ID: 1192493643

View in Genome Browser
Species Human (GRCh38)
Location X:71598385-71598407
Sequence TCATTCCCACACATAGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493643_1192493649 2 Left 1192493643 X:71598385-71598407 CCCCGCTCTATGTGTGGGAATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493643_1192493648 -7 Left 1192493643 X:71598385-71598407 CCCCGCTCTATGTGTGGGAATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493643_1192493650 7 Left 1192493643 X:71598385-71598407 CCCCGCTCTATGTGTGGGAATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493643 Original CRISPR TCATTCCCACACATAGAGCG GGG (reversed) Intronic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
905416136 1:37805741-37805763 CCATTCCCAGACCTAGAGTGGGG - Intronic
908169630 1:61491915-61491937 TCATTCCCACACATATTCCTCGG + Intergenic
911093793 1:94039455-94039477 ACATTCTCTCACATAGAGAGGGG + Intronic
915870998 1:159559448-159559470 TAATTCCCACATATCGAGGGAGG - Intergenic
918449745 1:184646991-184647013 TCAGTCCCACACATGGAGAAAGG - Intergenic
922061405 1:222096183-222096205 TCATGCCCACACATACACCCAGG + Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
1063911755 10:10837153-10837175 TCATTCCCACACGTTGTGGGAGG + Intergenic
1064318785 10:14282185-14282207 TAATTCCCACACATTGTGGGAGG - Intronic
1065837653 10:29673734-29673756 TAATCCCCACACATCGAGGGAGG - Intronic
1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG + Intronic
1077521276 11:3036559-3036581 ACATTCCCACCCATAGTGCATGG - Intronic
1081137847 11:39461264-39461286 TTATACCCACACATCGAGCCTGG + Intergenic
1081565870 11:44260965-44260987 TCACTCACACACATAGAGCTAGG - Exonic
1085446195 11:76602738-76602760 TAAATCCCACACCTAGGGCGAGG - Intergenic
1090972555 11:131655778-131655800 TCATTGCCTCACACAGAGCTTGG - Intronic
1092171715 12:6377517-6377539 TCACTCCCACACAGAGCCCGTGG + Intronic
1095944556 12:47746573-47746595 TCATGCCCACAGGTAGAGCCTGG - Intronic
1097735977 12:63180984-63181006 TCATCCCCACATAAAGAGCATGG + Intergenic
1100500834 12:95172548-95172570 TCATTCCCAAGCATAGGGAGAGG + Intronic
1111183089 13:84694229-84694251 CCATTCCCCCTCACAGAGCGGGG + Intergenic
1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG + Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1131708853 15:95030518-95030540 TCCATCCCACACATAGACCCTGG - Intergenic
1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG + Intronic
1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG + Intronic
1142904927 17:3035057-3035079 TCATTCCCACACACGTGGCGGGG - Exonic
1145803237 17:27705195-27705217 TGATTCCCACACATTGTGTGTGG - Intergenic
1155009961 18:21767439-21767461 TAATTCCCACACGTCGAGGGAGG - Intronic
1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG + Intronic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG + Intergenic
1158727515 18:59986997-59987019 ACATTCCCACATATACAGCATGG - Intergenic
1158859037 18:61574075-61574097 TAATTCCCACACATTGTGGGAGG - Intergenic
1162765854 19:12919027-12919049 TGATTTCCACACATGGCGCGTGG - Intronic
1163349940 19:16770188-16770210 TAATCCCCACACATTGAGGGAGG + Intronic
1167864788 19:52315764-52315786 TCCTTCCTACACATAGGGCTTGG + Intronic
934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG + Intronic
935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
938186958 2:129240344-129240366 TCCTTCCCTCACAGAGAGTGTGG - Intergenic
942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG + Intronic
944288763 2:197980092-197980114 GCATTCCCACACACAGAGTCAGG - Intronic
946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG + Intergenic
1169777282 20:9269487-9269509 TCATTCCAACACAGTGAGCAAGG + Intronic
1180592436 22:16952649-16952671 ACATACACACACATAGAGAGAGG - Intergenic
1185240089 22:49737707-49737729 TCATTCCCGCATATACAGAGAGG + Intergenic
1185240107 22:49737800-49737822 CCATTCCCACATATACAGAGAGG + Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
949642911 3:6059802-6059824 CCGTTCCAACACATAGATCGGGG - Intergenic
950117001 3:10457434-10457456 TCTTTCCCACACACAAAGCACGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950256126 3:11507775-11507797 TCCTTCCCACATCTAGAGTGTGG - Intronic
953503148 3:43457603-43457625 TAATTCCCACATATTGAGGGAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954874118 3:53789930-53789952 TCCTTCCCACACATGGATCCAGG - Intronic
954964457 3:54597969-54597991 CCTTTCCCATCCATAGAGCGAGG + Intronic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
955747913 3:62158317-62158339 TTATTCCCAAAAATAGAGCCAGG + Intronic
962718899 3:138153920-138153942 TAATCCCCACGCATAGAGGGAGG - Intergenic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
963729454 3:148957363-148957385 TAACTTCCACACATAGAGCAGGG + Intergenic
969862218 4:10046523-10046545 TAATCCCCACACATAGTGGGAGG - Intronic
971535158 4:27738783-27738805 TAATTCCCACACATTGTGGGAGG - Intergenic
971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG + Intergenic
977818734 4:101446625-101446647 TCATTCCCACACAAAGACTTTGG - Intronic
981104626 4:140866433-140866455 CTTTTCCCACACATAGAGAGTGG + Exonic
985776563 5:1847264-1847286 TCACTCCCACACCCAGTGCGTGG - Intergenic
993290107 5:86056759-86056781 TAATCCCCACACGTAGAGTGAGG + Intergenic
1005143388 6:22660161-22660183 TCATTCCCACAAATACATCCAGG + Intergenic
1006918862 6:37614563-37614585 TCATTCCCCCACATAGAAGGAGG - Intergenic
1008549939 6:52619179-52619201 TCATTCACATATATAGAGAGAGG - Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1011343918 6:86347910-86347932 TAATTCCCACACATTGTGGGAGG - Intergenic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1016450676 6:144179268-144179290 TAATTCCCACACGTTGTGCGAGG - Intronic
1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG + Intronic
1020578133 7:9960307-9960329 TCATTCACACACATGGCTCGTGG + Intergenic
1033129441 7:138733360-138733382 TCATGCCCACACAGAGAGGGTGG + Intronic
1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG + Intergenic
1037711222 8:21356935-21356957 TAATTCCCACACATTGTGGGAGG - Intergenic
1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG + Intronic
1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG + Intergenic
1043845820 8:85162365-85162387 TGATCCCCACACATCGAGGGAGG - Intergenic
1045306892 8:100965415-100965437 TAATTCCCACATGTAGAGGGAGG - Intergenic
1050894900 9:10873827-10873849 TCATTCCCACATATTGAGAGAGG - Intergenic
1056717375 9:89043224-89043246 TCATTCTCACACCTACAGCCTGG - Intronic
1060746679 9:126139503-126139525 TCATACACACACAGAGAGAGGGG - Intergenic
1187673672 X:21693786-21693808 TCATTCCCAGACATAGAAAAAGG + Intergenic
1188641491 X:32510969-32510991 ACATACACACACATAGAGAGAGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1194332276 X:92598586-92598608 ACATTCCCACAAATAGTGCATGG - Intronic
1200640981 Y:5717637-5717659 ACATTCCCACAAATAGTGCATGG - Intronic