ID: 1192493639

View in Genome Browser
Species Human (GRCh38)
Location X:71598371-71598393
Sequence AGAGCGGGGAAGAGAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2138
Summary {0: 1, 1: 0, 2: 19, 3: 192, 4: 1926}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493639_1192493647 2 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493647 X:71598396-71598418 GTGTGGGAATGACGAGGAAGAGG 0: 1
1: 0
2: 1
3: 29
4: 326
1192493639_1192493648 7 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493639_1192493646 -4 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493646 X:71598390-71598412 CTCTATGTGTGGGAATGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1192493639_1192493649 16 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493639_1192493650 21 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493639 Original CRISPR AGAGCGGGGAAGAGAGGAAG AGG (reversed) Intronic
Too many off-targets to display for this crispr