755474-229755496 GAAAATAGAGTCATGGGGCTAGG + Intergenic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
923623497 1:235595877-235595899 AAAAATATACACTTGGGGCCGGG + Intronic
923962057 1:239096848-239096870 GCAGATATACTGGTGGGGCTGGG - Intergenic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063102083 10:2959118-2959140 AAAAACATGCATATGGGGCTGGG - Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1065107931 10:22409221-22409243 GAAAAGATACTGAAGTGGCTGGG + Intronic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1066995604 10:42560156-42560178 GAAAGTATACATCTGGGGATTGG + Intergenic
1067746923 10:48942945-48942967 GAAAATAAGCAGATGGGCCATGG - Intronic
1068243847 10:54339661-54339683 GGAAGTATACAGATGAGCCTAGG - Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1072028174 10:91486285-91486307 GAAAATATCCATCTGGGACTAGG - Intronic
1072886955 10:99285629-99285651 GAAAATATATAAATGAGGCTGGG + Intergenic
1073507774 10:104016021-104016043 GAAATTTTACAGTTGAGGCTGGG + Intronic
1073670612 10:105583536-105583558 GAAAAGACACAGGTGGGGTTGGG + Intergenic
1074133060 10:110599912-110599934 GAAAATATTAAAATGAGGCTTGG + Intronic
1074302374 10:112244340-112244362 ACAAATATACTGATGGGGCATGG - Intergenic
1075386452 10:122058877-122058899 AAAAACACACAGAGGGGGCTGGG - Intronic
1076578787 10:131492609-131492631 GATAAAATACAGAGGGGACTGGG + Intergenic
1078850504 11:15158764-15158786 GATAATATATAGAGAGGGCTTGG + Intronic
1078871019 11:15344966-15344988 GAAAAAATTCAGATTGTGCTGGG + Intergenic
1079255813 11:18828671-18828693 TAAAAAATACAGAATGGGCTGGG - Intergenic
1079327442 11:19506259-19506281 GAAACTATAGGCATGGGGCTAGG + Intronic
1079713013 11:23709588-23709610 GAAAATACACAGTCAGGGCTGGG + Intergenic
1080526722 11:33129433-33129455 AAAAATATACAGATGGTGGGGGG + Intronic
1080680671 11:34472987-34473009 GAAAATAGATATATCGGGCTGGG + Intergenic
1080806076 11:35655305-35655327 GAAAATATTCAGAAGGGAATTGG + Intergenic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1082803911 11:57434686-57434708 GAAAATATCAAGGTGGAGCTTGG + Intergenic
1083130162 11:60617653-60617675 GAAAATCTACCTATTGGGCTGGG - Intergenic
1083253647 11:61483459-61483481 GAAATGAAAAAGATGGGGCTGGG - Intronic
1084507620 11:69578681-69578703 GAAGATATACAGATGGCAATTGG - Intergenic
1085177080 11:74498786-74498808 TAAAAAATACTGTTGGGGCTGGG + Intronic
1085441945 11:76572749-76572771 AAAAGTAAACAAATGGGGCTGGG - Intergenic
1085526919 11:77169554-77169576 GATAATCTGCAGATGGGGATGGG - Intronic
1085653630 11:78291857-78291879 TAAAAAATACATAAGGGGCTGGG - Intronic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1086478698 11:87209272-87209294 GAAAGTAGACAGGTGGGTCTTGG - Intronic
1086484467 11:87283561-87283583 GAAAATAAATTAATGGGGCTGGG + Intronic
1086816701 11:91380867-91380889 CAAAATATACAGGTGTTGCTAGG + Intergenic
1086838417 11:91654162-91654184 TAAAATATACAAATGAGGCTGGG - Intergenic
1088168073 11:106962254-106962276 GAAAATGTGTATATGGGGCTGGG + Intronic
1088967041 11:114733885-114733907 GAAAATATACACATGGGACTGGG - Intergenic
1089139322 11:116273514-116273536 GAAGATGTCAAGATGGGGCTTGG + Intergenic
1089766952 11:120774955-120774977 GACGAGATAAAGATGGGGCTAGG + Intronic
1094007754 12:25773454-25773476 GGAAATATATAGATGAGGCCAGG - Intergenic
1094198489 12:27774726-27774748 GAAAATAAAAAGCAGGGGCTGGG + Intergenic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1094379385 12:29826663-29826685 CAGAATATTCAGGTGGGGCTGGG + Intergenic
1095250329 12:39971677-39971699 GAAAAAATAAAAATGTGGCTGGG + Intronic
1096329887 12:50701966-50701988 AGAATTATACAGATGAGGCTGGG + Intronic
1096682064 12:53262472-53262494 GAAAATATATATATAAGGCTGGG - Intergenic
1097371932 12:58794557-58794579 GAATATGTAAAGATGAGGCTGGG + Intronic
1097653268 12:62330291-62330313 AAAAAAAAACAAATGGGGCTGGG + Intronic
1098048085 12:66422958-66422980 GAAAATTAAAACATGGGGCTAGG - Intronic
1098091278 12:66904595-66904617 TAAAATGTTCAGATTGGGCTGGG + Intergenic
1098097134 12:66970374-66970396 AAAATTACACAGATGAGGCTGGG - Intergenic
1098222486 12:68284971-68284993 GAGAATGAACAGGTGGGGCTAGG - Intronic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1099614167 12:84913207-84913229 GAGAATATTCAGATGGTGCCAGG - Intronic
1100100429 12:91097086-91097108 AAAAATATACACATAGGGCAAGG + Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100803995 12:98262088-98262110 GAAAAGCTAAAGATGTGGCTTGG - Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101949959 12:109166988-109167010 GAGAAGGTACAGATGGGTCTCGG + Exonic
1102372762 12:112396058-112396080 GAAAAGACACAGACTGGGCTGGG + Intergenic
1102695497 12:114796006-114796028 GAAAATATAGAAATGTGGCCAGG - Intergenic
1102883448 12:116503930-116503952 AAAAGTATACAGGTGGGGCTGGG - Intergenic
1103240088 12:119405874-119405896 TAAAAAATATAGATGAGGCTGGG + Intronic
1104176446 12:126337389-126337411 AAAATTAGAAAGATGGGGCTGGG - Intergenic
1104312675 12:127668349-127668371 GAAACTATTAAGTTGGGGCTGGG + Intergenic
1104863218 12:131936266-131936288 GAAAGTGTACAGTTCGGGCTGGG + Intronic
1106947707 13:34847329-34847351 GAAAAAATACAGGTGGGGCTGGG - Intergenic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1107695626 13:42996937-42996959 GAAAAGCTACACTTGGGGCTCGG - Intergenic
1108306113 13:49135148-49135170 GAAAATATATGAATGGGGCTGGG - Intronic
1108381640 13:49860317-49860339 TAAAAGAAATAGATGGGGCTTGG + Intergenic
1108538376 13:51410914-51410936 GAAAATAAGCACATGGAGCTGGG + Intronic
1108670859 13:52686773-52686795 AGAAATATCCAGATGGGGCTGGG + Intronic
1108876075 13:55052673-55052695 GAAAATTTGAAGATGGGTCTTGG - Intergenic
1110309541 13:74032649-74032671 GAAAATATAGAGAGAGGCCTGGG - Intronic
1110808073 13:79781198-79781220 TAATATATATATATGGGGCTGGG - Intergenic
1111139120 13:84091113-84091135 CAAAAAATACTGATAGGGCTTGG - Intergenic
1111417676 13:87970170-87970192 GAAAATATATATATTGGGATAGG + Intergenic
1111977812 13:94986036-94986058 AAAAATAAAAAGATAGGGCTGGG + Intergenic
1114377611 14:22164979-22165001 GAAAATGTACAGATGAGCTTAGG + Intergenic
1114428568 14:22640814-22640836 GAAAATATCAAGAAGAGGCTGGG - Intergenic
1114991297 14:28293448-28293470 TAAAAGATACAGAAGGGGCCAGG - Intergenic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1115620162 14:35133212-35133234 GAAAATACACAGTTAGGGCTGGG - Intronic
1116291289 14:43045724-43045746 GACAATATCTAGATGGGTCTGGG - Intergenic
1117130613 14:52682910-52682932 AAAAAGACACAGATTGGGCTGGG + Intronic
1117204095 14:53423594-53423616 GTAAACAAACTGATGGGGCTTGG - Intergenic
1117399492 14:55345704-55345726 GATAATAAACAGGTAGGGCTGGG + Intronic
1118100889 14:62601343-62601365 AAAAATAGACAAATGGGGCTGGG + Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1118980387 14:70711431-70711453 AAAAACATACAAATAGGGCTTGG + Intergenic
1119210235 14:72825984-72826006 GGAAAAATACAGATGGGGGCAGG + Intronic
1119459822 14:74791371-74791393 GAAAATAAAATGATGGGCCTTGG + Intronic
1119804354 14:77473130-77473152 GAAACTAAACAAAAGGGGCTGGG - Intergenic
1120790304 14:88574536-88574558 AAAAATATAAATATGAGGCTGGG - Intronic
1120929647 14:89835921-89835943 AAAAATATACAGGTTGGGCCAGG - Intronic
1121090623 14:91179454-91179476 AAATATATATAGATGAGGCTGGG + Intronic
1121249225 14:92487393-92487415 GAAAGTATAGGGATGGGGATGGG + Intronic
1121660310 14:95630414-95630436 GAAAATGTACAGTGTGGGCTCGG + Intergenic
1121993922 14:98587014-98587036 GAAAGAATACAGAAGTGGCTTGG + Intergenic
1123437710 15:20267667-20267689 ATAAAAATAGAGATGGGGCTGGG + Intergenic
1124082186 15:26510545-26510567 GACAACATACAGCTGGGTCTTGG + Intergenic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1126815603 15:52450369-52450391 AAAAAATTAGAGATGGGGCTGGG + Intronic
1128042148 15:64584610-64584632 ATAAACATAAAGATGGGGCTGGG - Intronic
1128047499 15:64631837-64631859 GAAAATATAGAGTTGTGGCCGGG - Intronic
1128089252 15:64907883-64907905 TAAAATACAAAGAAGGGGCTGGG - Intronic
1128562347 15:68677231-68677253 GCAAATATAGTGATGGGGCTTGG - Intronic
1129067256 15:72915818-72915840 TAAAATATAAAAATGAGGCTGGG - Intergenic
1129647114 15:77446510-77446532 AAAAGTATACATATGTGGCTGGG + Intronic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1131162068 15:90112787-90112809 TAAAGTATACAGACAGGGCTGGG + Intergenic
1131630367 15:94169984-94170006 AAAAAAATACATATAGGGCTGGG - Intergenic
1131942278 15:97580284-97580306 GAAAATATACAAATGGGGCTGGG - Intergenic
1133677840 16:8092298-8092320 GAAACTCTACAGATGGATCTTGG - Intergenic
1134087641 16:11369224-11369246 TAAAATATAGAGATGGGGCCGGG - Intronic
1134150790 16:11803185-11803207 TAAAAAATACAGATGGGGTTAGG + Intergenic
1135820633 16:25682374-25682396 GAATATATACAAAAGGGGCTGGG - Intergenic
1136846865 16:33583188-33583210 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1136864310 16:33731448-33731470 GGAAATATACGCATGGGACTAGG - Intergenic
1137012265 16:35334236-35334258 GAAAATATACAGATATACCTTGG - Intergenic
1137016629 16:35383017-35383039 GAAAATATACAGATATACCTTGG - Intergenic
1137019013 16:35404678-35404700 GAAAATATACAGATATATCTTGG - Intergenic
1137666820 16:50254988-50255010 AAAAATAGACACATTGGGCTAGG + Intronic
1137720863 16:50626586-50626608 GAAGAGACACAGATGTGGCTGGG + Intronic
1137742678 16:50795698-50795720 GCACATCTACAGATGGGGCTGGG - Intronic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1138375345 16:56559766-56559788 AAAAACATAATGATGGGGCTGGG + Intergenic
1138568822 16:57854330-57854352 AAAAGTATAAAGATGGGGCCAGG + Intronic
1139222188 16:65194884-65194906 AAAAATAGACAAATGGGACTAGG - Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140140792 16:72255551-72255573 GACAATCTACAAATGGGGCTGGG - Intergenic
1141532937 16:84659296-84659318 GAAATTAAACAGAAGAGGCTGGG - Intronic
1141613879 16:85199245-85199267 TAAAATATACAGGCGGGGCACGG - Intergenic
1203108573 16_KI270728v1_random:1431843-1431865 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1203125796 16_KI270728v1_random:1579586-1579608 GGAAATATACGCATGGGACTAGG - Intergenic
1142716147 17:1748002-1748024 GAAAAGATCCAGGAGGGGCTGGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143575272 17:7788867-7788889 AAAAATATGTAGATGGGGCTGGG + Intronic
1143675379 17:8428656-8428678 AAAAATATACACTTGGGGCCAGG - Intronic
1143926871 17:10378893-10378915 GAAAATGTACAGTTTGGGATGGG - Intergenic
1144075587 17:11716622-11716644 GAAAATAAATACATGGGACTGGG - Intronic
1144087833 17:11826755-11826777 GAAAACATACAGAACTGGCTGGG - Intronic
1145165252 17:20609085-20609107 GAAAAAAAAAAGATTGGGCTGGG - Intergenic
1146340332 17:32013298-32013320 GAAAATATAATGATGTGGCCAGG - Intronic
1146366015 17:32228532-32228554 AGAAATATACTGATGAGGCTGGG + Intronic
1149912640 17:60580427-60580449 AAAAATATACATATTGGGCTAGG + Intronic
1149953667 17:61021024-61021046 GTAAATATAAAGATGGGGAGGGG - Intronic
1149969134 17:61198433-61198455 GAAAATCAACATATCGGGCTGGG - Intronic
1150109889 17:62489631-62489653 GAAAATATACAGGCTGGGCATGG - Intronic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1151023436 17:70647259-70647281 GAACAGACACAGATGGGGATTGG - Intergenic
1151080742 17:71325573-71325595 GGAAATATAAAGTTGGGGCAGGG - Intergenic
1152584998 17:81185046-81185068 GAAAATAAAAAGAAGGGGCCGGG + Intergenic
1153211912 18:2776502-2776524 TAAAATATAAAAAAGGGGCTGGG - Intronic
1154154671 18:11934663-11934685 AAAAATAGACAGAAGGGGCCGGG + Intergenic
1155400322 18:25431937-25431959 GAAAATATAAAGATGAACCTAGG + Intergenic
1155432294 18:25772274-25772296 GAAAATAAGAAAATGGGGCTGGG + Intergenic
1155511498 18:26581970-26581992 GAAAGTATGCAAATAGGGCTGGG + Intronic
1155554064 18:26998428-26998450 AAACATATCCAGATTGGGCTGGG + Intronic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1157841200 18:50960430-50960452 AAAAAAATACAAATGGGGCCAGG + Intergenic
1158167524 18:54557322-54557344 GAAATTATAAAGATAGGGCCAGG - Intergenic
1158318492 18:56237854-56237876 GAAACAATACAAATTGGGCTGGG - Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159553271 18:69918865-69918887 GAAATTATACAGATGCGTATTGG - Intronic
1160029200 18:75243919-75243941 GAAAAAATAGAGCTGGGGCCAGG + Intronic
1160207309 18:76845553-76845575 AAAAAAATGCAGCTGGGGCTGGG + Intronic
1160580216 18:79879383-79879405 GAAAGGATAGACATGGGGCTTGG + Intronic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1162443072 19:10705208-10705230 GAAAAAATAAATATGGGGCTGGG - Intronic
1162631664 19:11932579-11932601 TAAAATATACTGATGTGGATGGG - Intronic
1163211350 19:15842680-15842702 GAAAATATGCACATGGGCCAAGG + Intergenic
1163939569 19:20479426-20479448 GAGAATATAAAGAGGAGGCTTGG + Intergenic
1164229511 19:23275167-23275189 TAAAATGTCCAAATGGGGCTGGG - Intergenic
1164867773 19:31619176-31619198 GAAAATACAAACATTGGGCTGGG + Intergenic
1165019023 19:32907880-32907902 GAAAAGATAAAAATGGGGCCGGG - Intronic
1166317649 19:41998018-41998040 GACAGAAAACAGATGGGGCTGGG - Intergenic
1167061188 19:47147746-47147768 AAAAAAATACAGTTGAGGCTGGG - Intronic
1167925535 19:52818415-52818437 AAAAATATAAAAATTGGGCTGGG + Intronic
1168390239 19:56001024-56001046 GAAAATATTCAAATTTGGCTGGG + Intronic
925296675 2:2781563-2781585 GAAGATAAACAGATGGGTGTGGG - Intergenic
925442098 2:3897374-3897396 GACAATATACCTATGGGTCTTGG + Intergenic
926773492 2:16399528-16399550 GAAACTATACATTTGGGGCTGGG + Intergenic
927095321 2:19743985-19744007 GACAATATGCAGATAGGCCTTGG - Intergenic
927598090 2:24415182-24415204 GAATATATACAGGCTGGGCTTGG - Intergenic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
928890666 2:36199658-36199680 GAAAATATAGATTTGGGGCCAGG - Intergenic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
929692225 2:44084560-44084582 GGAAGTATACAGATGGGCCTAGG - Intergenic
930221189 2:48748360-48748382 GAAAAGATCCAGAATGGGCTTGG + Intronic
931014054 2:57954715-57954737 TAAAATTTACAGGTGGGCCTGGG - Intronic
931518053 2:63063501-63063523 GAAAATAGAAAGATGAGACTTGG - Intergenic
932553576 2:72797516-72797538 TAAAATATACATATGTGGCCGGG + Intronic
932986792 2:76736133-76736155 GGAAGTATACATATGGGCCTAGG - Intergenic
933406767 2:81870265-81870287 GTAAATACATAGGTGGGGCTTGG - Intergenic
933508474 2:83208704-83208726 GAAAATATAAAATTTGGGCTAGG - Intergenic
933710633 2:85323251-85323273 AAAAAAATACACATGTGGCTGGG - Intronic
933740749 2:85532136-85532158 AAAAATATACACCTGTGGCTGGG + Intergenic
933768289 2:85726172-85726194 GAATTTATACAAATGGGGCCAGG + Intergenic
934071271 2:88385991-88386013 GAAAATATACAAATGGGGCAGGG + Intergenic
936237813 2:110759591-110759613 GACAACATACTGATGGGTCTTGG + Intronic
936373567 2:111922418-111922440 GAAAAAATATACATCGGGCTTGG - Intronic
936445894 2:112594909-112594931 TAAAATAAACAAAAGGGGCTGGG - Intergenic
937075645 2:119104335-119104357 GCAAATATAAAGCTGGGGCTGGG - Intergenic
937177371 2:119953699-119953721 GAAAATATACAAAAGAGCCTAGG - Intronic
937811167 2:126200970-126200992 GTCAAGATCCAGATGGGGCTGGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938605514 2:132888684-132888706 GAAAATATACACACTGGGCAGGG - Intronic
939272471 2:139958460-139958482 AAAAATATGAAGATTGGGCTTGG - Intergenic
940432541 2:153610377-153610399 TAAAATAAACAGATTGGGCCGGG + Intergenic
940619146 2:156088987-156089009 AGAAATGTACAGATGGGGGTGGG - Intergenic
940692468 2:156936691-156936713 GAAAATCTAAAGATTGGGATAGG + Intergenic
941190954 2:162381057-162381079 GAAAAAATACAACTGGAGCTGGG + Intronic
942136610 2:172932005-172932027 CAAAATATAAAGCTGGGGGTGGG - Intronic
942866754 2:180685670-180685692 GAAAAATTACTGAGGGGGCTTGG - Intergenic
944556678 2:200894323-200894345 GAACATCTACAAATGGGGCTGGG - Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
944827024 2:203494511-203494533 GAAAATATTTACATGGGGCCAGG + Intronic
945591649 2:211739762-211739784 TAAAATAGCCAGATGAGGCTGGG - Intronic
946033634 2:216724652-216724674 GAATAAATAAAGATGGGGCTGGG - Intergenic
946051010 2:216862636-216862658 AAAAATAAGCAGATTGGGCTAGG + Intergenic
946299850 2:218816088-218816110 CAAAATTTACTGCTGGGGCTTGG - Intergenic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
947660720 2:231864742-231864764 GAAAACATACAAAAGGAGCTTGG - Intergenic
948150749 2:235742869-235742891 AAAAATCTACAGAAGAGGCTAGG + Intronic
948535332 2:238642201-238642223 AAAAATATACTGGTGGGGCCGGG + Intergenic
948872184 2:240807436-240807458 TAAAATATATGGAAGGGGCTGGG - Intronic
1168930591 20:1620224-1620246 GAAGACATAAAGATGGGGTTAGG - Intergenic
1169120804 20:3094516-3094538 GAAAAAAAAAAGATTGGGCTTGG + Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169690248 20:8322369-8322391 GAAAAAAGACACATGGGGATGGG - Intronic
1169873508 20:10271933-10271955 CAAAATATAAAGATGGAGCGTGG + Intronic
1170456043 20:16533963-16533985 TAAAAAATAAAGATGTGGCTGGG + Intronic
1170604393 20:17864739-17864761 GAAAATATATCTATGGTGCTTGG - Intergenic
1170989416 20:21288196-21288218 AAAAATAGAAAAATGGGGCTGGG + Intergenic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171414948 20:24971581-24971603 AAAAACAAACAGATGGGGATTGG + Intronic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172254596 20:33506110-33506132 GAAAAGAAATAGAAGGGGCTGGG + Intronic
1172473477 20:35219025-35219047 GATAAAAAACTGATGGGGCTGGG - Intergenic
1172607393 20:36223191-36223213 GAAAATATAAAAATTAGGCTGGG - Intronic
1173219722 20:41122088-41122110 GAAAATAAACAGATTGCCCTGGG + Exonic
1173364476 20:42372442-42372464 GAAAATATACAAATTTAGCTAGG - Intronic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1175512616 20:59542560-59542582 GAAAATACACAGTCAGGGCTGGG - Intergenic
1177185989 21:17796877-17796899 GAAATTAAACAGATGATGCTGGG + Exonic
1178337113 21:31753178-31753200 GAAGAAAACCAGATGGGGCTTGG - Intergenic
1178342903 21:31801211-31801233 TAAGATATACAAATGAGGCTGGG + Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1178983627 21:37284901-37284923 GAAAATAAACCAATGGGGCCGGG - Intergenic
1179049696 21:37878726-37878748 GGAAAAATACAGGTGGGGCTGGG + Intronic
1180689710 22:17702855-17702877 AAAAATATATATATAGGGCTGGG + Intronic
1180906550 22:19416902-19416924 GAAGATATACAAATGAGGCACGG + Intronic
1181330241 22:22085485-22085507 GAAAATATAAATATGGAGCCAGG - Intergenic
1182341616 22:29626445-29626467 AAATATCTGCAGATGGGGCTGGG - Intronic
1182502857 22:30760518-30760540 GAAAATCAATAAATGGGGCTGGG + Intronic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1182797258 22:33000068-33000090 TCAAATCTACAGATGAGGCTGGG + Intronic
1183570756 22:38651655-38651677 TGAAATATTCAGAAGGGGCTGGG - Intronic
1183766615 22:39882707-39882729 GAAAATACACAAAGAGGGCTGGG + Intronic
1184025137 22:41850152-41850174 GAAAGTAATGAGATGGGGCTGGG + Intronic
1184244785 22:43230442-43230464 GAAAAGATACAGGTGGGGGTGGG + Intronic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
949231470 3:1755985-1756007 TAAAATATTCAGATGGGGCCAGG + Intergenic
949976204 3:9462610-9462632 GAATATAGATAGATGGGGCCAGG + Intronic
949994576 3:9606466-9606488 TTAAATATAGAGATGGGGCCAGG + Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950999384 3:17540118-17540140 GAAAATATACAAATGGCAATTGG - Intronic
951252011 3:20404743-20404765 GAATATATCCAGATGCTGCTTGG + Intergenic
951618461 3:24574648-24574670 GTAAATAAACAGTTGTGGCTGGG - Intergenic
952674644 3:36013029-36013051 GAAAAAATGCAGAAGGGGCAGGG - Intergenic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
953889220 3:46738242-46738264 GAAAGTAAAAAGATGTGGCTGGG + Intronic
954198458 3:49010015-49010037 AAAAAAATAGAGATGGGGCCTGG - Intronic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
954853831 3:53625960-53625982 GAAAATTTACAGACTAGGCTGGG + Intronic
955181758 3:56678713-56678735 CAAAACATACAAATGGGGCTGGG + Intronic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
956606505 3:71078125-71078147 GAAAATATACAGAGGAGGCCGGG - Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
956851565 3:73232662-73232684 GAAATTATAGACATGAGGCTGGG - Intergenic
957232876 3:77543206-77543228 GAAAAAATGCAGATGGCACTGGG - Intronic
957421251 3:79974571-79974593 GAAAATATTCATATGGGTCAAGG + Intergenic
958569350 3:95860175-95860197 AAAAAAATACATATGAGGCTGGG - Intergenic
958815399 3:98908694-98908716 GACAACATACCGATGGGTCTTGG - Intergenic
959035689 3:101360906-101360928 GAAAATATAGAGAACTGGCTGGG + Intronic
959356212 3:105332426-105332448 GAAAATATAGAGAAAGAGCTTGG + Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960103816 3:113772430-113772452 TAAAATATCAAAATGGGGCTGGG + Intronic
960157888 3:114316626-114316648 TAAAATATACAGAGGGAGCAGGG - Intergenic
960573725 3:119209325-119209347 GAAAAATTACAGATGGAGTTGGG + Intergenic
961341027 3:126219115-126219137 CAAAATATACAGATTGGGTTGGG + Intergenic
961600606 3:128058564-128058586 TAAAATACACACATGTGGCTGGG + Intronic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
961990723 3:131187618-131187640 AAAAAATTGCAGATGGGGCTGGG - Intronic
962348637 3:134640875-134640897 GAGAATAAACAGAGGGGGCAAGG - Intronic
963554854 3:146774113-146774135 GCAAAATAACAGATGGGGCTAGG - Intergenic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
964560161 3:157986264-157986286 GGAGAAATACTGATGGGGCTAGG - Intergenic
965254878 3:166393577-166393599 TAAAATATACAGAATGGGCGGGG - Intergenic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
965888705 3:173482438-173482460 GAAAGTGTGGAGATGGGGCTGGG - Intronic
966132253 3:176654342-176654364 GAAAATATACATTTGGGAATAGG - Intergenic
967296598 3:187971193-187971215 TAAAATATACAGCTGTGCCTAGG + Intergenic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
968755507 4:2413901-2413923 AGAAGTATACAGCTGGGGCTTGG - Intronic
968772619 4:2517339-2517361 AAAAAAATAGAGTTGGGGCTGGG - Intronic
968837876 4:2978932-2978954 GAAAATACACAAATTAGGCTGGG + Intronic
969165742 4:5309868-5309890 AAAAATAGAAAAATGGGGCTGGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970373680 4:15434572-15434594 GAACATATACAGGTGGTTCTGGG - Intronic
971854582 4:32026837-32026859 GAAAAAATACTGATAGGGCAAGG + Intergenic
972262764 4:37427150-37427172 GAAAGTATACAGATGGAGTTTGG - Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
972506440 4:39724398-39724420 AAAAAAATACAGTTTGGGCTGGG - Intronic
973697185 4:53501576-53501598 GAAAAGACAGAGATGGGTCTGGG - Intronic
974571156 4:63650433-63650455 CAAAATAAGCAGATGGGTCTTGG + Intergenic
974710474 4:65587584-65587606 GGGAATATCCAGATGGGGGTCGG - Intronic
976288831 4:83396859-83396881 GAAAATATACACTTCTGGCTGGG + Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
977437573 4:97018851-97018873 AAAAATAAATGGATGGGGCTGGG - Intergenic
977660633 4:99580943-99580965 GGAAATATACATATGGGGAGAGG - Intronic
978889468 4:113806024-113806046 GCAAATATATGGATGGGGCATGG + Intergenic
979683284 4:123484253-123484275 AAATATATCCAGATGGGGCCAGG - Intergenic
982007699 4:151079122-151079144 CAAGATATACAAATGGGACTGGG - Intergenic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
983082359 4:163402253-163402275 GGAAGTATACAGATGGGCCTAGG + Intergenic
983932995 4:173473670-173473692 GTAAATATGCAGATCTGGCTAGG + Intergenic
984048750 4:174837154-174837176 TAAAAGATACATCTGGGGCTGGG + Intronic
984262783 4:177461947-177461969 GAAAATCCAGAGCTGGGGCTGGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
984836797 4:184029857-184029879 TACAATAAACAGAAGGGGCTGGG + Intergenic
986694883 5:10342806-10342828 TTAAATATACAGTTGGGGCTGGG - Intergenic
986996484 5:13613121-13613143 TAAAACATACAGATGGGGTTGGG + Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987926015 5:24342869-24342891 CAAGATATAAAGATGGGGCCGGG + Intergenic
987978906 5:25054234-25054256 GAAAATAAACAAATAAGGCTGGG + Intergenic
988001326 5:25353601-25353623 GAAAATATACAGGCCGGGCACGG + Intergenic
988255859 5:28819346-28819368 AAAAATCTAAAGATGTGGCTAGG + Intergenic
988277564 5:29101478-29101500 GAAAATATACAGATGACACTTGG + Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
991181808 5:63760727-63760749 GAAAATAAATTGATGGGGCCAGG - Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
993368364 5:87060343-87060365 GAAAATAGACAGTTTGGGCCAGG - Intergenic
993376864 5:87158626-87158648 GAAAAGATACACATTTGGCTGGG - Intergenic
995140019 5:108725376-108725398 GAAAGTATACAGACAGGCCTAGG + Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
995677543 5:114680001-114680023 GAAAAAATACAGGTGAGGCATGG - Intergenic
997321868 5:132984252-132984274 AAGAATAAACAGATGGGGGTGGG - Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
998348002 5:141481520-141481542 AAAAATCTAGAGATGGGGCTGGG + Intronic
998490206 5:142540019-142540041 CAAAATAAAAAGATGGGGGTTGG + Intergenic
998573767 5:143290855-143290877 TTAAATATAGAGATGGGGCCAGG - Intronic
999332662 5:150687367-150687389 AAAAACAGACTGATGGGGCTGGG + Intergenic
999414862 5:151386171-151386193 AAAAAGATACAGAAGGGGCCGGG - Intergenic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999902886 5:156105681-156105703 TAAAATATATAAATGGTGCTTGG - Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000570602 5:162908801-162908823 AAAAATATATAGATGGGGGGTGG + Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001335776 5:170795472-170795494 GAAAACATGCAGATGTGTCTTGG + Intronic
1001544347 5:172561179-172561201 GCAAATATAAAGAAGGGGCTGGG - Intergenic
1001849797 5:174953474-174953496 TAAAATATACACATGCGGCCGGG - Intergenic
1001948547 5:175799828-175799850 GAAAGTATATGGAAGGGGCTGGG - Intronic
1002891877 6:1340410-1340432 GAAAATACGCAGCTGAGGCTAGG - Intergenic
1004229835 6:13822218-13822240 AAAAATATATAGAAGAGGCTGGG + Intergenic
1004924000 6:20402092-20402114 GAAAAGAGAGAGAGGGGGCTCGG + Intronic
1005223315 6:23613344-23613366 GAAGATATACAGAGGGAGCCAGG + Intergenic
1005757533 6:28938553-28938575 AAAATTATACATATGAGGCTGGG - Intergenic
1005940934 6:30559080-30559102 GAAAATATAAATTTGCGGCTGGG + Intronic
1006329425 6:33379571-33379593 GAGAATATACAGTTGAGGCTGGG + Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006488043 6:34360925-34360947 AAATATATACATATGGGGCCAGG + Intronic
1007340494 6:41188321-41188343 GAAAGTGTCCAGTTGGGGCTGGG + Intergenic
1007392699 6:41559515-41559537 GAAAAAAAAGAGAAGGGGCTAGG + Intronic
1007505139 6:42329693-42329715 GAAAATGTACTGATTTGGCTGGG + Intronic
1008098903 6:47370693-47370715 GAAGATATACAAATGGATCTTGG + Intergenic
1008134385 6:47756988-47757010 GGAAATATACAAATGGGACTTGG + Intergenic
1008389084 6:50928524-50928546 GAGAAGATACAGGTGGGGCAAGG - Intergenic
1009274242 6:61654852-61654874 GAAAAGATACAGCTGCTGCTGGG + Intergenic
1009351158 6:62680622-62680644 AAAAATATTGAGATGGGGCCGGG + Intergenic
1009938106 6:70257352-70257374 TAAAACATACAGACTGGGCTGGG - Intronic
1010161212 6:72858572-72858594 GAAAATATAAATATGAGGGTTGG - Intronic
1011106679 6:83789327-83789349 GAAGGAATACAGATGGGACTAGG + Intergenic
1012009120 6:93757596-93757618 GAAAATATCCAAATTTGGCTGGG + Intergenic
1012142845 6:95644767-95644789 GACAACATACTGATGGGCCTTGG - Intergenic
1012278779 6:97303944-97303966 GAAAATATACAAAGTGGGCCTGG - Intergenic
1012682268 6:102196999-102197021 GAAATTTTACAGCTGGGCCTTGG + Intergenic
1012849502 6:104429868-104429890 GAAAAGAGAGAGATGGGGCCAGG + Intergenic
1013502522 6:110766837-110766859 GAAAATAAACAAATAAGGCTGGG + Intronic
1013503614 6:110776632-110776654 GAGAAGATACAGCTGAGGCTGGG - Intronic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1014172263 6:118291820-118291842 TAAAAAATACTGATGTGGCTGGG + Intronic
1015012730 6:128371658-128371680 GAAAAGATAAAGATGGTGATTGG - Intronic
1015559442 6:134498590-134498612 GAAAAAATAAAGAAGAGGCTGGG + Intergenic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1015940185 6:138441982-138442004 GACAACATACAGAAGGAGCTAGG - Intronic
1015993110 6:138969156-138969178 GAAAATATACACTTGGCCCTGGG + Intronic
1016569373 6:145495409-145495431 GACAACATACTGATGGGTCTTGG + Intergenic
1016847742 6:148585820-148585842 GACAACATACTGATGGGTCTTGG + Intergenic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1019036079 6:169060426-169060448 GAAAATATATAGTAGAGGCTGGG - Intergenic
1020123475 7:5518977-5518999 GAAAATAAACAGGTCAGGCTGGG - Intergenic
1020890743 7:13875254-13875276 GAAAATATACACAAAGGGATTGG - Intergenic
1021066447 7:16180277-16180299 GCTAATATACAGATAGGGCCGGG + Intronic
1021109621 7:16678799-16678821 GAAATTTTACAGCTGGGTCTCGG + Intronic
1021478875 7:21093779-21093801 GAGAATGTACAGGTTGGGCTGGG + Intergenic
1021538453 7:21730846-21730868 AAAAATAAGCACATGGGGCTGGG + Intronic
1021916771 7:25441995-25442017 GACAGCATACAGATGGGTCTTGG + Intergenic
1022157578 7:27675712-27675734 GAAAAGTCACAGTTGGGGCTGGG - Intergenic
1022799693 7:33764328-33764350 GAAAATATAAAAGTGGGGCCAGG + Intergenic
1023087464 7:36585763-36585785 GAAAATACACAGAAAGGGCCTGG + Intronic
1025063389 7:55830636-55830658 AACAATATACAGTTGGGGCCTGG - Intronic
1025899020 7:65728973-65728995 AAAAATATACCAATAGGGCTGGG + Intergenic
1026069833 7:67108976-67108998 GAAAATATACTGATGAGGCCGGG + Intronic
1027671585 7:81105903-81105925 GAATGTGTACAGATGGGCCTAGG + Intergenic
1027725496 7:81800157-81800179 AAAAATATGCAGAGGGGGCTGGG - Intergenic
1027796953 7:82707602-82707624 GAAAATAGACTGATGGGCCTTGG + Intergenic
1028031793 7:85924508-85924530 GCAAAAATACAGTTGAGGCTAGG + Intergenic
1028093083 7:86727322-86727344 GAATATATATGAATGGGGCTGGG - Intronic
1028704036 7:93816974-93816996 TAAAATACACAGATAGGTCTGGG + Intronic
1028798325 7:94930633-94930655 AAAAGTATAAAGATAGGGCTGGG - Intronic
1029342183 7:99954266-99954288 GAAAATACTAATATGGGGCTAGG - Intergenic
1029909241 7:104126682-104126704 GAAAATATTCTGATTGGTCTGGG - Exonic
1031085635 7:117299163-117299185 CATAATATAAAGATGGGGGTGGG - Intronic
1031096927 7:117431475-117431497 GACAGTATACTGATGGGTCTTGG + Intergenic
1032038888 7:128541792-128541814 GAAAATATACAGACTGGGCATGG - Intergenic
1032038899 7:128541926-128541948 GAAAATATACAGCCTGGGCATGG - Intergenic
1033455365 7:141498281-141498303 GAAAATATTCTGATGGGGGAAGG - Intergenic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1034628195 7:152510314-152510336 TTAAAAATAGAGATGGGGCTGGG + Intergenic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1038479978 8:27895151-27895173 AGAAATAAACACATGGGGCTGGG + Intronic
1038580480 8:28744497-28744519 AAAAATATACAAATTAGGCTGGG + Intronic
1038695285 8:29801007-29801029 GAAAATGTAAAATTGGGGCTGGG - Intergenic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1038783293 8:30587575-30587597 GAAGATATACAAATGAGGCCAGG + Intronic
1039633212 8:39134858-39134880 AAAAAGATAAAGATGGGGCCTGG + Intronic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1040511332 8:48098917-48098939 GAAAATACACAGAGAAGGCTGGG - Intergenic
1040530951 8:48265884-48265906 AAGAATATGCAGAAGGGGCTGGG - Intergenic
1040601007 8:48883803-48883825 GAAAATACAGAGTTGGGGGTGGG + Intergenic
1041327136 8:56679959-56679981 AAATATATACAGAAGGGGCCAGG - Intergenic
1042029978 8:64465245-64465267 GAAAATATTCATATGGCTCTAGG - Intergenic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1042540463 8:69902689-69902711 AAAAATAAACAAATGGGGCTGGG - Intergenic
1042725404 8:71869927-71869949 GGAAATGTGCAGATGGGGTTTGG - Intronic
1042884264 8:73530667-73530689 GAAAATACAGAAATTGGGCTTGG + Intronic
1043324784 8:79036136-79036158 GACAGCATACAGATGGGTCTTGG - Intergenic
1043439576 8:80265473-80265495 GAAAAGAAAAAGATGTGGCTGGG - Intergenic
1044650538 8:94489850-94489872 TATCATATACAGAGGGGGCTAGG - Intronic
1044835986 8:96296431-96296453 GAAAAAGAACACATGGGGCTGGG - Intronic
1045270168 8:100654715-100654737 GAAAAAGTAAAGATGGGGCCGGG + Intronic
1045526587 8:102945657-102945679 GAAAATAGACATAAGAGGCTGGG + Intronic
1045713519 8:105014565-105014587 AAAAATATAAAGTTGGGGCCGGG - Intronic
1045961343 8:107972439-107972461 TAAAATATACAAAATGGGCTGGG - Intronic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1047609045 8:126503100-126503122 GTAAATATTCAGAGGGGGCCTGG + Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1049520256 8:143084486-143084508 AAAAATCGACAGATTGGGCTTGG - Intergenic
1049582110 8:143417532-143417554 GAAAATAGACAGGGGAGGCTGGG + Intergenic
1050026762 9:1342872-1342894 GAAAATATTAAGATAAGGCTAGG - Intergenic
1050579647 9:7039093-7039115 GAAAATATACTGATGAAGTTAGG - Intronic
1050609404 9:7336066-7336088 AAAGATATCCAGATGAGGCTTGG + Intergenic
1051418039 9:16863206-16863228 GAATATATTGAGATGGGGCAGGG - Intronic
1052477994 9:28985866-28985888 GAAAATAGACAAATGGGATTAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055067830 9:72136678-72136700 TAAAATATACATATGAGGCTGGG + Intronic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056128777 9:83563760-83563782 AAAAAAATAATGATGGGGCTGGG + Intergenic
1056177715 9:84051521-84051543 GAACATATACAGACTGGGCCGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058396021 9:104555485-104555507 CAAAATAGACAAATGGGGCTAGG + Intergenic
1059309609 9:113378985-113379007 GAATCTACACAGATGGGTCTTGG + Intergenic
1059583698 9:115581934-115581956 GAAAATAAAGGGAAGGGGCTGGG - Intergenic
1059650222 9:116309369-116309391 GAAAATATGCACATCTGGCTGGG - Intronic
1059784631 9:117567594-117567616 AACAATATACATATGAGGCTGGG - Intergenic
1060233008 9:121839500-121839522 GAAAACAGACATAAGGGGCTGGG + Intronic
1060285013 9:122243121-122243143 TAAAAAAATCAGATGGGGCTGGG - Intronic
1060675725 9:125512876-125512898 AAAAATATACATACGAGGCTGGG - Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1062654287 9:137594424-137594446 GAAAATAGAGAGGTGGGGCTGGG + Intergenic
1185887681 X:3797349-3797371 GAAAATATAAAGGAAGGGCTGGG + Intergenic
1186074810 X:5866606-5866628 GAAAAATTATAGATGTGGCTGGG + Intronic
1186801470 X:13096582-13096604 AAAAATATACAGAGGAGGCCGGG - Intergenic
1187535367 X:20137147-20137169 GAAATCCTACATATGGGGCTAGG + Intronic
1187865724 X:23721386-23721408 AAAAAAATAGAGATGGGGCTGGG - Intronic
1188840634 X:35012747-35012769 GAATCCATACAAATGGGGCTAGG - Intergenic
1190061001 X:47211676-47211698 AAAAATATGCAGATGGGGTGGGG - Intronic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1191832157 X:65427622-65427644 CAAAATAGAGGGATGGGGCTGGG - Intronic
1192102521 X:68279404-68279426 AAAAGTATACTGTTGGGGCTGGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192739618 X:73880414-73880436 TAAAATATACAGAGTGGGCCGGG + Intergenic
1192834068 X:74780670-74780692 GAAAATTTTAAGATGGGGCTAGG - Intronic
1194478707 X:94392791-94392813 GAAAATATATGGAGGAGGCTGGG - Intergenic
1195991777 X:110690341-110690363 GAATATATATATATGTGGCTGGG - Intronic
1196214002 X:113028689-113028711 GAAAACATACAAATGGGGCCAGG - Intergenic
1196434647 X:115663945-115663967 TAAAATATACACTTTGGGCTGGG + Intergenic
1196813395 X:119646076-119646098 GATAATATTCTGATTGGGCTTGG + Intronic
1197041425 X:121940213-121940235 GAAATTTTACAGCTGGGCCTCGG - Intergenic
1197268165 X:124397931-124397953 GAAAAGTCACAGTTGGGGCTGGG + Intronic
1197363350 X:125534199-125534221 GAAAATATAAAAATATGGCTGGG - Intergenic
1197752592 X:129975742-129975764 AAAATTGTACAGATGAGGCTGGG - Intergenic
1198186621 X:134259614-134259636 GGGAATATACACATGAGGCTGGG - Intergenic
1198223719 X:134626214-134626236 GAAAAAATACAGGTGGGGCATGG - Intronic
1198470865 X:136945604-136945626 GAAAATTTACAAATTGTGCTTGG + Intergenic
1199284769 X:146043525-146043547 GAAAATGTACATTTGAGGCTGGG - Intergenic
1199587400 X:149430694-149430716 GAAAATATTGAGATTGGCCTTGG + Intergenic
1202582682 Y:26398563-26398585 GAAAATATAATGAAGGGGCCGGG + Intergenic