ID: 1192493549

View in Genome Browser
Species Human (GRCh38)
Location X:71597554-71597576
Sequence AGAGGGCCACAGATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493549_1192493553 -4 Left 1192493549 X:71597554-71597576 CCTCTCTCCATCTGTGGCCCTCT 0: 1
1: 0
2: 1
3: 74
4: 611
Right 1192493553 X:71597573-71597595 CTCTACCCTTCTCAGACAACTGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493549 Original CRISPR AGAGGGCCACAGATGGAGAG AGG (reversed) Intronic
900212030 1:1460896-1460918 AGCCGGCCACAGAAGGAAAGCGG + Exonic
900793106 1:4692313-4692335 AGGGGCCCAGAGACGGAGAGAGG - Intronic
900860427 1:5225233-5225255 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
901770458 1:11527731-11527753 AAAGGGCCTGAGATGGAAAGGGG - Intronic
902671574 1:17978186-17978208 AGAGGACCAGAGAGGGACAGTGG + Intergenic
902797831 1:18810692-18810714 AGAGGCTCAGAGATGGAGAGGGG + Intergenic
903178197 1:21592841-21592863 AGAGAGCCACAGCTGCAGAGAGG + Intergenic
903576936 1:24345075-24345097 GGAGGGGCACAGGTGTAGAGGGG - Intronic
903580675 1:24368259-24368281 AGGGGACCACAGTTAGAGAGAGG - Intronic
903640269 1:24854767-24854789 AGAGGGCATCACATGGTGAGAGG - Intergenic
903800899 1:25967466-25967488 AGAGGCCCAAACATGGAGATAGG + Intronic
903998158 1:27321400-27321422 AGAGGGCCACAGAATGAAAAGGG + Intergenic
904079620 1:27863767-27863789 AGAGGGCATCACATGGTGAGAGG - Intergenic
904360930 1:29971327-29971349 AAAGGGTCAGAGAGGGAGAGAGG - Intergenic
904478313 1:30778333-30778355 AGAGGCACACAGCTGGTGAGTGG - Intergenic
905275730 1:36816772-36816794 AGAGGGAGACAGATGAAGAGAGG - Intronic
905518291 1:38578288-38578310 GGAGAGATACAGATGGAGAGAGG + Intergenic
906370647 1:45250519-45250541 AGAGAGAGACAGAGGGAGAGAGG + Intronic
906452038 1:45958549-45958571 AGAGGGAGAGAGAGGGAGAGGGG - Intronic
906558882 1:46739056-46739078 AGAGGGAGAGAGATGGAGGGTGG + Intergenic
906747982 1:48234899-48234921 AGAAGGCCCCAGAGGGAGATGGG + Intronic
907471696 1:54678535-54678557 AGAGGGCTATTGATGGAAAGGGG + Intronic
908457977 1:64322516-64322538 AAAAGACCAGAGATGGAGAGGGG + Intergenic
910839722 1:91549267-91549289 GGAGGGCCTCAGATGTAGGGTGG - Intergenic
910921749 1:92356080-92356102 AAAGGCCCACAGTTGGAGTGAGG - Intronic
912067452 1:105761933-105761955 AGAGGGGGAGAGATTGAGAGGGG - Intergenic
912067456 1:105761949-105761971 AGAGGGAGAGAGATTGAGAGGGG - Intergenic
912159874 1:106968653-106968675 AGAGGGGCACAGAGAGAGGGAGG - Intergenic
912449616 1:109761031-109761053 AGAGGGCCACTGTTGGAGAGGGG - Intronic
912670476 1:111619958-111619980 AGACGGCCCCAGAGGGAGCGGGG + Intronic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
912687631 1:111779606-111779628 AGGGTGCCACAGCTGGAGTGTGG - Intronic
913996982 1:143659486-143659508 AGAAGGAGACAGAGGGAGAGAGG + Intergenic
914349792 1:146831249-146831271 AGAGGGCCAGGGATGGGAAGGGG - Intergenic
914505271 1:148283282-148283304 AGAAGGAGACAGAGGGAGAGAGG - Intergenic
914507294 1:148300865-148300887 AGAAGGAGACAGAGGGAGAGAGG + Intergenic
914747008 1:150508454-150508476 GCAGGGGCACAGAAGGAGAGGGG + Intronic
914990350 1:152494612-152494634 AGGGGGACAAAGATGGAGATGGG - Intergenic
915335795 1:155140442-155140464 GGAGGGCGAGAGATGGGGAGTGG - Intronic
915559989 1:156681522-156681544 AGAGGGGCACAGGAGGAGACAGG + Intergenic
916867478 1:168876037-168876059 GGAGGGTCACACTTGGAGAGTGG - Intergenic
917083532 1:171281883-171281905 AGAGAGCCCCAGAATGAGAGAGG + Intronic
917646396 1:177032858-177032880 AGAGGACCACAGATGGATGTGGG + Intronic
917789942 1:178493128-178493150 AGAGGTGCAGAGCTGGAGAGAGG + Intergenic
918003829 1:180523516-180523538 AGAGGTCCTCAGATGGACAATGG - Intergenic
919064773 1:192680162-192680184 AGAGAGACAGGGATGGAGAGAGG - Intergenic
919308860 1:195879146-195879168 AGATGGTCCCAGATGGAGATGGG - Intergenic
919434190 1:197536069-197536091 AAAGGGACAGAGAGGGAGAGAGG + Intronic
920038164 1:203078943-203078965 AGAGGACCAGATAAGGAGAGAGG + Intergenic
920201638 1:204263212-204263234 ACAGGGCCATTGATGGGGAGTGG + Intronic
920445083 1:206010272-206010294 AGAGGGGCCCAGCTGGAGGGTGG + Exonic
920856158 1:209663926-209663948 AGGAGGGCACAGATGGACAGAGG + Intergenic
920966037 1:210701420-210701442 TGAGGCCCAGAGAGGGAGAGTGG + Intronic
921345851 1:214184489-214184511 ACAGGACCACAGATGAAGACAGG + Intergenic
923249007 1:232162143-232162165 AGAGGGAGACAGAGAGAGAGGGG + Intergenic
923273955 1:232380520-232380542 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
923558780 1:235022659-235022681 AGCTGGCCACAGAGAGAGAGAGG + Intergenic
923800210 1:237201733-237201755 AGAGAGCCACAGGAGGAGTGAGG - Intronic
1062960416 10:1569173-1569195 AGAGGGACAGAGAGAGAGAGAGG + Intronic
1063791115 10:9449339-9449361 AGAGGGCCACACTTGGGCAGTGG - Intergenic
1064899970 10:20284975-20284997 AGATGGCCACAGATGGGGGCAGG - Exonic
1065219262 10:23479435-23479457 AGAGGGACAAAAATGCAGAGAGG - Intergenic
1065294028 10:24257953-24257975 AGATGGCCACAGAAGCAGAGAGG + Intronic
1065917647 10:30366301-30366323 AGAGAGCCCCAGAAGGAAAGGGG - Intronic
1067251624 10:44591607-44591629 ACAAGGCCACAGATGCAGAAAGG - Intergenic
1067711494 10:48654717-48654739 AGAGAGAGACAGAGGGAGAGGGG + Intronic
1068854570 10:61784381-61784403 AGAGAGACATAAATGGAGAGGGG - Intergenic
1069304152 10:66947523-66947545 AGAGGGAGACAGAGTGAGAGAGG - Intronic
1069342909 10:67433236-67433258 AGAGAGACACAGATGGGGAAAGG + Intronic
1069580050 10:69559662-69559684 AGAAGGCCAGGGATGGAGTGAGG + Intergenic
1070036642 10:72731624-72731646 TGATGGCCACAGGTGTAGAGGGG - Intronic
1070851161 10:79562552-79562574 AGAAGGGCACTGAAGGAGAGCGG - Intergenic
1071087153 10:81876517-81876539 AGAGGGCCAGGGAGGGAGAGAGG + Intronic
1072544245 10:96422367-96422389 AGGAAGCCACAGATGGACAGTGG + Intronic
1073173556 10:101534544-101534566 AGAGGGCCAGACTGGGAGAGTGG - Intronic
1074614516 10:115053926-115053948 AGATGCCCAGTGATGGAGAGTGG + Intergenic
1074622797 10:115143717-115143739 AGAGAGCCAGAGAGAGAGAGAGG + Intronic
1074917326 10:117970101-117970123 AGAGGGGCACAGGAGGTGAGAGG + Intergenic
1075847337 10:125555364-125555386 AAAGGCCCCCAGGTGGAGAGGGG - Intergenic
1076163443 10:128263518-128263540 AGAGGGACAGAGGAGGAGAGGGG - Intergenic
1076738279 10:132468357-132468379 AGAGGGCAAGGGAGGGAGAGAGG + Intergenic
1076948220 10:133665726-133665748 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076949209 10:133669036-133669058 AGGCGGGCAGAGATGGAGAGAGG + Intronic
1076950193 10:133672335-133672357 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076951178 10:133675634-133675656 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076952168 10:133678944-133678966 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076953156 10:133682254-133682276 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076955124 10:133741905-133741927 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076956114 10:133745215-133745237 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076957102 10:133748524-133748546 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076958091 10:133751834-133751856 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076959075 10:133755133-133755155 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1076960064 10:133758443-133758465 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
1077402733 11:2367147-2367169 AGGGAGCCCCAGCTGGAGAGGGG - Intergenic
1077402753 11:2367219-2367241 AGGGAGCCCCAGCTGGAGAGGGG - Intergenic
1077440024 11:2563940-2563962 AGATGACCACAGCTGGAGTGCGG + Intronic
1078117827 11:8472483-8472505 AGAGGGAGAGAGATGAAGAGTGG + Intronic
1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG + Intronic
1078930834 11:15910982-15911004 AGAGAGCCAAAGAGGAAGAGGGG - Intergenic
1079109011 11:17593639-17593661 GGAGGTCCACACATGGCGAGTGG + Exonic
1079143503 11:17830569-17830591 AGAGGGAGAGAGATGGGGAGAGG + Intronic
1079209642 11:18449783-18449805 AGAGCCCCAGAGATGGTGAGAGG + Intronic
1079723023 11:23843348-23843370 AGAGGGAAAGAGAGGGAGAGAGG + Intergenic
1080332198 11:31152713-31152735 GGATGGCCACAGGTGCAGAGTGG - Intronic
1080800131 11:35602775-35602797 GGAGGGCCACAGACCCAGAGGGG - Intergenic
1081120129 11:39256021-39256043 AGGTGGTCTCAGATGGAGAGAGG - Intergenic
1081615033 11:44585736-44585758 ACAGGGCCACAGGTAGAGAAAGG + Intronic
1081742422 11:45449888-45449910 AGAGGGGCCAAGATGGAGGGTGG - Intergenic
1083595846 11:63917930-63917952 AGAGCGGCACAGACGGAGATGGG + Intergenic
1083624499 11:64065208-64065230 AGAGGCCCAGAGATGAAGAGCGG + Intronic
1083659044 11:64243731-64243753 AGAAGGCCAGAAATGGAGAAGGG - Intronic
1083681841 11:64354981-64355003 AGAGGGCCAGAGGAGGGGAGAGG - Intronic
1084364277 11:68687468-68687490 AGAGGGTCACAGAGGGAGACAGG - Intronic
1084461365 11:69298411-69298433 CGAGGGCCCCAGATGGGGTGTGG + Intronic
1085056390 11:73406540-73406562 AGAGGGGGACAGTTGGGGAGAGG + Exonic
1085520670 11:77137422-77137444 AGAGAGCCACAAATGCAGACTGG + Intronic
1088209841 11:107442833-107442855 AGAGGGACAGAGAGGGAGGGAGG + Intronic
1088376789 11:109149726-109149748 AGAGGACCCCTGATGGAGAAGGG + Intergenic
1088392714 11:109332756-109332778 AGAGACCCAAAGATGGATAGTGG - Intergenic
1088988560 11:114930442-114930464 AGAGGGAGAAAGAGGGAGAGAGG + Intergenic
1089982683 11:122785411-122785433 AGATGTCCAGAGAAGGAGAGTGG + Intronic
1090425351 11:126603485-126603507 GGAGGGCCACAGAAGGGGAGAGG + Intronic
1090550773 11:127817474-127817496 AGAGGGCAAGAGAGGGAAAGGGG - Intergenic
1090970045 11:131633620-131633642 AGAGAGGCAGAGATAGAGAGAGG - Intronic
1091274538 11:134341778-134341800 AGATGGCCAGAGACGGGGAGGGG - Intronic
1091563421 12:1630762-1630784 AGAAGGGCGCAGATGGAGAGGGG + Intronic
1091690946 12:2597073-2597095 ACAGGGACACAGATGGACATGGG - Intronic
1091843932 12:3640759-3640781 AGATGGCCACAGAGAGATAGAGG - Intronic
1092238721 12:6824908-6824930 TGGGGGCCACAAATGGAGTGGGG - Intronic
1092662748 12:10756184-10756206 AGATGGTCTCAGATGGAGATGGG - Intergenic
1094371040 12:29737740-29737762 AGCAGGACACAGCTGGAGAGTGG - Intronic
1094745624 12:33341351-33341373 AGTGTGGCACAGAAGGAGAGAGG - Intergenic
1095710290 12:45281003-45281025 GGAGGATCACTGATGGAGAGAGG - Intronic
1096217816 12:49808276-49808298 AGAGTGCCCCAGCTGGAGTGGGG + Intronic
1096749439 12:53749364-53749386 AGAGGGGCACGGAGAGAGAGGGG + Intergenic
1096785929 12:54017372-54017394 AGAGAGGCAGAGAGGGAGAGAGG + Intronic
1097492470 12:60287383-60287405 TGAGGGCCAAAGATGAAGAGAGG + Intergenic
1098174353 12:67775411-67775433 AGAATGTCACAGGTGGAGAGGGG + Intergenic
1098958707 12:76715407-76715429 AGAGAGAAACAGAGGGAGAGAGG + Intergenic
1099004636 12:77221685-77221707 ACAGGGCTAGAGCTGGAGAGAGG - Intergenic
1100569849 12:95837382-95837404 AGAGAGGGAAAGATGGAGAGAGG + Intergenic
1101212784 12:102551374-102551396 CGATGGCCACATATGCAGAGAGG - Intergenic
1101508648 12:105372777-105372799 AGAGGACCACAGAGGTAAAGTGG + Intronic
1101599012 12:106192377-106192399 AGAGGGCCCCAGATTCAGACCGG + Intergenic
1101671715 12:106881538-106881560 AGAGGGACACAGGAGGAGACAGG - Intronic
1101984310 12:109433701-109433723 AGGAGTCTACAGATGGAGAGAGG - Intronic
1102238571 12:111309784-111309806 AGAGGGACAGAGAGAGAGAGAGG - Intronic
1102598634 12:114012581-114012603 AGAGGGAGACAGAGAGAGAGGGG + Intergenic
1102991832 12:117321539-117321561 GCAGGGACACAGATGGGGAGAGG + Intronic
1102992194 12:117323048-117323070 GCAGGGGCACAGATGGAGAGAGG - Intronic
1103130996 12:118468550-118468572 AGAGGGCATCACATGGTGAGAGG + Intergenic
1103204792 12:119120160-119120182 AGAGAGAGAGAGATGGAGAGAGG - Intronic
1104502401 12:129298791-129298813 AGAGAGCCAAAGAAGGAGAATGG + Intronic
1104514105 12:129407920-129407942 AAATGACCACAGATGGACAGTGG + Intronic
1104664579 12:130638658-130638680 AGAAGACAACAGATGGGGAGGGG - Intronic
1104702490 12:130917849-130917871 AGAGAGCCACAGGTGGGGTGGGG + Intergenic
1104821714 12:131681038-131681060 AGAGAGCCAGAGAAAGAGAGAGG + Intergenic
1104947486 12:132422778-132422800 AGAGAGAAGCAGATGGAGAGAGG - Intergenic
1104947499 12:132423019-132423041 AGACAGAAACAGATGGAGAGAGG - Intergenic
1104987954 12:132607736-132607758 AGAGAGACAGAGACGGAGAGAGG - Intronic
1104987967 12:132607906-132607928 AGAGAGAGACAGACGGAGAGAGG - Intronic
1105644888 13:22306514-22306536 AGATGGCCACAGGTAGAGATTGG - Intergenic
1105683293 13:22752034-22752056 AGAGGGTGGCAGCTGGAGAGAGG - Intergenic
1106370560 13:29128403-29128425 AGAGGGACTCAGATGGCGACAGG + Intronic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1107862407 13:44673426-44673448 AGAGGGCCACAGTTGGTTTGGGG + Intergenic
1108168902 13:47721284-47721306 AGAGGGTCACAAGGGGAGAGTGG - Intergenic
1110299900 13:73914251-73914273 AGTGAGCCACATAGGGAGAGTGG - Intronic
1110666626 13:78124954-78124976 ACAGGGACACACATGAAGAGTGG + Intergenic
1112186443 13:97132459-97132481 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1112380257 13:98882278-98882300 AGAGGGAGACAGAAGGGGAGAGG + Intronic
1112429213 13:99335700-99335722 AGAGGGGAACAGCTGCAGAGTGG - Intronic
1113396900 13:109956222-109956244 AGAGGGCATCAAATGGAGAGAGG + Intergenic
1113939963 13:114013611-114013633 AGAGAGAGACAGATGGAGGGGGG - Intronic
1114057391 14:18984123-18984145 AAAGGGCTAAAGATGGAGAGTGG - Intronic
1114105155 14:19417624-19417646 AAAGGGCTAAAGATGGAGAGTGG + Intronic
1114476361 14:22997990-22998012 AGAGAGGCAGAGGTGGAGAGAGG - Intronic
1114657607 14:24325484-24325506 AGAGGGCCAGAGGTGGAGACAGG + Intronic
1115640803 14:35334502-35334524 GGGGTGGCACAGATGGAGAGAGG + Intergenic
1115655996 14:35444346-35444368 GGAGGGCAACACATGGTGAGAGG + Intergenic
1116786895 14:49297612-49297634 AGATGGTCACACACGGAGAGCGG - Intergenic
1116814143 14:49568072-49568094 AGAAGGGTAGAGATGGAGAGAGG - Intergenic
1117245394 14:53879816-53879838 AGAGGGGCACATAGGGAAAGGGG + Intergenic
1117308379 14:54498315-54498337 AGGGTGCCAGAGAGGGAGAGAGG + Intergenic
1118628627 14:67682005-67682027 AGAGGGCATCACATGGTGAGAGG - Intronic
1119334776 14:73823752-73823774 AATGGGCCACAGATGCAGAAAGG - Intergenic
1120272970 14:82337581-82337603 AGAGAGACACAGAGAGAGAGAGG - Intergenic
1121592295 14:95125515-95125537 AGAGAGGCAGAGAGGGAGAGAGG + Intronic
1125501996 15:40245707-40245729 AGAGGTCCAGAGAAGGAAAGTGG + Intronic
1126066133 15:44827671-44827693 AGAGGGCCCCAGCAGGGGAGAGG + Intergenic
1126093703 15:45072893-45072915 AGAGGGCCCCAGCAGGGGAGAGG - Intronic
1127043714 15:55004090-55004112 AGAGGATCACAGAAGGAAAGTGG + Intergenic
1127628199 15:60800894-60800916 AGAGGGTCACAGAGGGACAGAGG - Intronic
1127865534 15:63029572-63029594 ACAGGGCCAGAGATGGAGGCGGG - Intergenic
1128087424 15:64895716-64895738 AGAGGGACAAAGAAGAAGAGAGG - Intronic
1128331313 15:66757463-66757485 AGAGGCCCAGAGATGGTGTGGGG + Intronic
1128533939 15:68475750-68475772 AGAGAGACAGAGATGGAGAGAGG - Intergenic
1128582800 15:68820741-68820763 AGAGCGCGAGAGATGGAGATGGG - Exonic
1128606867 15:69043026-69043048 AGAGAGCAACAGAAAGAGAGTGG + Intronic
1128621528 15:69154881-69154903 AGAAGGAAGCAGATGGAGAGAGG - Intergenic
1129049398 15:72766867-72766889 AGAGGGACAAAGATAGAGATGGG + Intronic
1129379012 15:75153929-75153951 AGAGGGACACTGATGGATGGGGG + Intergenic
1129518481 15:76171117-76171139 AGAGGGTCATTGATGGTGAGTGG + Exonic
1129707949 15:77805363-77805385 TGAGGCCCAGAGATGGAGGGTGG - Intronic
1129781033 15:78271370-78271392 GGAGGGCCACAAAGGGAGGGTGG - Intronic
1130196244 15:81782683-81782705 GGAGGGACACAGAAGGTGAGTGG + Intergenic
1130734889 15:86537556-86537578 GGCTGGCCAGAGATGGAGAGTGG + Intronic
1131793547 15:95990495-95990517 AGAGGGCCAGAGAGGCAGAAAGG + Intergenic
1132086421 15:98911891-98911913 AGAGGGCCACAGCTTGGGAGAGG - Intronic
1132092376 15:98956910-98956932 AGAAAGCCAGGGATGGAGAGGGG + Intronic
1132116713 15:99142259-99142281 AAAGGGCCACAGAGCAAGAGAGG + Intronic
1132156019 15:99495633-99495655 ACAGGGACAGAGATGGAGAGGGG + Intergenic
1132690155 16:1178496-1178518 AGGAGGACACAGATGCAGAGGGG + Intronic
1132875828 16:2136443-2136465 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1133231548 16:4369374-4369396 AGAGGGCCAGAGGTGGTAAGAGG + Intronic
1133431010 16:5736727-5736749 AGACACACACAGATGGAGAGAGG - Intergenic
1134134320 16:11669109-11669131 AGGGGGCGACAGCTGGAGAGGGG - Intronic
1134212422 16:12288920-12288942 AGAAGGCCACAGAGGGCGATGGG - Intronic
1134214187 16:12303621-12303643 AGAGGGCCAGCATTGGAGAGAGG + Intronic
1134519154 16:14910890-14910912 AGAGAGAGACAGAGGGAGAGAGG - Intronic
1134554773 16:15155336-15155358 AGAGAGAGACAGAAGGAGAGAGG + Intergenic
1134706824 16:16309545-16309567 AGAGAGAGACAGAGGGAGAGAGG - Intergenic
1134782082 16:16907343-16907365 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1134782094 16:16907405-16907427 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1134782099 16:16907433-16907455 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1134960716 16:18402579-18402601 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1135595001 16:23735076-23735098 AGGAGGCCACGGATGGAAAGGGG - Intergenic
1135630699 16:24033911-24033933 AGAGAGACACAGTTGGAGAAAGG + Intronic
1135912833 16:26577115-26577137 AAAGGGCTACGGGTGGAGAGTGG - Intergenic
1135932130 16:26747334-26747356 AGAGGGACAGAGAGAGAGAGAGG - Intergenic
1136042701 16:27593076-27593098 AGAAGGACACAGAAGCAGAGAGG - Intronic
1136474374 16:30503462-30503484 AGAGGGGGACAGAAGGAGGGAGG + Intronic
1136573373 16:31109494-31109516 TGAGGGCTAGAGAGGGAGAGAGG - Exonic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1137578548 16:49620093-49620115 AGAGGGAGACAGACAGAGAGAGG - Intronic
1137717914 16:50610368-50610390 AGAGGACCACAGATGGTCACTGG - Intronic
1139984244 16:70884282-70884304 AGAGGGCCAGGGATGGGAAGGGG + Intronic
1140279771 16:73543903-73543925 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1141420531 16:83912449-83912471 TGAGGGACACAGATGAAGACAGG + Intronic
1141426978 16:83951101-83951123 AGAGGGCGAGAGAGAGAGAGAGG - Intronic
1141526748 16:84616894-84616916 AGATAGCCACTGATGGGGAGGGG - Intronic
1141742643 16:85904242-85904264 TGGGGGCCAGAGATGGGGAGGGG + Intronic
1141927383 16:87178437-87178459 AGAGAGCTACAGAGGGAAAGTGG - Intronic
1142483219 17:231137-231159 GGAGGCCCAGAGATGCAGAGAGG - Intronic
1142683881 17:1565983-1566005 AGTGTGGCACAGCTGGAGAGTGG - Intergenic
1143442694 17:6987685-6987707 AGAAGGCCAGAGCTGGAGATGGG - Intronic
1143520521 17:7441759-7441781 AGTGGGCTGCAGGTGGAGAGAGG - Exonic
1143652236 17:8270497-8270519 TGGGGTCCACAGATGGTGAGGGG + Intergenic
1144641387 17:16939256-16939278 AGAGAGACAGAGAGGGAGAGAGG - Exonic
1144641390 17:16939280-16939302 AGAGAGGCAGAGAGGGAGAGAGG - Exonic
1144641393 17:16939296-16939318 AGAGAGGCAGAGAGGGAGAGAGG - Exonic
1144777327 17:17791450-17791472 AGAGGGGCACAGAGAGGGAGAGG - Intronic
1145030087 17:19498354-19498376 AGAGGGCGTCACATGGCGAGAGG - Intronic
1145034629 17:19532600-19532622 AGAGGGACAGAGATGGGAAGAGG + Intronic
1145066354 17:19764049-19764071 AGAGGGGCACAGATGGATTCAGG - Intergenic
1145769005 17:27479107-27479129 ACAGGAGCACAGAGGGAGAGAGG - Intronic
1145809257 17:27754950-27754972 AGAGGGGCACAGCTGGGGAGAGG + Intergenic
1146185978 17:30724522-30724544 TGAGGGACACAGATGGGGACAGG + Intergenic
1147139243 17:38452261-38452283 GGAGGGACAGAGATGGGGAGGGG - Intronic
1147166411 17:38595955-38595977 GGAGGGCCAGAAACGGAGAGGGG - Intronic
1147382528 17:40063825-40063847 GGAGGGCCCCAGATGGAGAAGGG - Intronic
1147674944 17:42198724-42198746 AGAGGCTCACAGTTGGAGAAAGG - Intergenic
1147859933 17:43513330-43513352 AGAGGGGCAAAGCTGGAGTGAGG - Intronic
1148202234 17:45756795-45756817 AGAGGGACAGGGATGGGGAGAGG + Intergenic
1148568390 17:48647085-48647107 AGAGAGGCAGAGAGGGAGAGAGG + Intergenic
1149523574 17:57337022-57337044 GGAGGGCCCCACATGGAGAGTGG - Intronic
1150203797 17:63384806-63384828 AGAGGGCCAAGGATGGAAAATGG + Intronic
1150464983 17:65385229-65385251 AAAGGGAGAGAGATGGAGAGAGG - Intergenic
1150466864 17:65400962-65400984 GGAGGGAGACAGATGAAGAGAGG - Intergenic
1151321303 17:73354301-73354323 AGAGAGCCACGGATAAAGAGGGG - Intronic
1152560377 17:81075698-81075720 AGAAGGGCACAGAGGGAGTGTGG - Intronic
1152650764 17:81491629-81491651 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1152650778 17:81491679-81491701 AGAGGGGGAAAGAGGGAGAGAGG - Intergenic
1152942298 17:83179012-83179034 AGAAGGCCACGGAGCGAGAGTGG + Intergenic
1156360159 18:36377807-36377829 AGAGGGGAACAGATGGCCAGGGG - Intronic
1156471877 18:37382316-37382338 AGAGAGGCAGAGAAGGAGAGTGG - Intronic
1156597632 18:38565817-38565839 AGAGGGAGAAAGAGGGAGAGAGG - Intergenic
1157016250 18:43718499-43718521 ACAGGGTCACACATGGCGAGGGG + Intergenic
1157046592 18:44107526-44107548 GGATGGCCACAGATGCAGGGAGG + Intergenic
1157392506 18:47314593-47314615 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1157542828 18:48524321-48524343 AGAGGGCTAGAGATGGGGTGGGG + Intergenic
1157619667 18:49008999-49009021 GAAGGGCCACAGAGGGAGACAGG + Intergenic
1157793515 18:50554870-50554892 TGAGGGCTACAGAGGAAGAGGGG + Intergenic
1157915995 18:51664385-51664407 AGAGGGCCAGGCATGCAGAGAGG - Intergenic
1159028346 18:63206991-63207013 AGAGGCTGACAGATGCAGAGAGG + Intronic
1159616599 18:70587415-70587437 AGAGAGACAGAGAGGGAGAGAGG - Intergenic
1159828900 18:73249385-73249407 AGAGGGCCACGTAAGGAGACAGG + Intronic
1160178974 18:76618263-76618285 AGAGGGTCATGGGTGGAGAGGGG + Intergenic
1160277204 18:77448099-77448121 AGATGCCCAGAGCTGGAGAGGGG + Intergenic
1160425090 18:78773819-78773841 TGAGGGGCAGGGATGGAGAGAGG + Intergenic
1160441972 18:78899922-78899944 CGAGGCCCACAGATGGAGACTGG - Intergenic
1160840490 19:1144682-1144704 AGAGGGCGACAGAGACAGAGAGG + Intronic
1160953392 19:1678440-1678462 AGAGAGACAGAGATGGAGAGAGG - Intergenic
1160953397 19:1678504-1678526 AGAGAGACAGAGATGGAGAGAGG - Intergenic
1160953421 19:1678730-1678752 AGAGGGCCAGAGACAGAGATAGG - Intergenic
1161771037 19:6230794-6230816 AGAGGCCCAGTGAGGGAGAGGGG - Intronic
1161774532 19:6252188-6252210 CTAAGGCCACAGAGGGAGAGAGG - Intronic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1162972800 19:14191209-14191231 TGAGGGACACAGATGGGGACAGG - Intronic
1163062139 19:14768446-14768468 AGAGGGGCACAGATGCTGATGGG + Intronic
1163561174 19:18020492-18020514 AGAGCGCCAGAGATGGGGTGGGG + Intergenic
1163783223 19:19261318-19261340 CGAGGGGCTCAGATGGGGAGTGG + Intronic
1164137514 19:22427879-22427901 CGGGGGCCACAGAAGGATAGGGG - Intronic
1164526326 19:29016119-29016141 AGAGGGAAAGAGAAGGAGAGAGG - Intergenic
1164526341 19:29016189-29016211 AGAGGGAGAAAGAGGGAGAGGGG - Intergenic
1164581588 19:29438581-29438603 AGAGAGACAGAGAGGGAGAGAGG + Intergenic
1164780022 19:30884606-30884628 TGAGGGCCGCACATGCAGAGGGG - Intergenic
1164837079 19:31363317-31363339 AGAGGACCACAAATGGCGAGTGG + Intergenic
1165395785 19:35562989-35563011 AGAGGGAGGGAGATGGAGAGAGG - Intronic
1165418991 19:35713466-35713488 AGAAGGCCTCAGCTGGAGAGAGG - Intronic
1166118459 19:40670086-40670108 AGAGGGCCACCGAGGGCGGGGGG - Intronic
1166880910 19:45929439-45929461 AGAGGGAGACAGAGGGACAGGGG + Intergenic
1167223430 19:48219128-48219150 AGTGGGAAACAGAGGGAGAGAGG + Intronic
1167229083 19:48270457-48270479 GGAGGGGCAGAGAGGGAGAGAGG + Intronic
1167463237 19:49637201-49637223 AGAGGGACAGAGACTGAGAGAGG - Intronic
1167609238 19:50498703-50498725 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609275 19:50498985-50499007 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609304 19:50499219-50499241 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609315 19:50499297-50499319 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609332 19:50499427-50499449 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609391 19:50499919-50499941 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609404 19:50500007-50500029 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609417 19:50500121-50500143 AGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167796651 19:51713746-51713768 AGGAGGCCACACATGTAGAGGGG + Exonic
1168221692 19:54965154-54965176 GGAGGACCACAGGTGGAGATCGG + Intronic
1168272410 19:55257595-55257617 AGGAGGTGACAGATGGAGAGTGG - Intronic
924962735 2:47826-47848 AGAGGGACAGAGATGGAGAAAGG + Intergenic
925070867 2:965570-965592 AGGGGGCCACAGAGGAGGAGGGG - Intronic
925237969 2:2295854-2295876 AGAGAGAGACAGAGGGAGAGAGG + Intronic
926217755 2:10915721-10915743 AGAGGGCCCCAGGTAGAGAGGGG + Intergenic
926742687 2:16125730-16125752 AGAGGGCCACAGATGGGGGAAGG - Intergenic
926751710 2:16203504-16203526 AGAAAGACAGAGATGGAGAGAGG - Intergenic
927275848 2:21261762-21261784 AGAGGGCCCCTGATGCAGACAGG + Intergenic
928651703 2:33410909-33410931 AGAGAGGGACAGAGGGAGAGAGG - Intergenic
928786694 2:34895594-34895616 AGAGGGACACAGAGAGAAAGTGG - Intergenic
929310573 2:40419541-40419563 ACAGGGGCAAAGATGGAGGGAGG - Intronic
931025408 2:58108616-58108638 AGACTTCCACAGATGGAGACAGG - Intronic
932083927 2:68740517-68740539 AGGGAGACCCAGATGGAGAGAGG - Intronic
932409436 2:71536499-71536521 AGAGCGGCACACATGGAGAGCGG - Intronic
934517678 2:94998871-94998893 AGAGAGGGACAGAGGGAGAGCGG + Intergenic
935093166 2:99916535-99916557 AGACTGGCAAAGATGGAGAGAGG + Intronic
935230767 2:101094047-101094069 AGAGGGCCTCTGCTGGGGAGGGG - Intronic
935641253 2:105292583-105292605 AGAGAGACACAGAGGGACAGTGG + Intronic
935729333 2:106052083-106052105 AAAGGGGCAGAGATGGAGATGGG - Intergenic
936780905 2:116030807-116030829 AGAGAGCCACAGACTGAAAGAGG - Intergenic
936835899 2:116708948-116708970 GGAGGACCACAGATGGACAGTGG + Intergenic
937025937 2:118697123-118697145 GGAGGGGCACAGATGGGGAAGGG + Intergenic
937376667 2:121341128-121341150 CTAGGGCCACAGAGGGAGGGAGG + Intronic
937773977 2:125753882-125753904 AGTGGGACACTGATTGAGAGAGG - Intergenic
938164564 2:129015430-129015452 CCAGGGACACTGATGGAGAGGGG + Intergenic
938283757 2:130089401-130089423 AAAGGGCTAAAGATGGAGAGTGG + Intronic
938284901 2:130103918-130103940 AAAGGCCTAAAGATGGAGAGTGG + Intronic
938307021 2:130263501-130263523 TGAAGGCCACTGATGGAGAAGGG - Intergenic
938334403 2:130477967-130477989 AAAGGGCTAAAGATGGAGAGTGG + Intronic
938335544 2:130492470-130492492 AAAGGCCTAAAGATGGAGAGTGG + Intronic
938354280 2:130628198-130628220 AAAGGCCTAAAGATGGAGAGTGG - Intronic
938355421 2:130642701-130642723 AAAGGGCTAAAGATGGAGAGTGG - Intronic
938430703 2:131234972-131234994 AAAGGCCTAAAGATGGAGAGTGG - Intronic
938431850 2:131249492-131249514 AAAGGGCTAAAGATGGAGAGTGG - Intronic
938475519 2:131608117-131608139 AAAGGGCTAAAGATGGAGAGTGG - Intergenic
938729263 2:134133684-134133706 AAAGGGCCACCGAATGAGAGGGG + Intronic
939308513 2:140440714-140440736 AGAGGGACAAGGATGGAGGGTGG - Intronic
940043540 2:149385811-149385833 AGAGGGGCAGAGAAGGAGAGAGG + Intronic
940323349 2:152400110-152400132 AGATGGCAACAGATAGAAAGTGG + Intronic
940373195 2:152924270-152924292 AGAGGGACAGAGAGAGAGAGAGG - Intergenic
940982640 2:160020655-160020677 ACAGGGCATCACATGGAGAGGGG - Intronic
941568801 2:167142963-167142985 AGAGAGAAAAAGATGGAGAGAGG + Intronic
941783994 2:169478740-169478762 AGAGGATCACAGAGGGCGAGGGG - Intergenic
941801893 2:169669159-169669181 AGAGGTCCACAGATGAAGAATGG + Intronic
942331343 2:174827945-174827967 AGAGGGTCACTGATGGAGCAAGG + Intronic
942448302 2:176092747-176092769 GGAGGCTCACAGAGGGAGAGAGG + Intergenic
943143197 2:184009130-184009152 AGAGGGCTACTGATGGGTAGGGG - Intergenic
944539597 2:200743083-200743105 AGAAGGCCCCGGATGGGGAGTGG - Intergenic
945371625 2:209025631-209025653 AGTGAGCAACAGATGCAGAGAGG + Intergenic
946046577 2:216826378-216826400 AGTGAGGAACAGATGGAGAGCGG - Intergenic
946226388 2:218266152-218266174 AGAGAGGCACAGATGAAGAGAGG + Intronic
948136343 2:235639169-235639191 AGTGGCCCACAGGTTGAGAGAGG + Intronic
948562102 2:238861072-238861094 AGAGGACTCCAGATGGAGATGGG + Intronic
948614553 2:239190209-239190231 AGAGGGGGACAGGGGGAGAGGGG - Intronic
948807843 2:240460632-240460654 AGAGGGCAGCAGAGGGAGGGCGG - Intronic
1168861788 20:1050889-1050911 ACAGGGACACAGATTCAGAGAGG - Intergenic
1169020688 20:2328611-2328633 ACAGGGACACAGCTGGAGATGGG - Intronic
1170396586 20:15932210-15932232 GGAGGGAGACACATGGAGAGAGG - Intronic
1170431158 20:16278185-16278207 AGGGGGCCACAGAGAGACAGAGG + Intronic
1170577163 20:17672990-17673012 AGAGGGGCACAGAAGGAGGTTGG + Intronic
1170943235 20:20866460-20866482 AGAGGCACACAGCTGGTGAGCGG - Intergenic
1171023520 20:21608291-21608313 AGAGGGACACACACGGAGAACGG - Intergenic
1171194378 20:23186114-23186136 GCAGGGCCACAGAAGGAGAAGGG - Intergenic
1171209958 20:23309413-23309435 AGAGGGAGACAGGGGGAGAGAGG - Intergenic
1171399761 20:24865278-24865300 AGAGGGCATCACATGGAGACAGG + Intergenic
1172013176 20:31858256-31858278 GGGGGGGCACAGATTGAGAGTGG - Intronic
1172557304 20:35853389-35853411 AGAATGCCACAGATGGAAAACGG - Intronic
1172919043 20:38466055-38466077 AGAAGTCCATAGATGGAGAGAGG + Intergenic
1173224211 20:41152501-41152523 AGTGGGCCACAGAGGCTGAGGGG - Intronic
1173246745 20:41342404-41342426 AGAGGGCTAGGGAGGGAGAGAGG + Intronic
1173251230 20:41365222-41365244 TGAGGCCCACAGATGGAGGTGGG - Intronic
1173452846 20:43180424-43180446 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1173865829 20:46312264-46312286 AGAGGGAGACAGAGGGAGACTGG - Intergenic
1173888033 20:46478996-46479018 AGAGGGCCAGAGACTGAGGGTGG - Intergenic
1174081201 20:47971893-47971915 ACAGAGGCACTGATGGAGAGAGG - Intergenic
1174298623 20:49567076-49567098 AGAGGCCCAGAGAGGGAGAGAGG + Intronic
1174361371 20:50030852-50030874 AGAGAGCCACAGAAGGAGCGAGG + Intergenic
1174725614 20:52858680-52858702 CGATGGCCACATATGGTGAGTGG - Intergenic
1175159177 20:56995321-56995343 AGAGGGGCCCAGACTGAGAGCGG - Intergenic
1175487309 20:59355511-59355533 AGAGAGGCAGAGAGGGAGAGAGG - Intergenic
1175487355 20:59355637-59355659 GGAGGGGGACAGAGGGAGAGAGG - Intergenic
1175790335 20:61736658-61736680 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1175791762 20:61744461-61744483 GGAGGGAGAGAGATGGAGAGAGG + Intronic
1175791779 20:61744538-61744560 GGAGGGAGAGAGATGGAGAGAGG + Intronic
1175908483 20:62393331-62393353 GGAGGGCTACAGATTGAAAGGGG + Intronic
1175921272 20:62451574-62451596 AGAGGGAGAGAGAGGGAGAGAGG + Intergenic
1176035803 20:63035938-63035960 AGGGGGCCATAGAGGGAGAAGGG - Intergenic
1176047775 20:63101605-63101627 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1176837838 21:13810167-13810189 TGAGAGACAGAGATGGAGAGAGG + Intergenic
1177560078 21:22739417-22739439 GGAGTGCCACAGGAGGAGAGTGG + Intergenic
1178478110 21:32955738-32955760 AAAGGGGCAGAGATGGAGGGGGG + Intergenic
1178637742 21:34319775-34319797 AGATGGCAACAGGTGGAGACGGG - Intergenic
1179722687 21:43324559-43324581 ACAGAGGCACAGATGGGGAGAGG - Intergenic
1179951877 21:44712819-44712841 AGAGAGACAGAGATGGAGGGAGG + Intergenic
1180049919 21:45326392-45326414 CGAGGGCCACAGCTGGAGGAGGG - Intergenic
1180475880 22:15706732-15706754 AAAGGGCTAAAGATGGAGAGTGG - Intronic
1180577391 22:16791746-16791768 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1181584472 22:23845491-23845513 AGAGGGACACAGAGCCAGAGAGG - Intergenic
1181903026 22:26170636-26170658 AGAGGGCCAGATAGAGAGAGGGG + Intronic
1182430646 22:30297068-30297090 TGAGGGCCAGAGAGGGAAAGGGG - Intronic
1182751707 22:32646821-32646843 ACAGAACCACAGAGGGAGAGGGG - Intronic
1183409340 22:37645746-37645768 AGAGGGAGACAGAGGTAGAGAGG + Intronic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1183542159 22:38435772-38435794 TGAGGGCCTCAGCTGGAGTGGGG - Intronic
1183544491 22:38448394-38448416 AGAGGCCCCCAGATGGACAGTGG + Intronic
1184147694 22:42620962-42620984 AGAGTGGCACAAATGGAAAGTGG - Intronic
1184250305 22:43256428-43256450 AGGGGGACACAGATGAACAGTGG + Intronic
1184454846 22:44603858-44603880 AGCAGGCCACAGATGCAGAAAGG + Intergenic
1185147410 22:49146879-49146901 AGAGGGCCAGTGATGGATAACGG + Intergenic
1185150322 22:49160518-49160540 ACAGGGTCACACCTGGAGAGAGG - Intergenic
1185345994 22:50311026-50311048 GGAGGGCCACTCATGGAGACTGG - Exonic
1185371028 22:50461048-50461070 ACAGGGCCACTGCTGGAGACTGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950579934 3:13855500-13855522 AGGGGGCCACAGAAGAAGGGAGG - Intronic
950883724 3:16344936-16344958 TGAGAGCCACAGATGAAGAGAGG - Intronic
951582340 3:24179166-24179188 TGAGGACCAGAGCTGGAGAGAGG - Intronic
952061691 3:29518256-29518278 ATAGGCCCACAGAAGGAGGGTGG - Intronic
952533082 3:34282081-34282103 ACAGGGGCAAAGTTGGAGAGAGG - Intergenic
953830140 3:46289944-46289966 AGAGAGACAGAGATGGAGGGAGG + Intergenic
953956579 3:47236271-47236293 TGAGGGCCAGAGATGGAGATGGG - Intronic
954454771 3:50591803-50591825 AGAGGGCCAAAGATGGGGCTGGG + Intergenic
954629616 3:52040770-52040792 AGAGGGCCAGAGAAGGGAAGTGG + Intergenic
954757444 3:52849122-52849144 AGAGGGCCACAGAGGACAAGAGG - Intronic
955699993 3:61672778-61672800 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
958000090 3:87739574-87739596 AGAGGGGCACAGAGGCAGAGAGG - Intergenic
958518766 3:95157082-95157104 AGGAGGTCACAGATGGAGATAGG - Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
959614261 3:108329685-108329707 AGAGGGGCAGACATCGAGAGTGG - Intronic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
960036123 3:113104805-113104827 GCTGGGCTACAGATGGAGAGGGG + Intergenic
961128803 3:124446353-124446375 AGAGGGCCACAGCAGCAGATTGG + Intronic
961311873 3:126007488-126007510 AGAGAGCCCCAGCTGGTGAGTGG - Intronic
961499547 3:127322417-127322439 AGAGAGAGAGAGATGGAGAGAGG + Intergenic
961518826 3:127455492-127455514 AGAGGCCCAGGGATGGAGAGGGG + Intergenic
964094807 3:152918867-152918889 AGAGGATCACAGGTTGAGAGGGG - Intergenic
964133673 3:153319013-153319035 AGAGGGAGACAGAGAGAGAGAGG + Intergenic
964425546 3:156549635-156549657 AGAGAGCTAAAGATGGAGACAGG - Intronic
965618091 3:170614939-170614961 AGAGGGCCACAGGTGCAGGGAGG + Intronic
965743326 3:171899678-171899700 AGGGGGCCAGAGGTGTAGAGAGG - Intronic
965894912 3:173563842-173563864 AGAGGGACAAAGATGGAAACAGG - Intronic
967320890 3:188194012-188194034 AAAGGACCAAAGATGGTGAGTGG - Intronic
967839103 3:193990336-193990358 AGAAGGCATCACATGGAGAGTGG + Intergenic
967887301 3:194341912-194341934 AGGGAGGCAAAGATGGAGAGCGG + Exonic
968054067 3:195677556-195677578 AGATGGCCTCAGATGTAGGGTGG + Intergenic
968101825 3:195971593-195971615 AGATGGCCTCAGATGTAGGGTGG - Intergenic
968570127 4:1335014-1335036 AGACGGCCACACCTGGAGGGAGG - Intronic
968615187 4:1574604-1574626 TGAGGGCCACAGAGGAAGAGAGG - Intergenic
969174888 4:5390914-5390936 AGAAGGCCACATAAGGACAGAGG - Intronic
970109203 4:12618459-12618481 TGAGGGCCACAGAGACAGAGTGG - Intergenic
970705402 4:18795525-18795547 AGAGGGCATCACATGGTGAGAGG + Intergenic
972566559 4:40274745-40274767 AGAGGCCCACATCTGGTGAGGGG + Intergenic
972976411 4:44641718-44641740 AGAAAGCCACAGATATAGAGGGG + Intronic
973132271 4:46662362-46662384 AGAGAGAGAGAGATGGAGAGAGG + Intergenic
973253110 4:48082002-48082024 AGAGGGCAAGAGATGGAAAGAGG - Intronic
974374775 4:61062135-61062157 AGAGGGAGACAGAGAGAGAGAGG + Intergenic
974525385 4:63043796-63043818 AGGTGGCCTCAGATGGAGATGGG - Intergenic
975296865 4:72744710-72744732 ATAGGGCAACAGATGGTGACTGG - Intergenic
975373098 4:73610734-73610756 AGAGTGCTAGAGATAGAGAGCGG - Intronic
975603244 4:76125659-76125681 AGAGGGGGAGAGAGGGAGAGAGG + Intronic
975603276 4:76125762-76125784 AGAGGGGGAGAGAGGGAGAGAGG + Intronic
976829433 4:89297672-89297694 AGAGGGAGACCAATGGAGAGTGG + Intronic
977093147 4:92704750-92704772 GGAGGGGCAGAGAGGGAGAGAGG - Intronic
977537169 4:98267486-98267508 AGAGGGGGACAAATGGAGGGAGG - Intronic
977836109 4:101647775-101647797 AGAGGGACAGAGAGGGAGTGAGG + Intronic
979086749 4:116421535-116421557 AGAGGGCATCACATGAAGAGAGG + Intergenic
979135538 4:117107330-117107352 AGAGAGAGAGAGATGGAGAGGGG - Intergenic
979682716 4:123479311-123479333 AGAGGGCCAGAGAAGGACTGAGG - Intergenic
980194345 4:129568745-129568767 AGAAGGGCTCAGATGGTGAGAGG - Intergenic
981167387 4:141577477-141577499 AGAGAGTCACTGATAGAGAGTGG - Intergenic
982173171 4:152681002-152681024 AGAGACAGACAGATGGAGAGAGG + Intergenic
982967344 4:161929123-161929145 AGAGAGCAACAGAGGGAGGGAGG - Intronic
983144589 4:164197701-164197723 AGAGCGCGAGAGATGGAGATGGG - Intronic
983837061 4:172401914-172401936 AGAGGGGGAGAGAGGGAGAGAGG + Intronic
984048270 4:174829968-174829990 ACAGGGACAGAGAAGGAGAGGGG - Intronic
985031385 4:185794233-185794255 AGAGGGCAGCAGAAAGAGAGTGG + Intronic
985268941 4:188176404-188176426 AGAGGGAGACAGAGGGAGAGAGG + Intergenic
985268945 4:188176422-188176444 AGAGGGAGACAGAGGGATAGAGG + Intergenic
985345616 4:189001704-189001726 ACAGGGGCACACATGGAGTGAGG - Intergenic
985451676 4:190066534-190066556 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985452664 4:190069826-190069848 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985453650 4:190073123-190073145 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985454640 4:190076416-190076438 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985455628 4:190079709-190079731 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985456612 4:190083003-190083025 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985457600 4:190086303-190086325 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985458587 4:190089596-190089618 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985459576 4:190092896-190092918 AGGCGGGCAGAGATGGAGAGAGG + Intergenic
985689781 5:1300734-1300756 CGAGGGCAAGAGAGGGAGAGAGG + Intergenic
985983102 5:3488599-3488621 AGAGGGGCAGAGAGGCAGAGAGG - Intergenic
986097216 5:4570923-4570945 AGAGAGGCAGAGAGGGAGAGAGG + Intergenic
986225982 5:5813158-5813180 AGCTGGCCAAAGATGCAGAGGGG - Intergenic
986514434 5:8546391-8546413 AGAGGGGCAGTGATGGATAGGGG + Intergenic
986799551 5:11245433-11245455 AGAGGGACGCAGAGGGAGACTGG + Intronic
988414130 5:30924457-30924479 AGAGGGCACCACATGGAAAGTGG + Intergenic
988612750 5:32743165-32743187 AGAGGGCAAGAGATGGATAGAGG - Intronic
988907297 5:35802627-35802649 AGAGGCCCAAAGAAGGTGAGGGG + Intronic
989576394 5:42992278-42992300 AGAAGGCCTCGGATGGAGAATGG - Intergenic
989667023 5:43866502-43866524 AGAGGGTAACAGGTGGAGAGAGG + Intergenic
989763102 5:45044117-45044139 AGAGAGACAGAGATGGAGAGAGG + Intergenic
992095583 5:73359555-73359577 GGATGGACACAGATGCAGAGAGG - Intergenic
992212785 5:74496923-74496945 AAAGGGCCACAGATGTGAAGGGG + Intergenic
992646908 5:78819752-78819774 AGGGGGCCACAGAGGTAGAGAGG + Intronic
992880013 5:81098464-81098486 AGAGGGCTGCAGACTGAGAGAGG + Intronic
993641234 5:90409073-90409095 AGAGGGCAACAGAGGGTTAGAGG + Intronic
994708833 5:103241208-103241230 AGAGGGACAGAGAGAGAGAGAGG - Intergenic
995736226 5:115302842-115302864 AGAGGTCCCCAGCTGGAGTGAGG - Intergenic
995958108 5:117804801-117804823 AGAGAGCAACAGATGGAAATAGG + Intergenic
996261929 5:121482125-121482147 AGAGTGCCCCATATGAAGAGTGG + Intergenic
996803085 5:127425300-127425322 GGCCGGCCACAGATGGACAGAGG - Intronic
996847773 5:127919814-127919836 AGAGGGACACAGAGGGACAGAGG - Intergenic
997572293 5:134940116-134940138 AGAAGTCCACAGATAGAGAAAGG - Intronic
997759526 5:136431633-136431655 AGAGGGTCAGAGATGGTCAGAGG - Intergenic
998201751 5:140130391-140130413 AGAGTGCCACTGTTGTAGAGAGG + Intergenic
998401872 5:141852582-141852604 AGATGGCCACAGTGGGAGACGGG + Intergenic
998804282 5:145903594-145903616 AGAGGCCCAGAGATGGCTAGAGG - Intergenic
999962088 5:156766834-156766856 AGAGGGCCACAGCAGCAAAGAGG + Intronic
1000416120 5:160985542-160985564 AGAGTGACAAAGAGGGAGAGAGG + Intergenic
1000580784 5:163033477-163033499 ACAGGGCCTCACATGGAGAGAGG - Intergenic
1000969942 5:167703004-167703026 AGAGGGAGACAGAGGGAGAGAGG - Intronic
1001219868 5:169891250-169891272 AGAGGGACACGGAAGGGGAGAGG - Intronic
1001408997 5:171496847-171496869 AGAGAGACTCAGAGGGAGAGGGG + Intergenic
1001629992 5:173167938-173167960 ACAGGGCCAAAGATTGTGAGAGG - Intergenic
1002106174 5:176880355-176880377 CGAGGGCCACAGCCGGACAGGGG + Exonic
1002422345 5:179155165-179155187 AGAGGGCCCCAGCTGCAGTGTGG - Intronic
1004387365 6:15184562-15184584 AGGGGGCCAGAGATGGTGAAAGG - Intergenic
1004794647 6:19067701-19067723 AGAGGGAGACAGAAGGAGACAGG - Intergenic
1004928056 6:20434884-20434906 AGAGCGTGGCAGATGGAGAGGGG + Intronic
1006311854 6:33266694-33266716 AGAGGGCCTCAAATGGATACTGG + Exonic
1006374051 6:33662245-33662267 AGAGGTACACATAGGGAGAGAGG + Intronic
1006620747 6:35362375-35362397 GGAGAGACACAGATGGGGAGAGG - Intronic
1007236263 6:40392994-40393016 AGAGTGACAGAGATGGGGAGGGG + Intronic
1007292243 6:40796701-40796723 AGAGGGCTACAGAGCAAGAGGGG + Intergenic
1007811006 6:44485652-44485674 ACAGGGAGACAGATGGACAGGGG + Intergenic
1007830236 6:44632571-44632593 AGAGGAGCAGAGCTGGAGAGTGG - Intergenic
1008187150 6:48408153-48408175 AGAGGTCCAGAGATTGAGAGGGG - Intergenic
1008864664 6:56195052-56195074 AGAGGGCATCACATGGTGAGGGG - Intronic
1010059993 6:71611431-71611453 AGAGGGAGATAGAGGGAGAGAGG - Intergenic
1011083889 6:83517558-83517580 AAAAGGCCACAGCAGGAGAGGGG - Intronic
1011250067 6:85361875-85361897 AGAGGACCAGAGATGGTGTGTGG + Intergenic
1011704300 6:89985596-89985618 AGAGGGCCTCAGCTGGGCAGGGG + Intronic
1012703575 6:102494314-102494336 AGAGGGACACAGCTCGAGTGGGG - Intergenic
1012745238 6:103078665-103078687 AGATGGTCTCAGATGGAGATAGG - Intergenic
1013551982 6:111216945-111216967 AGAGGCCCTCAGATTGTGAGTGG + Intronic
1013630426 6:111981003-111981025 GAAGGGCCACTTATGGAGAGGGG - Intergenic
1013975587 6:116074726-116074748 TGAGGGCCACAGATGAGAAGTGG - Intergenic
1015423907 6:133042176-133042198 AGTGAGGCATAGATGGAGAGGGG - Intergenic
1015620393 6:135126207-135126229 AAAGGGCCTCACATGGAGGGTGG + Intergenic
1016227845 6:141762069-141762091 AGAGGGGGAGAGTTGGAGAGGGG + Intergenic
1017429964 6:154361241-154361263 AGCGGGTCAGAGATGGAGAGGGG + Intronic
1018961675 6:168453867-168453889 AGAGAGACAGAGATGGAGAATGG - Intronic
1019154201 6:170028149-170028171 AGAGAGACAAAGATGGAGAGAGG + Intergenic
1019215120 6:170438563-170438585 ACACGGGCACAGATGGAGGGTGG - Intergenic
1019512249 7:1423511-1423533 AGAGAGACAGAGAGGGAGAGAGG + Intergenic
1019800873 7:3087486-3087508 AGAAGGCCACAGGGGGTGAGAGG + Intergenic
1020632981 7:10662697-10662719 AGTGGAACACTGATGGAGAGTGG + Intergenic
1020663788 7:11014043-11014065 AGTGGGATACAGATGGAGAAGGG + Intronic
1021886649 7:25146151-25146173 AGAGAGAGAGAGATGGAGAGAGG + Intronic
1022374964 7:29804711-29804733 GGAGGTCCAGAGAAGGAGAGTGG + Intergenic
1022470273 7:30677717-30677739 GGAGGCCCCCAGATGGAGACAGG + Intronic
1022492973 7:30834896-30834918 ATAAGGTCTCAGATGGAGAGGGG - Intronic
1023593354 7:41802138-41802160 AGAGAGCCAGAGAGAGAGAGAGG - Intergenic
1023667473 7:42539510-42539532 AGAGAGCGAGAGATGGAGAGAGG + Intergenic
1024241371 7:47438960-47438982 AGAGGGTGAGAGATGGTGAGAGG + Intronic
1025626900 7:63230821-63230843 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025626912 7:63230867-63230889 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1026592839 7:71711528-71711550 AGAGGGAGACAGAGGGAGAGAGG - Intronic
1028984007 7:96995997-96996019 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1029318867 7:99739496-99739518 AGAGGGACACAGAGGCTGAGAGG - Intergenic
1029323810 7:99788485-99788507 AGAGGGACACAGAGGCTGAGAGG - Intergenic
1029560560 7:101300102-101300124 TGAGGGCCAAGGAGGGAGAGGGG + Intergenic
1029561972 7:101308798-101308820 TGAGGGCCAGGGAGGGAGAGGGG + Intergenic
1029605767 7:101598681-101598703 AGAGGGTCCCAGATGGAGCCTGG + Intergenic
1029611447 7:101628681-101628703 GGCGGGCCCCAGATGGACAGTGG - Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1030693230 7:112556451-112556473 AGAGGGACAGAGATTGAGAGAGG - Intergenic
1030722475 7:112885577-112885599 AGGTGGCCTCAGATGGAGATGGG - Intronic
1031161426 7:118173139-118173161 AGCCTGCCACACATGGAGAGGGG + Intergenic
1032473004 7:132191763-132191785 AGAGAGAGAGAGATGGAGAGAGG - Intronic
1032985034 7:137328413-137328435 AGTGGGACACAGATGAACAGAGG - Intronic
1034070428 7:148179552-148179574 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1034433526 7:151052380-151052402 AGAGGGTCAGAGGTGGGGAGTGG - Intronic
1034535045 7:151721096-151721118 AGAGGGGGACAGAAGGATAGAGG + Intronic
1035100461 7:156392085-156392107 AGACGGGAAGAGATGGAGAGAGG + Intergenic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036080036 8:5545133-5545155 ACAGAGGCACAGATGGGGAGTGG - Intergenic
1036604037 8:10290680-10290702 AGTGGGCTACACAAGGAGAGTGG - Intronic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1037482536 8:19317669-19317691 GGAGGCCCCCAGATGGTGAGAGG + Intronic
1037748209 8:21662952-21662974 TAAGGCCCACAGATGGACAGGGG - Intergenic
1039428542 8:37506608-37506630 AGAGAGGGAGAGATGGAGAGAGG + Intergenic
1039741199 8:40384480-40384502 AGAGGGACACACAGAGAGAGGGG + Intergenic
1041839104 8:62248756-62248778 AGGAGGCTACAGATGGCGAGTGG - Intronic
1043400861 8:79882930-79882952 AGAGGGCAGGAGAGGGAGAGGGG - Intergenic
1043758094 8:84029704-84029726 ACAGGATCACAGATGGAAAGGGG + Intergenic
1044341712 8:91053731-91053753 AGATGACCAAAGAGGGAGAGCGG - Intergenic
1044381175 8:91535545-91535567 CCAGAGCCACAGATGGAAAGTGG - Intergenic
1045244668 8:100432602-100432624 AAAAGGCCACAGAGAGAGAGAGG - Intergenic
1045428929 8:102095247-102095269 AGAGGGTGGCAGATGGAGTGAGG + Intronic
1045490138 8:102661929-102661951 AGAGGGCCACAGAGAGGTAGTGG + Intergenic
1045820394 8:106329991-106330013 ATAGGGCTACAGACAGAGAGGGG - Intronic
1046436733 8:114199254-114199276 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1047288187 8:123506342-123506364 TGAGGGCCAGAGAAGGAGGGTGG + Intronic
1047500000 8:125432984-125433006 AAAGGGCCACAGAGGGTGGGGGG + Intronic
1047969245 8:130070826-130070848 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1047969249 8:130070844-130070866 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1047969253 8:130070862-130070884 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1048074258 8:131052063-131052085 AGAGGGAAAGAGAAGGAGAGAGG + Intergenic
1049339853 8:142106271-142106293 AGAGGGACACAGGTGAACAGAGG + Intergenic
1049534415 8:143171613-143171635 TGAGGCCGACAGATGCAGAGGGG + Intergenic
1049739621 8:144231527-144231549 AGAGGGCGAGAGGTGGGGAGTGG + Intronic
1050337128 9:4600486-4600508 AGAGAGCCAGAGAGAGAGAGAGG + Intronic
1050831028 9:10013216-10013238 ACAAGGCCACAGATGGACACTGG + Intronic
1053006877 9:34610839-34610861 CGAGGGCCACAGCTGGAGCTGGG + Exonic
1053010180 9:34628453-34628475 AGAGGGACCAAGATGGAGAGAGG + Intergenic
1056338241 9:85599188-85599210 AGAGAGGGACAGAAGGAGAGAGG + Intronic
1056429693 9:86514943-86514965 AGGGGGTCACTGATGGAGAAAGG - Intergenic
1056604943 9:88077853-88077875 AGAGGGAGACAGAGGGAGCGGGG + Intergenic
1057806925 9:98226051-98226073 TGAGGGTCTCAGATGGACAGCGG + Intronic
1057866963 9:98689092-98689114 TGAGGCCCAGAGAAGGAGAGAGG - Intronic
1059632726 9:116141958-116141980 AGAGGGTAAGAGATGGGGAGGGG + Intergenic
1060190864 9:121591634-121591656 ATAGGGACCCACATGGAGAGGGG + Intronic
1061276118 9:129570160-129570182 AGAGGGCCAGAGAGAGAGAGAGG + Intergenic
1061590812 9:131596484-131596506 CGAGGAGCACAGAAGGAGAGGGG - Intronic
1061880070 9:133564441-133564463 AGAGGGAGAGAGAGGGAGAGAGG + Intronic
1061880084 9:133564527-133564549 AGAGAGACAGAGAGGGAGAGAGG + Intronic
1061977134 9:134075136-134075158 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1062040063 9:134400469-134400491 TGAGGCCCAGAGAGGGAGAGTGG + Intronic
1062140957 9:134958878-134958900 ACAGGGCCATAGATACAGAGAGG + Intergenic
1062247526 9:135576861-135576883 AGAGGGAGAGAGATAGAGAGAGG - Intergenic
1186501922 X:10058127-10058149 GTAGGGCCACAGATGGGCAGGGG - Intronic
1186935781 X:14449302-14449324 AGAGGTCCACAGTGGGAGAGTGG - Intergenic
1187026652 X:15442351-15442373 AGAGGGAGAGAGATGGAGAACGG - Intronic
1188079113 X:25815071-25815093 AGAGGGAGAGAGAAGGAGAGAGG - Intergenic
1188079162 X:25815257-25815279 AGAGGGAGAGAGAGGGAGAGAGG - Intergenic
1189273810 X:39770446-39770468 AGGGTGCCAAATATGGAGAGAGG - Intergenic
1189320627 X:40084900-40084922 TGAGGGTCAGAGAAGGAGAGGGG + Intronic
1189615056 X:42774607-42774629 AGAGGGACAAAGAGGGAGAGAGG - Intergenic
1189974734 X:46449307-46449329 AGAGGGCCACAGTGGAGGAGAGG - Intronic
1190057131 X:47187486-47187508 AGAGGGCCACAGCGTGAAAGGGG + Intergenic
1190968760 X:55328832-55328854 AGACGGTGCCAGATGGAGAGAGG + Intergenic
1191843372 X:65528663-65528685 AAAGGGCCAGAGATGAGGAGAGG + Intronic
1192320871 X:70089550-70089572 AGAGGGAGGCAGAAGGAGAGAGG - Intergenic
1192320879 X:70089584-70089606 AGAGGGAGGCAGAAGGAGAGAGG - Intergenic
1192437624 X:71152765-71152787 AGAGAGCCAGAGAGGGAGAGAGG - Intronic
1192493549 X:71597554-71597576 AGAGGGCCACAGATGGAGAGAGG - Intronic
1192502754 X:71664439-71664461 AGGGGGCCACAGGTGCAGATGGG - Intergenic
1192504018 X:71670066-71670088 AGGGGGCCACAGGTGCAGATGGG + Intergenic
1192529088 X:71870943-71870965 AGGGGGCCACAGGTGCAGATGGG - Intergenic
1194573914 X:95587641-95587663 AGAAGGCCAGAGATGGGCAGTGG - Intergenic
1194592359 X:95815137-95815159 AGAGGGGCACAGAGGGAAAATGG - Intergenic
1195411067 X:104567941-104567963 TGGGCGGCACAGATGGAGAGGGG - Intronic
1195981313 X:110581390-110581412 AGAGGGCACCAAAAGGAGAGAGG + Intergenic
1196202674 X:112903218-112903240 AGAGGGCAACATATGGCAAGAGG - Intergenic
1196535140 X:116835610-116835632 ACAGGGCCACTGATGGAATGAGG - Intergenic
1196775763 X:119335482-119335504 AGAGGGCATCACATGGTGAGAGG - Intergenic
1197599958 X:128517438-128517460 AGAGGTCTACAGCGGGAGAGTGG - Intergenic
1197865198 X:131009927-131009949 AGTGGGCCACAGCTGGGGAATGG + Intergenic
1198199682 X:134402978-134403000 AGAGGGAGAGAGATGGAGAATGG - Intronic
1199494025 X:148433103-148433125 ATCTGGCCAGAGATGGAGAGTGG - Intergenic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1200039416 X:153354952-153354974 AGAGGTCGACAGGTGCAGAGAGG - Intronic