ID: 1192493640

View in Genome Browser
Species Human (GRCh38)
Location X:71598377-71598399
Sequence ACACATAGAGCGGGGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493640_1192493647 -4 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493647 X:71598396-71598418 GTGTGGGAATGACGAGGAAGAGG 0: 1
1: 0
2: 1
3: 29
4: 326
1192493640_1192493649 10 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493640_1192493650 15 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493640_1192493648 1 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493640_1192493646 -10 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493646 X:71598390-71598412 CTCTATGTGTGGGAATGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493640 Original CRISPR ACACATAGAGCGGGGAAGAG AGG (reversed) Intronic
903027723 1:20441702-20441724 ACACATAGGTGGGGGAAGAGCGG - Intergenic
903105470 1:21075279-21075301 ACACATAGGGCCGGGCAGGGTGG + Intronic
903121509 1:21219439-21219461 TCACAGGGAGTGGGGAAGAGAGG + Intronic
904322754 1:29707650-29707672 ACACAGAGAGGGGGAAAGATGGG + Intergenic
906110861 1:43321163-43321185 ACACATACAGCGGGGCTGGGAGG + Intronic
906673510 1:47677121-47677143 ATGCAGAGAGGGGGGAAGAGAGG - Intergenic
907547730 1:55276922-55276944 ACTCAGAGAGTGGGGAAGAGTGG + Intergenic
910598938 1:89009832-89009854 TCAGATAGAGGGAGGAAGAGAGG + Intronic
912570364 1:110616808-110616830 ACACACAGAGCGTGGCACAGAGG + Intronic
912666204 1:111582144-111582166 AAACAAAGAGAGGGGAAGAGAGG + Intronic
915274789 1:154780956-154780978 AGACACAGAGCGGGGTAGCGTGG - Intronic
915832311 1:159142420-159142442 AGAGATAGAGGGAGGAAGAGTGG + Intronic
916084449 1:161258574-161258596 AGACAGAGAGCGGGAAGGAGGGG - Intergenic
917641907 1:176990889-176990911 AGTCATAGACCAGGGAAGAGAGG - Intronic
920157839 1:203969886-203969908 ACAGAGAGAGAGAGGAAGAGAGG + Intergenic
920516634 1:206589318-206589340 ACACTGGGAGCGGGGGAGAGAGG + Intronic
920783069 1:209013287-209013309 ACCCCGAGAGAGGGGAAGAGAGG - Intergenic
920943814 1:210509683-210509705 ACACACAGAGTGGAGAAGGGGGG - Intronic
921416249 1:214890744-214890766 ACAAACAGAGTGGGGAGGAGGGG + Intergenic
923394138 1:233543943-233543965 ACACATAGTGCCGAGAAGATAGG - Intergenic
924169707 1:241325788-241325810 ACACATACAGAGGGGAAGGGAGG + Intronic
924591356 1:245407398-245407420 ACACAAAGAGATGGGAAGCGGGG - Intronic
1062990555 10:1810533-1810555 ACACACAGAGAGGGATAGAGAGG + Intergenic
1063112332 10:3047871-3047893 ACAGAGAGAGAGGGGGAGAGTGG - Intergenic
1063956568 10:11273037-11273059 AGGAAGAGAGCGGGGAAGAGGGG - Intronic
1064184175 10:13146469-13146491 ACACAGAGAGGGAGGAAGGGAGG - Intergenic
1065089279 10:22214060-22214082 ACAAATTCAGCAGGGAAGAGAGG + Intergenic
1065209052 10:23385120-23385142 ACACATATGGAGAGGAAGAGAGG + Intergenic
1065314277 10:24447114-24447136 ACAAAGAGAGCGGGGCAGGGAGG - Intronic
1065744134 10:28823307-28823329 ACACAGAGAGAGGGAGAGAGAGG - Intergenic
1067980971 10:51083795-51083817 ACACACAGAGCTGGCAATAGGGG - Intronic
1070041373 10:72783726-72783748 ACGCATAGAGTGGGGTGGAGTGG + Intronic
1070451903 10:76567485-76567507 AGACATAGAGCAAGGAAGATAGG - Intergenic
1074456999 10:113603924-113603946 ACATATAGAGCAGGGAAGTGGGG - Intronic
1078156656 11:8805727-8805749 ACAGACAGAGTGGGGGAGAGAGG + Intronic
1079398560 11:20086827-20086849 AGACACAGAGGGGGGCAGAGTGG + Intronic
1079421632 11:20296396-20296418 ACAAATAGAGCTGGGAAAACTGG - Intergenic
1079689299 11:23402445-23402467 AAAAATAGAGCAGGGAAGAGGGG - Intergenic
1081683358 11:45024383-45024405 TCCCATAGAGCTGGGAATAGGGG - Intergenic
1082966031 11:58966931-58966953 ACACATGGAGGGAGAAAGAGAGG - Intronic
1083889683 11:65589657-65589679 ACTCATACAGAGGGGAGGAGGGG - Intronic
1084667245 11:70583043-70583065 CCACATGGAGCGGGGGACAGAGG + Intronic
1084839631 11:71834714-71834736 ACACAGAGAGAGGGCAAGAGTGG + Intronic
1086477822 11:87198503-87198525 AGAAACAGAGCGGGGAGGAGAGG - Intronic
1087211768 11:95452191-95452213 ACAGATTGAGAGGGGCAGAGCGG - Intergenic
1087565913 11:99857071-99857093 AGACAGAGAGAGAGGAAGAGAGG - Intronic
1088732611 11:112696496-112696518 ACAGGAAGAGAGGGGAAGAGAGG - Intergenic
1092303163 12:7272107-7272129 GAACACAGAGCTGGGAAGAGAGG - Intergenic
1093908554 12:24720139-24720161 ACTCATACAGAGGAGAAGAGAGG + Intergenic
1099077034 12:78122462-78122484 AGGCATAGTGCAGGGAAGAGGGG - Intronic
1099834823 12:87896012-87896034 ACACATAGAGCTGGCTAAAGAGG - Intergenic
1100035856 12:90250705-90250727 ACACAAAGAGGGATGAAGAGGGG - Intergenic
1101600095 12:106201871-106201893 GCACATAGAGAGGGAAGGAGAGG + Intergenic
1102197498 12:111035225-111035247 AGAGAAAGAGCAGGGAAGAGAGG - Intronic
1104446853 12:128841307-128841329 AGACAGAGAGGGGGAAAGAGAGG - Intergenic
1106243006 13:27925094-27925116 ACACACACAGCGGGGAAGCTGGG + Exonic
1112577622 13:100650475-100650497 AGGCATAGAGTGGTGAAGAGGGG - Intronic
1113865111 13:113516811-113516833 ACACATAGAAAGAGGAACAGAGG + Intronic
1115211026 14:30967256-30967278 GCAGAGAGAGGGGGGAAGAGAGG + Intronic
1115727378 14:36231982-36232004 ACACATGGAGAGAGGAAGTGGGG - Intergenic
1115903383 14:38179504-38179526 ACACAGTGAGGGTGGAAGAGTGG - Intergenic
1118026021 14:61769928-61769950 ACATATAGAGAGGAGACGAGAGG + Intronic
1119635837 14:76272627-76272649 ACACATAGAGAGGGAGAGAGAGG + Intergenic
1120969605 14:90196377-90196399 ACACATAGAAGGGTGAGGAGCGG - Intergenic
1121851193 14:97222621-97222643 ACACATACAGCTGGTAAGTGAGG - Intergenic
1122029361 14:98901342-98901364 AGACATAGAAGAGGGAAGAGGGG + Intergenic
1122152716 14:99733377-99733399 ACACAGAGACCTGGGAAGTGAGG - Intergenic
1124983409 15:34583812-34583834 ACACCGCGCGCGGGGAAGAGAGG + Intronic
1125716300 15:41821783-41821805 ACTCATAGGGAGGGGAAGACGGG - Intronic
1128291944 15:66484775-66484797 AGAAATAGAGCAGGGATGAGGGG + Intronic
1129244142 15:74269549-74269571 ACACACAGAACAAGGAAGAGGGG + Intronic
1130140554 15:81222533-81222555 ACTCATAGAGGTGGGGAGAGAGG - Intronic
1131358386 15:91766411-91766433 ACACACAGAGTGGGTAAGAAAGG + Intergenic
1131359981 15:91782070-91782092 ACACATAGAGAGAGGCAGAGTGG - Intergenic
1131727164 15:95239331-95239353 ACACAAGGAGAGAGGAAGAGAGG + Intergenic
1131800974 15:96069306-96069328 ACACATAGAAAGGGGAGGACAGG + Intergenic
1132312090 15:100864650-100864672 AGACATAAAGCGGGGAAAAGAGG - Intergenic
1132737127 16:1392426-1392448 AAAAAAAGAGGGGGGAAGAGGGG - Intronic
1134527136 16:14953176-14953198 ACCCATAGTGCTGGCAAGAGAGG - Intergenic
1134912725 16:18042619-18042641 AGAAGAAGAGCGGGGAAGAGGGG - Intergenic
1135420944 16:22305143-22305165 ACACATCGATCTGGGAAGAAGGG - Exonic
1138313469 16:56048096-56048118 AGAGACAGAGAGGGGAAGAGAGG - Intergenic
1138458139 16:57132921-57132943 AAATAAAGAGGGGGGAAGAGTGG + Intronic
1139012857 16:62654328-62654350 ACACATAGAGCTGGGTGCAGTGG + Intergenic
1140696378 16:77538436-77538458 ACACAAAGGGGTGGGAAGAGAGG - Intergenic
1144699193 17:17325729-17325751 ACACAGAGAGGGGGGCACAGTGG - Intronic
1147535828 17:41322900-41322922 AGACATAGAGGAGGGAAGATGGG - Intergenic
1149616674 17:58006851-58006873 ACATAGAGAACGGGGAAGCGGGG - Intronic
1151057418 17:71049359-71049381 ACACTGAGAGGAGGGAAGAGTGG + Intergenic
1154228287 18:12528552-12528574 ACACATAGGGCAGGGATGAATGG + Intronic
1155684657 18:28534051-28534073 AAAAATAAAGCAGGGAAGAGTGG + Intergenic
1156256742 18:35405241-35405263 ACAAATAGTGCTGGGAAGATTGG + Intergenic
1158269233 18:55695022-55695044 CCACATAGAGAGAGAAAGAGAGG + Intergenic
1161461687 19:4401234-4401256 ACAGAGAGAGAGAGGAAGAGAGG - Intergenic
1162057804 19:8075194-8075216 AGACATAGAGAGAGGGAGAGAGG + Intronic
1163227701 19:15976425-15976447 ACCTATAGAGAGAGGAAGAGAGG + Intergenic
1165924686 19:39320059-39320081 ACAGATGGAGGGGGGATGAGAGG - Intergenic
1166142976 19:40815341-40815363 ACACAGAGGTCGGGGGAGAGAGG - Intronic
1166348965 19:42185224-42185246 ACACTGGGAGCAGGGAAGAGAGG - Intronic
1167868596 19:52348823-52348845 ATCCATAGAGAGGGGAGGAGGGG + Intronic
925655555 2:6144356-6144378 ACACAGAGAAAGGGGAAGAGAGG - Intergenic
925781066 2:7382332-7382354 ACACATATCGGGTGGAAGAGTGG - Intergenic
926519450 2:13892179-13892201 ACACAAAGAGGGTAGAAGAGTGG - Intergenic
926540248 2:14168192-14168214 ACACATAGAGCAAGTAAGAGAGG + Intergenic
927964643 2:27261705-27261727 CGATATTGAGCGGGGAAGAGGGG + Intronic
928504264 2:31933377-31933399 ATATATAGAAAGGGGAAGAGAGG + Intronic
929349269 2:40929005-40929027 AGAAATGGAGAGGGGAAGAGTGG + Intergenic
930281280 2:49373095-49373117 ACTAATAGAGTGGGGAAGAAGGG - Intergenic
931385633 2:61795408-61795430 AGACAGAGAGCGTGAAAGAGAGG + Intergenic
932771532 2:74503245-74503267 ACCCATAGACCCGGGACGAGCGG + Intronic
933191964 2:79344171-79344193 ACACAAAGAGCTGTGTAGAGCGG - Intronic
933523015 2:83397871-83397893 ACTCATAAAGTAGGGAAGAGTGG + Intergenic
934621868 2:95815288-95815310 CCAAATAGAGGAGGGAAGAGAGG + Intergenic
935482671 2:103612831-103612853 AAACATAGAACTGGAAAGAGAGG - Intergenic
935744482 2:106178757-106178779 AGACATAGGGCGGGGGAAAGGGG - Intronic
937235245 2:120427764-120427786 ACACAGAGAGCAGGGCACAGTGG - Intergenic
939787721 2:146537652-146537674 ACACATAGAGGGAGAGAGAGCGG - Intergenic
940286629 2:152038865-152038887 ACATACAGGGCTGGGAAGAGAGG - Intronic
940558630 2:155264813-155264835 ACACACAGAGGGTGGTAGAGTGG + Intergenic
941260639 2:163292484-163292506 ACACAGAGAGCAGAGAAGAAGGG + Intergenic
943826600 2:192402276-192402298 ACACACAGAGGTGGAAAGAGAGG + Intergenic
944487325 2:200220750-200220772 ACACATAGAGGAGGCCAGAGTGG - Intergenic
945665381 2:212734865-212734887 ACCCATAGAAAGAGGAAGAGTGG - Intergenic
946238539 2:218340282-218340304 ACACATAGCCTGGGGAAGGGGGG + Intronic
948088307 2:235268526-235268548 AGACACAGAGAGGGGAAGAAAGG - Intergenic
1169342679 20:4808422-4808444 ACACAGAGAAAGGAGAAGAGGGG + Intronic
1171880881 20:30616780-30616802 ACACATAGGGAAGGGAGGAGGGG + Intergenic
1172879239 20:38187870-38187892 ACAGAGAGAGCAGAGAAGAGGGG - Intergenic
1173902316 20:46600171-46600193 ACAGAGAGAGAGAGGAAGAGAGG + Intronic
1174364594 20:50048741-50048763 TCACATAGAGTGGGGAACAGTGG - Intergenic
1177086498 21:16711638-16711660 ACACATAGGGCTGGGCACAGTGG - Intergenic
1178306174 21:31492116-31492138 ACACAGAGAGAGAGAAAGAGAGG + Intronic
1178825651 21:36014305-36014327 ACACCTAGAGAGGAGAAGAAAGG + Intergenic
1179291429 21:40021282-40021304 ACAAATAGAGAAGGGAAAAGGGG + Intronic
1180785312 22:18543835-18543857 GCAGCTAGAGCCGGGAAGAGAGG - Intergenic
1181128894 22:20717876-20717898 GCAGCTAGAGCCGGGAAGAGAGG - Intronic
1181242214 22:21483188-21483210 GCAGCTAGAGCCGGGAAGAGAGG - Intergenic
1182185586 22:28398274-28398296 ACACAAAGAGGGGGCCAGAGGGG + Intronic
1182797330 22:33000491-33000513 ACACATCAGGCAGGGAAGAGTGG + Intronic
1183200801 22:36384861-36384883 ACTCTTAGAGCTGGGAAGAGTGG - Intronic
1183263143 22:36809089-36809111 ACAAACAGAGCAGGGAAGAGAGG + Intronic
1185372522 22:50467646-50467668 CCACAGAGAGGGAGGAAGAGGGG - Exonic
950393069 3:12711884-12711906 ACTACTAGAGCGGGGAGGAGAGG - Intergenic
951206859 3:19934440-19934462 ACACACAGAGAGGGAGAGAGAGG - Intronic
952325119 3:32313863-32313885 ACACATAGAAGGGTGAGGAGTGG + Intronic
953827678 3:46268084-46268106 ACACATAGAGCATGGAGGGGAGG + Intergenic
954160638 3:48719089-48719111 ACATATAGAGCCAGGATGAGGGG - Intronic
954281123 3:49578773-49578795 ATAGATAGAGGGGGGAAGAATGG - Intronic
955072770 3:55585523-55585545 AGTTATAGAGAGGGGAAGAGAGG - Intronic
955875765 3:63488925-63488947 ACAGATTGAGAGGGGAACAGTGG - Intronic
956158476 3:66323454-66323476 ACACATAGAGCTGGGTAAATGGG + Intronic
956168341 3:66413209-66413231 ACACCTAGTGCAGGCAAGAGGGG + Intronic
956399492 3:68861879-68861901 AGACATAGTGCTGGGGAGAGGGG + Intronic
956884530 3:73545860-73545882 ACACTTATTGCGGGGAGGAGGGG + Intronic
959683509 3:109122388-109122410 ACACAGAGAGAGAGAAAGAGAGG + Intergenic
959687912 3:109167725-109167747 ACACAGAGAGAGAGGGAGAGAGG + Intergenic
962141042 3:132791162-132791184 ACATATAAAGAGGGGAGGAGAGG - Intergenic
962745449 3:138394579-138394601 AGACATAGAGAAGAGAAGAGGGG - Intronic
963025891 3:140918221-140918243 ACACATGGAGAGGGAAGGAGAGG + Intergenic
964114408 3:153120778-153120800 ACACATATGGCTGGGAACAGTGG - Intergenic
964810906 3:160663885-160663907 ACACATAAAACTGGTAAGAGTGG - Intergenic
966501415 3:180645454-180645476 ACGGATAGAGGGAGGAAGAGAGG - Intronic
969650400 4:8463835-8463857 TGACCAAGAGCGGGGAAGAGCGG - Intronic
969780713 4:9400726-9400748 ACACAGAGAGAGGGCAAGAGTGG + Intergenic
970599028 4:17626447-17626469 ACACACTGACCAGGGAAGAGGGG - Exonic
970832076 4:20351658-20351680 TCACATGGAGGTGGGAAGAGTGG + Intronic
971572432 4:28230366-28230388 ACACATTGAAAGGTGAAGAGAGG - Intergenic
972752846 4:42009909-42009931 AAACAGAGAGCAGGGCAGAGAGG - Intronic
973026839 4:45283816-45283838 ACATGGAGAGCAGGGAAGAGGGG + Intergenic
974865601 4:67577210-67577232 ACACAGAAAGTGGGGAAGAATGG + Exonic
977116101 4:93030825-93030847 ACAGAGAGAGAGGAGAAGAGTGG + Intronic
977249309 4:94671445-94671467 ACACCTAGATCCAGGAAGAGAGG + Intergenic
978521268 4:109618213-109618235 GGAGATAGAGCGGGGAAGAAGGG - Intronic
981874367 4:149522605-149522627 AGACATAGAGGGGGAAAAAGTGG + Intergenic
983355611 4:166653476-166653498 ACATATAGAGCTGGGATGAATGG - Intergenic
986150612 5:5126597-5126619 ACACATGGTGCTGGGCAGAGGGG + Intergenic
986957863 5:13176859-13176881 ACACAAGGAGAGGGGGAGAGAGG + Intergenic
987186919 5:15430886-15430908 AGACAAAGAGCCAGGAAGAGGGG - Intergenic
989179975 5:38566963-38566985 AAACATGGAGTTGGGAAGAGAGG + Intronic
989368168 5:40679509-40679531 ACATCTAGATCGTGGAAGAGAGG - Exonic
990147046 5:52774053-52774075 GGACACAGAGCAGGGAAGAGGGG - Intergenic
990791154 5:59481543-59481565 ACCCATAGAGCAGGGAATAGGGG - Intronic
992076671 5:73198471-73198493 AGACTTAGAGAGGGGAACAGAGG - Intergenic
992789270 5:80198936-80198958 ACAGAGAGAGGGAGGAAGAGAGG - Intronic
995648145 5:114336866-114336888 ACACAGAGCAAGGGGAAGAGAGG + Intergenic
996798357 5:127375631-127375653 AGAGCTAGAGCAGGGAAGAGGGG - Intronic
997131223 5:131278489-131278511 ACACATGGAGCTGGAGAGAGAGG - Intronic
998390586 5:141784755-141784777 ATGCACAGAGCTGGGAAGAGAGG - Intergenic
1001097144 5:168784390-168784412 ACACACAGAGTGGGGCAGACAGG + Intronic
1001220063 5:169892951-169892973 AGACAAAGAGCAGGGAGGAGAGG - Intronic
1002510538 5:179713451-179713473 ACACTTAAAGCGAGGGAGAGGGG + Intronic
1002856265 6:1040630-1040652 AAACAGACAGCGGGGCAGAGAGG + Intergenic
1005762486 6:28980165-28980187 ACACACAGAGAGGTTAAGAGTGG - Intergenic
1011415479 6:87115405-87115427 ACAAATAGAGCCATGAAGAGAGG + Intergenic
1012299786 6:97571760-97571782 ACACATAGAGAAGGCAAGAAGGG - Intergenic
1012450595 6:99349634-99349656 ACACAAAGAGCGGGGCGGAGAGG - Exonic
1012606957 6:101169343-101169365 ACACATAGAGAGTAGAAGAATGG + Intergenic
1016669795 6:146690641-146690663 ACACATTGTTAGGGGAAGAGGGG + Intronic
1016957232 6:149638671-149638693 ACATATAGAGATGGGAAGTGTGG - Intronic
1017585520 6:155918412-155918434 ACATATACAAGGGGGAAGAGAGG + Intergenic
1019841806 7:3453514-3453536 ACACAGAGGGAGGGGAAGAAAGG + Intronic
1020531206 7:9338139-9338161 ACACATAGAGAGAGAGAGAGAGG + Intergenic
1021065723 7:16170650-16170672 ACACAGGGGGCGGGGGAGAGAGG + Intronic
1021454416 7:20814025-20814047 ACACAGAGAGCCGGGCACAGTGG + Intergenic
1022332270 7:29391274-29391296 AAAGAGAGAGTGGGGAAGAGAGG + Intronic
1023277019 7:38530818-38530840 AAAAATAGAACGGGGAAGAAAGG + Intronic
1023496803 7:40806573-40806595 ACAAATAAAAGGGGGAAGAGAGG - Intronic
1026319882 7:69259140-69259162 AAACAGAGAGGGGAGAAGAGGGG - Intergenic
1027392572 7:77720049-77720071 ACACATACAGCTGGGAACAGTGG - Intronic
1030688270 7:112508208-112508230 ACAAAAAGAGAGGGGAGGAGGGG + Intergenic
1031491700 7:122397500-122397522 ACACAAAGAGGGGGAAAGAAAGG + Intronic
1031863627 7:127012956-127012978 ACACACAGAGGGTGGCAGAGAGG + Intronic
1032525815 7:132577500-132577522 ACATCTAGAGCGAGGGAGAGCGG + Intronic
1033272452 7:139944811-139944833 ACACAGAGAGAGGGAAGGAGAGG - Intronic
1034758055 7:153641507-153641529 ACACACACAGAGGGAAAGAGAGG - Intergenic
1034888750 7:154820343-154820365 CCACACAGAGCGGTAAAGAGTGG + Intronic
1035251681 7:157601739-157601761 ACCCATCGAGTGGGGGAGAGTGG + Intronic
1036278150 8:7374659-7374681 ACACAGAGAGAGGGCAAGAGTGG + Intronic
1036343372 8:7937232-7937254 ACACAGAGAGAGGGCAAGAGTGG - Intronic
1036838712 8:12097994-12098016 ACACAGAGAGAGGGCAAGAGTGG - Intergenic
1036860500 8:12344238-12344260 ACACAGAGAGAGGGCAAGAGTGG - Intergenic
1038077203 8:24089843-24089865 CCACACAGAGTGGGGAAGAAGGG - Intergenic
1038288941 8:26231200-26231222 ACACACAGAGGGAGAAAGAGAGG + Intergenic
1040694352 8:49978224-49978246 ATAGAGAGAGCGGGGGAGAGAGG + Intronic
1042038705 8:64567599-64567621 GCACATAGAGCGAAGAAGAACGG + Intergenic
1045319689 8:101072653-101072675 GCACAGAGAGAGGGGATGAGAGG + Intergenic
1051726237 9:20089994-20090016 ACACAGAGAAAGGGGCAGAGGGG - Intergenic
1056240599 9:84642656-84642678 CTACAAAGAGTGGGGAAGAGAGG - Intergenic
1057760017 9:97864431-97864453 AAACATAGAGCTGGGCACAGTGG - Intergenic
1058314519 9:103548294-103548316 ACACAAAGAGAGAGGGAGAGAGG + Intergenic
1061432473 9:130539980-130540002 ACACACAGAGCAGGGCAGAGAGG - Intergenic
1062675015 9:137737425-137737447 ACAAATGGTGCGGGGAAGACTGG + Intronic
1185545394 X:939741-939763 AAACAGAGAGAGGAGAAGAGAGG - Intergenic
1186434956 X:9534769-9534791 ACTCAGAGAGGGGGGAAGAGGGG - Intronic
1186593751 X:10958880-10958902 ACACATGGTGGGGGGCAGAGAGG + Intergenic
1186918275 X:14247290-14247312 ACACACAGAAGGGGGAAGAGCGG + Intergenic
1187754902 X:22512523-22512545 ACACACAGAGCGAGCGAGAGAGG - Intergenic
1188342555 X:29022131-29022153 ACACATAGACATTGGAAGAGAGG - Intronic
1189167093 X:38870862-38870884 ACATGTAGATGGGGGAAGAGTGG + Intergenic
1189491781 X:41475760-41475782 ACACAGAGAGCGGGGCAGGGAGG + Intergenic
1189683441 X:43540007-43540029 ACAAAGAGAGAAGGGAAGAGGGG + Intergenic
1191867617 X:65717826-65717848 ACACAGAGAGCAAGGAAGAAAGG - Intronic
1191899998 X:66031044-66031066 GCTCACAGAGCAGGGAAGAGTGG + Intronic
1192493640 X:71598377-71598399 ACACATAGAGCGGGGAAGAGAGG - Intronic
1192812746 X:74561457-74561479 ACACATAGGGCTGGGCACAGTGG + Intergenic
1193496726 X:82221484-82221506 AGAAATAGTGCTGGGAAGAGTGG - Intergenic
1194956355 X:100185532-100185554 TCAAATAGAGCTGGTAAGAGAGG + Intergenic
1194989469 X:100530742-100530764 ACAAATGGTGCTGGGAAGAGTGG - Intergenic
1197030965 X:121815321-121815343 ACACATAGAGAAGGGAATAGAGG - Intergenic
1197299451 X:124760224-124760246 ACACATAGAAGGGTGAGGAGTGG - Intronic
1197424383 X:126277329-126277351 AGACATAGAGAGTGGAATAGAGG + Intergenic
1198077992 X:133212808-133212830 AGACAGGGAGAGGGGAAGAGGGG + Intergenic
1198713965 X:139536285-139536307 ACACATAGAGAGAGAGAGAGAGG + Intronic
1199978995 X:152910907-152910929 TCACAGAGAGCAGGGCAGAGTGG - Intergenic
1200106194 X:153714237-153714259 CCACATTGAGAGGGAAAGAGAGG - Intronic
1201793163 Y:17864785-17864807 ACACAAAGAGAGTGGGAGAGTGG + Intergenic
1201808391 Y:18041201-18041223 ACACAAAGAGAGTGGGAGAGTGG - Intergenic