ID: 1192477486

View in Genome Browser
Species Human (GRCh38)
Location X:71455570-71455592
Sequence AATTGACATAAAGCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192477486 Original CRISPR AATTGACATAAAGCAGGCCT GGG Intronic
901652964 1:10753582-10753604 ACTTCAGATAAAGCAGGCCAGGG + Intronic
903179664 1:21598758-21598780 CACTGACATAAATCAGGCATGGG + Intronic
904815449 1:33193326-33193348 AATTGACATAAAGTTTGTCTTGG + Intergenic
906850735 1:49247465-49247487 AATTGACAAAAGGCAAGTCTAGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907989678 1:59567510-59567532 ATTTGACATACAGCAGTCTTGGG + Intronic
908215681 1:61949306-61949328 TATAGAGAGAAAGCAGGCCTGGG + Intronic
912618827 1:111134893-111134915 AATTAACATAAAGTTGGCCCGGG - Intronic
912947471 1:114096929-114096951 ATTTGAGAAAAAGCAGGCCTGGG + Intronic
915815435 1:158960735-158960757 AATTGACATGAATCAGGACCAGG + Intronic
919636620 1:200009592-200009614 AAGTGAAATAAGGCAGGCATAGG - Intergenic
920030639 1:203035471-203035493 ATTGGACAAAAAGTAGGCCTTGG - Intronic
923936581 1:238767433-238767455 TTTTGAAATAAAGCAAGCCTTGG - Intergenic
1064181734 10:13122637-13122659 AATTGACACAGAGCAGGACAAGG - Intronic
1064419050 10:15174561-15174583 AAGTGAAATAAAGCAGGCACAGG - Intergenic
1065710260 10:28509398-28509420 AAATGAATTAAAGCAGGTCTGGG - Intergenic
1068028187 10:51674961-51674983 AATAAACATAAAGCCAGCCTTGG - Intronic
1068815729 10:61309498-61309520 AATTGAAATAAACCAGGCACAGG - Intergenic
1071157484 10:82707687-82707709 AAATAAAATAAATCAGGCCTGGG - Intronic
1073203678 10:101756729-101756751 AATTGAAATAAAGTATGGCTGGG + Intergenic
1073879600 10:107965505-107965527 AAGTGACTTAAAGCAGGGCTCGG + Intergenic
1074876779 10:117619780-117619802 ATTTGACATCCAGCACGCCTGGG - Intergenic
1078645781 11:13140495-13140517 AATTTACAGACAGGAGGCCTGGG - Intergenic
1079430417 11:20384458-20384480 ACTTGGCATACAGTAGGCCTTGG - Intergenic
1080195714 11:29606296-29606318 AACTGACATCAAGCAAACCTGGG - Intergenic
1080988830 11:37505726-37505748 AAATGACAGATAGCAGGCCCTGG + Intergenic
1081346323 11:41991526-41991548 AATAGACATAAAGGAGGCTAGGG - Intergenic
1081993937 11:47351927-47351949 AACTGAGATAAAGCTGGCCTGGG + Intronic
1083557454 11:63642215-63642237 AATTGCCATGAAACAGGCCAGGG + Intronic
1085249659 11:75134621-75134643 TATTAAGATAAAGCAGACCTGGG + Intronic
1085935158 11:81132927-81132949 AATTGACAGGCAACAGGCCTAGG - Intergenic
1086157082 11:83679130-83679152 AATTGGCATATAGCAGTGCTAGG - Intronic
1086284008 11:85224229-85224251 AATTGACAGAAATCAGGTGTAGG + Intronic
1086675690 11:89604456-89604478 AGATGACATAAAGCAGGCACTGG - Intergenic
1088104519 11:106191131-106191153 ACTAGACATAAACCTGGCCTTGG - Intergenic
1088323807 11:108581619-108581641 AATAAACATAAAGCAGGCAATGG + Intronic
1092071508 12:5635101-5635123 CATTGACTTAAAGAGGGCCTAGG + Intronic
1094809001 12:34119698-34119720 AATAGACAAGGAGCAGGCCTTGG - Intergenic
1097716487 12:62971808-62971830 AATTAATCTAAAGCAGGTCTTGG - Intergenic
1098730073 12:74024885-74024907 AAGATACAGAAAGCAGGCCTGGG - Intergenic
1099039185 12:77629834-77629856 AATTGGAACAAAGCAGGCTTGGG + Intergenic
1099289645 12:80761060-80761082 GATTGACAAAATGCAAGCCTCGG - Intergenic
1100870956 12:98909590-98909612 AATTGACTTTAAGCATTCCTGGG + Intronic
1101619685 12:106372973-106372995 AATTGACATAAAGCACCAATTGG - Intronic
1104537984 12:129636327-129636349 ACATGACAGATAGCAGGCCTTGG - Intronic
1105945391 13:25185439-25185461 AACTGAATTAAAGCAGCCCTGGG - Intergenic
1107351085 13:39515442-39515464 AATTGACATAAAGTGTGCCTGGG + Intronic
1107388167 13:39935358-39935380 AATAGAAAGAAAGGAGGCCTGGG + Intergenic
1108046637 13:46389618-46389640 AACTGCCATAAGGCAGGCCTAGG + Intronic
1112700498 13:102002103-102002125 AAGTGAAATAAAACATGCCTGGG + Intronic
1115903613 14:38182613-38182635 TATTGACATAATTCAAGCCTGGG + Intergenic
1119921796 14:78453415-78453437 AAATGGCATAAAGTAGACCTGGG - Intronic
1120416390 14:84223207-84223229 AATTGAAATAAAACAGGCATGGG - Intergenic
1120678632 14:87452277-87452299 AAATGACATAAAGTAGGCAGAGG + Intergenic
1121610754 14:95277258-95277280 CATAGATATAATGCAGGCCTAGG + Intronic
1121795486 14:96731877-96731899 CATTTACATAATACAGGCCTAGG + Intergenic
1125735777 15:41924608-41924630 AAGTGACAGAAAGCAGGCAGTGG + Intronic
1128866982 15:71121448-71121470 AATTTACCCAAAGCAAGCCTTGG - Intronic
1129300959 15:74625220-74625242 AATTCACAAAACGCAGGGCTGGG - Intronic
1130124710 15:81083628-81083650 GATTAGCAAAAAGCAGGCCTAGG - Intronic
1135157248 16:20063317-20063339 AATAGACACAGAGCAGGCCTTGG - Intronic
1135507881 16:23054742-23054764 CTTTGAAATAAAACAGGCCTAGG + Intergenic
1138492746 16:57385882-57385904 ATTTGAGATAGAGCAGGCTTGGG + Intergenic
1138492969 16:57387347-57387369 ATTTGAGATAGAGCAGGCTTGGG - Intergenic
1138779594 16:59767006-59767028 AAATGACATAAAGCAAGAGTAGG - Intergenic
1141587011 16:85040853-85040875 AATACACTTAAAGCAGTCCTTGG + Intronic
1147911057 17:43856557-43856579 AAGGGACAGAAAGCAGGCCCAGG - Intronic
1149361800 17:55902928-55902950 AATTGACATAAAGTAGACATCGG + Intergenic
1149710070 17:58733304-58733326 AAATGAGATAAAGCCGGGCTCGG - Intronic
1150127205 17:62645211-62645233 AATTTACATAAAGTAAGCCAGGG + Intronic
1156613217 18:38751879-38751901 AATTAAGATAAAGCAGTGCTGGG + Intergenic
1161853432 19:6750699-6750721 AATTCGCCTAAAGCAGGGCTGGG + Intronic
1163480364 19:17552060-17552082 AATTAAAATAAAGAAAGCCTTGG - Intronic
1163785889 19:19274753-19274775 TACAGACAGAAAGCAGGCCTGGG - Intergenic
1164535161 19:29080452-29080474 GATGGACATACAGCAGGCTTGGG - Intergenic
1168467458 19:56614911-56614933 CAGTGACATAAAGCAGACCAGGG - Intronic
925022405 2:582038-582060 AAATGACATAAAGGTGCCCTGGG + Intergenic
927479946 2:23445088-23445110 AAATGACATACAGCAGGTCCTGG - Intronic
929129455 2:38552671-38552693 AAATGGCATAGAGTAGGCCTTGG - Intergenic
929313828 2:40453771-40453793 AATAGACCTGGAGCAGGCCTGGG + Intronic
931761101 2:65417555-65417577 AATTGAGATAAAGGTGGCCCAGG - Intronic
932159877 2:69449815-69449837 AATTGACAACCAGCAGCCCTTGG - Intergenic
933764783 2:85699281-85699303 AATTGCAATAAAACAGGACTGGG - Intergenic
936699393 2:114992454-114992476 GACTGGCATAAAGCAGGACTTGG - Intronic
940654041 2:156466992-156467014 AATTGACATAAAGGTGACCCAGG + Intronic
943472836 2:188316418-188316440 AAGTGACATAATGCAGGACCTGG - Intronic
943776944 2:191775835-191775857 AATTTACCTAAAGCAAGCCTAGG - Intergenic
946098427 2:217296556-217296578 AATTGAACTAAACCTGGCCTGGG - Intronic
948580411 2:238983975-238983997 TATTGACAGCAAGCTGGCCTCGG + Intergenic
948967116 2:241391429-241391451 AATAGACATAAAGCAGTAATGGG + Intronic
1170282689 20:14668466-14668488 CATTCAAATAACGCAGGCCTAGG + Intronic
1170400359 20:15976596-15976618 CATTAACACACAGCAGGCCTGGG + Intronic
1174376924 20:50132405-50132427 AAAGGAGATAAAGTAGGCCTGGG - Intronic
1174618992 20:51859592-51859614 AATTGACATGAAGCTGGGCGCGG - Intergenic
1175138171 20:56840490-56840512 AGTTGGAATAAGGCAGGCCTGGG + Intergenic
1177162372 21:17561962-17561984 AATTGACATTTGGCAGGTCTAGG + Intronic
1183154905 22:36067153-36067175 AACTGACACAAAACAGACCTTGG - Intergenic
952242120 3:31542247-31542269 AATTGGCATAAAGAAGGCATTGG + Intronic
955021193 3:55122919-55122941 AATTGACATTAACAATGCCTGGG + Intergenic
955125253 3:56104910-56104932 AAATGTCATAGAGCAAGCCTGGG + Intronic
955826613 3:62953790-62953812 AATTGGCAGAAAGCAGGTTTTGG - Intergenic
959085492 3:101848030-101848052 AATTGACAGAAAGCAGAGCTGGG - Intronic
965430152 3:168576608-168576630 TATTGATATGAAGCAGGCGTTGG + Intergenic
965671827 3:171155646-171155668 AAGAGACACAAAGGAGGCCTTGG + Intronic
966599285 3:181759400-181759422 TAATGACAGAAAGCATGCCTCGG - Intergenic
969657550 4:8506957-8506979 AATTGTCATCAGACAGGCCTGGG + Intergenic
970936962 4:21583491-21583513 AATAGTCATAAAGAAGTCCTAGG + Intronic
972331694 4:38069830-38069852 AAATGAAAGAAAGCAGGCCGCGG - Intronic
973575995 4:52289892-52289914 AATGGACACAAAACAGACCTGGG + Intergenic
974446990 4:61997290-61997312 AATTGACATAAGGCTGTCCATGG - Intronic
979421116 4:120506394-120506416 AATTGAAATAAAGCATGGGTGGG + Intergenic
982861579 4:160457771-160457793 AAATGAAATAAAGAATGCCTTGG - Intergenic
985368121 4:189255290-189255312 CAGTGACATAGAGCAGGCTTTGG - Intergenic
986969162 5:13311785-13311807 AAACAACATAAAGCTGGCCTGGG + Intergenic
987820304 5:22957092-22957114 TATTGTCATAAAGCATCCCTGGG - Intergenic
989124366 5:38037206-38037228 AGTTGAAAAAAAGCAGACCTAGG + Intergenic
989819381 5:45776940-45776962 AACTGACATAGACCAGGACTTGG - Intergenic
990852205 5:60219097-60219119 ACTTGACAAAAAGCATGTCTAGG + Intronic
994560663 5:101366948-101366970 AATTAAGAAAAAGCAGGCATAGG + Intergenic
997837837 5:137210797-137210819 AACTGGCATAAAGCCGGACTAGG - Intronic
998656121 5:144181663-144181685 AAGTGACATAAAGCAGACATAGG + Intronic
999352549 5:150888552-150888574 ATTTGACATAAAACAATCCTTGG + Intronic
1003060620 6:2859811-2859833 AAGTGAAATAAACCAGGCCCAGG + Intergenic
1004014469 6:11719473-11719495 AATTGGTCTAAGGCAGGCCTGGG + Intronic
1008165855 6:48137388-48137410 AGTTGAAGTAAAGCAGACCTGGG - Intergenic
1008560733 6:52722249-52722271 TTTTGACATGAAGCAGGACTGGG + Intergenic
1011177635 6:84582736-84582758 GATTGACATAAAGCATGCATTGG + Intergenic
1013462690 6:110390335-110390357 TAATTTCATAAAGCAGGCCTGGG + Intergenic
1013934687 6:115579667-115579689 AATTAACATAAAGTTGGCCCGGG + Intergenic
1014952526 6:127573982-127574004 CTTTGACATCAGGCAGGCCTGGG + Intronic
1016830545 6:148429454-148429476 AATTTAAACAAACCAGGCCTAGG + Intronic
1021486431 7:21173336-21173358 AGGTGTCATAAAGCAGGCATCGG + Intergenic
1026032062 7:66802790-66802812 TATTGCCATAAGGCAGGGCTGGG - Intronic
1027579238 7:79972888-79972910 CATTTAAATAAAGCAAGCCTAGG + Intergenic
1028037751 7:86005936-86005958 AAGTGAAATAAACCAGGCATAGG + Intergenic
1028585293 7:92446471-92446493 AGTTGACAAACAGCAGGCCTGGG - Intergenic
1033470453 7:141642600-141642622 TATTGAAATAAAGCAGGCATTGG + Intronic
1033608143 7:142942390-142942412 AACTGACATAAAGCAAGCTGTGG + Intronic
1035057099 7:156042932-156042954 AATTCACAGAAAGAAGGCTTTGG - Intergenic
1046804159 8:118462121-118462143 ATTTGAAATAAAGGAGGCTTAGG - Intronic
1047667209 8:127105216-127105238 AAATGAAATAAGGCCGGCCTCGG + Intergenic
1050439331 9:5644250-5644272 AATGGACAAAAAGTAGGCCAAGG - Intronic
1050734950 9:8751599-8751621 AATTGACTCACAGCAGGCCTTGG - Intronic
1050989862 9:12137034-12137056 ACATGACAGATAGCAGGCCTTGG + Intergenic
1051480595 9:17555981-17556003 AACTTATATAAAGCAGACCTTGG + Intergenic
1055013799 9:71594550-71594572 AAATGACAAACAGCAGGCCCCGG + Intergenic
1055576983 9:77670441-77670463 AATTGACATATTGCAGTTCTAGG - Intergenic
1057715289 9:97489458-97489480 AATTGAAAGAAAGCAGGAGTAGG - Intronic
1058625826 9:106931916-106931938 AGTTGACATAAAGTTGGGCTAGG - Intronic
1058656894 9:107230681-107230703 AATTGACATAAAGAAGGGCGTGG - Intergenic
1188404979 X:29796882-29796904 AATTGACATAGCCCAGGCTTAGG + Intronic
1192477486 X:71455570-71455592 AATTGACATAAAGCAGGCCTGGG + Intronic
1193901167 X:87179262-87179284 AATTCAGATACAGCATGCCTGGG + Intergenic
1193971568 X:88061699-88061721 AAGTGACATAAAACAGGCAGTGG + Intergenic
1194348381 X:92794251-92794273 AAGTGACATAAAGCTGGCGATGG - Intergenic
1196541162 X:116909879-116909901 AGTTGAAATAAGGCAGGCCAAGG + Intergenic
1196671361 X:118371181-118371203 AAGTGAAATAAACCAGGCATAGG + Intronic
1196867309 X:120081851-120081873 GATAGACAAGAAGCAGGCCTTGG - Intergenic
1196875790 X:120154431-120154453 GATAGACAAGAAGCAGGCCTTGG + Intergenic
1198738267 X:139811713-139811735 ATTTGAATTAAAGCAAGCCTAGG - Intronic
1200656710 Y:5910879-5910901 AAGTGACATAAAGCTGGCGATGG - Intergenic