ID: 1192493644

View in Genome Browser
Species Human (GRCh38)
Location X:71598386-71598408
Sequence GTCATTCCCACACATAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1587
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 1578}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493644_1192493650 6 Left 1192493644 X:71598386-71598408 CCCGCTCTATGTGTGGGAATGAC 0: 1
1: 0
2: 0
3: 8
4: 1578
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493644_1192493649 1 Left 1192493644 X:71598386-71598408 CCCGCTCTATGTGTGGGAATGAC 0: 1
1: 0
2: 0
3: 8
4: 1578
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493644_1192493648 -8 Left 1192493644 X:71598386-71598408 CCCGCTCTATGTGTGGGAATGAC 0: 1
1: 0
2: 0
3: 8
4: 1578
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493644 Original CRISPR GTCATTCCCACACATAGAGC GGG (reversed) Intronic
903389927 1:22956416-22956438 GTCACTCCCACACACAGAACTGG - Intronic
905262656 1:36730565-36730587 GTCATTACCAAACATCGAGAGGG + Intergenic
916422713 1:164651441-164651463 GTCATTAACGCACAGAGAGCGGG + Intronic
919205348 1:194415826-194415848 GTATTTTCCACACCTAGAGCTGG + Intergenic
920112581 1:203597774-203597796 GCCACCCCCACACACAGAGCTGG + Intergenic
920192870 1:204205393-204205415 GTCTTTCCAACAGATAGTGCTGG - Intronic
922029578 1:221784867-221784889 GTCATTACCACACAGAGATGAGG - Intergenic
922612805 1:226942387-226942409 GTCACTGCCACACATTTAGCAGG - Intronic
923145149 1:231192602-231192624 GTCATTCACACACAAAGGACTGG + Intronic
1062891376 10:1063274-1063296 GTCTTTCAGACACAGAGAGCAGG - Intronic
1066021686 10:31310099-31310121 GTAATTCCCTCACATACATCCGG - Intergenic
1066240089 10:33525061-33525083 TTCCTTCCCACCCACAGAGCTGG + Intergenic
1067779004 10:49185290-49185312 GTCTTTCCCACACACAGAGTAGG - Intronic
1068156288 10:53203845-53203867 GTCTTTCCTACAAATAGTGCTGG + Intergenic
1069940627 10:71952884-71952906 GTCATTCCCACACCTCCATCTGG - Intergenic
1072499708 10:96001308-96001330 CTTATTCATACACATAGAGCAGG + Intronic
1074764714 10:116692128-116692150 GTCAGTCCCACAACAAGAGCTGG - Intronic
1077270455 11:1676089-1676111 GTCTTTTCCACAAATAGTGCTGG - Intergenic
1080277774 11:30522682-30522704 GCCATTCCCACACGCAGGGCAGG - Intronic
1082322593 11:51094379-51094401 AACATTCCTATACATAGAGCAGG + Intergenic
1082322888 11:51098632-51098654 AACATTCCTATACATAGAGCAGG + Intergenic
1082324616 11:51123504-51123526 AACATTCCTATACATAGAGCAGG + Intergenic
1082327639 11:51166867-51166889 AACATTCCTATACATAGAGCAGG + Intergenic
1082329327 11:51191518-51191540 AACATTCCTATACATAGAGCAGG + Intergenic
1082331198 11:51218717-51218739 AACATTCCTATACATAGAGCAGG + Intergenic
1082334153 11:51261728-51261750 AACATTCCTATACATAGAGCAGG + Intergenic
1082334976 11:51273632-51273654 AACATTCCTATACATAGAGCAGG + Intergenic
1082335856 11:51286380-51286402 AACATTCCTATACATAGAGCAGG + Intergenic
1082336739 11:51299135-51299157 AACATTCCTATACATAGAGCAGG + Intergenic
1082338021 11:51317842-51317864 AACATTCCCATAGATAGAGCAGG + Intergenic
1082340292 11:51350990-51351012 AACATTCCTATACATAGAGCAGG + Intergenic
1082340883 11:51359492-51359514 AACATTCCTATACATAGAGCAGG + Intergenic
1082340943 11:51360342-51360364 AACATTCCTATACATAGAGCAGG + Intergenic
1082341058 11:51362041-51362063 AACATTCCTATACATAGAGCAGG + Intergenic
1082341116 11:51362891-51362913 AACATTCCTATACATAGAGCAGG + Intergenic
1082342693 11:51385844-51385866 AACATTCCTATACATAGAGCAGG + Intergenic
1082343390 11:51396043-51396065 AACATTCCTATACATAGAGCAGG + Intergenic
1082344208 11:51407943-51407965 AACATTCCTATACATAGAGCAGG + Intergenic
1082344499 11:51412194-51412216 AACATTCCTATACATAGAGCAGG + Intergenic
1082345490 11:51426647-51426669 AACATTCCTACAGATAGAGCAGG + Intergenic
1082346424 11:51440250-51440272 AACATTCCTATACATAGAGCAGG + Intergenic
1082346889 11:51447052-51447074 AACATTCCTATACATAGAGCAGG + Intergenic
1082348122 11:51464900-51464922 AACATTCCTATACATAGAGCAGG + Intergenic
1082348297 11:51467450-51467472 AACATTCCTATACATAGAGCAGG + Intergenic
1082349877 11:51490226-51490248 AACATTCCTATACATAGAGCAGG + Intergenic
1082350530 11:51499577-51499599 AACATTCCTATACATAGAGCAGG + Intergenic
1082351354 11:51511480-51511502 AGCATTCCTATACATAGAGCAGG + Intergenic
1082353172 11:51537841-51537863 AACATTCCTATACATAGAGCAGG + Intergenic
1082354235 11:51553145-51553167 AACATTCCTATACATAGAGCAGG + Intergenic
1082354292 11:51553995-51554017 AACATTCCTATACATAGAGCAGG + Intergenic
1082354979 11:51564199-51564221 AACATTCCTATACATAGAGCAGG + Intergenic
1082356493 11:51586295-51586317 AACATTCCTATACATAGAGCAGG + Intergenic
1082357185 11:51596495-51596517 AACATTCCTATACATAGAGCAGG + Intergenic
1082357241 11:51597345-51597367 AACATTCCTATACATAGAGCAGG + Intergenic
1082357709 11:51604146-51604168 AACATTCCTATACATAGAGCAGG + Intergenic
1082357767 11:51604997-51605019 AACATTCCCATAGATAGAGCAGG + Intergenic
1082359058 11:51623889-51623911 AACATTCCTATACATAGAGCAGG + Intergenic
1082359684 11:51633238-51633260 AACATTCCTATACATAGAGCAGG + Intergenic
1082362315 11:51671319-51671341 AACATTCCTATACATAGAGCAGG + Intergenic
1082362374 11:51672169-51672191 AACATTCCTATACATAGAGCAGG + Intergenic
1082362433 11:51673019-51673041 AACATTCCTATACATAGAGCAGG + Intergenic
1082362899 11:51679819-51679841 AACATTCCTATACATAGAGCAGG + Intergenic
1082363991 11:51695968-51695990 AACATTCCTATACATAGAGCAGG + Intergenic
1082365102 11:51712120-51712142 AACATTCCTATACATAGAGCAGG + Intergenic
1082367872 11:51752073-51752095 AACATTCCTATACATAGAGCAGG + Intergenic
1082369103 11:51769926-51769948 AACATTCCTATACATAGAGCAGG + Intergenic
1082369687 11:51778429-51778451 AACATTCCTACAGATAGAGCAGG + Intergenic
1082370674 11:51792880-51792902 AACATTCCTATACATAGAGCAGG + Intergenic
1082371320 11:51802232-51802254 AACATTCCTATACATAGAGCAGG + Intergenic
1082375364 11:51860889-51860911 AACATTCCTATACATAGAGCAGG + Intergenic
1082376354 11:51875339-51875361 AACATTCCTATACATAGAGCAGG + Intergenic
1082377363 11:51889790-51889812 AACATTCCTATACATAGAGCAGG + Intergenic
1082377888 11:51897442-51897464 AACATTCCTATACATAGAGCAGG + Intergenic
1082378707 11:51909342-51909364 AACATTCCTATACATAGAGCAGG + Intergenic
1082378881 11:51911892-51911914 AACATTCCTACAGATAGAGCAGG + Intergenic
1082380173 11:51930592-51930614 AACATTCCCATAGATAGAGCAGG + Intergenic
1082382341 11:51962177-51962199 AACATTCCTATACATAGAGCAGG + Intergenic
1082383155 11:51974073-51974095 AACATTCCTATACATAGAGCAGG + Intergenic
1082383739 11:51982571-51982593 AACATTCCTACAGATAGAGCAGG + Intergenic
1082384951 11:52000432-52000454 AACATTCCTATACATAGAGCAGG + Intergenic
1082385189 11:52003832-52003854 AACATTCCTATACATAGAGCAGG + Intergenic
1082385249 11:52004682-52004704 AACATTCCTATACATAGAGCAGG + Intergenic
1082387238 11:52033582-52033604 AACATTCCCATAGATAGAGCAGG + Intergenic
1082390194 11:52076936-52076958 AACATTCCTACAGATAGAGCAGG + Intergenic
1082390540 11:52082037-52082059 AACATTCCTATACATAGAGCAGG + Intergenic
1082391006 11:52088837-52088859 AACATTCCTATACATAGAGCAGG + Intergenic
1082391771 11:52099891-52099913 AACATTCCTATACATAGAGCAGG + Intergenic
1082391825 11:52100741-52100763 AACATTCCTACAGATAGAGCAGG + Intergenic
1082394411 11:52138290-52138312 AACATTCCTATACATAGAGCAGG + Intergenic
1082394766 11:52143390-52143412 AACATTCCTATACATAGAGCAGG + Intergenic
1082395463 11:52153590-52153612 AACATTCCTATACATAGAGCAGG + Intergenic
1082396114 11:52162940-52162962 AACATTCCTATACATAGAGCAGG + Intergenic
1082396521 11:52168893-52168915 AACATTCCTATACATAGAGCAGG + Intergenic
1082398390 11:52196089-52196111 AACATTCCTATACATAGAGCAGG + Intergenic
1082398744 11:52201188-52201210 AACATTCCTACAGATAGAGCAGG + Intergenic
1082399100 11:52206289-52206311 AACATTCCTATACATAGAGCAGG + Intergenic
1082400471 11:52225842-52225864 AACATTCCTATACATAGAGCAGG + Intergenic
1082402101 11:52249641-52249663 AACATTCCTATACATAGAGCAGG + Intergenic
1082403223 11:52265961-52265983 AACATTCCTATACATAGAGCAGG + Intergenic
1082403391 11:52268510-52268532 AACATTCCTATACATAGAGCAGG + Intergenic
1082406507 11:52313200-52313222 AACATTCCTATACATAGAGCAGG + Intergenic
1082409036 11:52349761-52349783 AACATTCCCATAGATAGAGCAGG + Intergenic
1082409333 11:52354011-52354033 AACATTCCTATACATAGAGCAGG + Intergenic
1082409392 11:52354861-52354883 AACATTCCTATACATAGAGCAGG + Intergenic
1082409684 11:52359110-52359132 AACATTCCTATACATAGAGCAGG + Intergenic
1082409800 11:52360810-52360832 AACATTCCTATACATAGAGCAGG + Intergenic
1082410413 11:52369511-52369533 AACATTCCTATACATAGAGCAGG + Intergenic
1082411523 11:52385661-52385683 AACATTCCTATACATAGAGCAGG + Intergenic
1082412467 11:52399264-52399286 AACATTCCTATACATAGAGCAGG + Intergenic
1082413644 11:52416267-52416289 AACATTCCTACAGATAGAGCAGG + Intergenic
1082415118 11:52437517-52437539 AACATTCCTACAGATAGAGCAGG + Intergenic
1082415467 11:52442616-52442638 AACATTCCTATACATAGAGCAGG + Intergenic
1082415527 11:52443466-52443488 AACATTCCTATACATAGAGCAGG + Intergenic
1082416421 11:52456219-52456241 AACATTCCTATACATAGAGCAGG + Intergenic
1082419308 11:52497868-52497890 AACATTCCTATACATAGAGCAGG + Intergenic
1082421303 11:52526778-52526800 AACATTCCTACAGATAGAGCAGG + Intergenic
1082425050 11:52581183-52581205 AACATTCCTATACATAGAGCAGG + Intergenic
1082425990 11:52594781-52594803 AACATTCCCATAGATAGAGCAGG + Intergenic
1082426928 11:52608382-52608404 AACATTCCTATACATAGAGCAGG + Intergenic
1082427689 11:52619438-52619460 AACATTCCTATACATAGAGCAGG + Intergenic
1082428322 11:52628789-52628811 AACATTCCTATACATAGAGCAGG + Intergenic
1082429731 11:52649161-52649183 AACATTCCTATACATAGAGCAGG + Intergenic
1082429972 11:52652562-52652584 AACATTCCTATACATAGAGCAGG + Intergenic
1082430093 11:52654262-52654284 AACATTCCTATACATAGAGCAGG + Intergenic
1082430976 11:52667017-52667039 AACATTCCTATACATAGAGCAGG + Intergenic
1082432091 11:52683167-52683189 AACATTCCTATACATAGAGCAGG + Intergenic
1082432570 11:52689965-52689987 AACATTCCTATACATAGAGCAGG + Intergenic
1082435114 11:52726521-52726543 AACATTCCTATACATAGAGCAGG + Intergenic
1082437042 11:52754569-52754591 AACATTCCTATACATAGAGCAGG + Intergenic
1082437341 11:52758819-52758841 AACATTCCTATACATAGAGCAGG + Intergenic
1082437582 11:52762218-52762240 AACATTCCTATACATAGAGCAGG + Intergenic
1082438984 11:52782625-52782647 AACATTCCTATACATAGAGCAGG + Intergenic
1082439042 11:52783475-52783497 AACATTCCTATACATAGAGCAGG + Intergenic
1082439340 11:52787723-52787745 AACATTCCTATACATAGAGCAGG + Intergenic
1082441282 11:52815760-52815782 AACATTCCTATACATAGAGCAGG + Intergenic
1082441819 11:52823409-52823431 AACATTCCTATACATAGAGCAGG + Intergenic
1082445008 11:52869299-52869321 AACATTCCTATACATAGAGCAGG + Intergenic
1082446116 11:52885453-52885475 AACATTCCTATACATAGAGCAGG + Intergenic
1082446415 11:52889702-52889724 AACATTCCTACAGATAGAGCAGG + Intergenic
1082448933 11:52926259-52926281 AACATTCCTATACATAGAGCAGG + Intergenic
1082449229 11:52930513-52930535 AACATTCCTATACATAGAGCAGG + Intergenic
1082449467 11:52933914-52933936 AACATTCCTATACATAGAGCAGG + Intergenic
1082450112 11:52943266-52943288 AACATTCCTACAGATAGAGCAGG + Intergenic
1082450927 11:52955164-52955186 AACATTCCTATACATAGAGCAGG + Intergenic
1082451277 11:52960267-52960289 AACATTCCTATACATAGAGCAGG + Intergenic
1082451511 11:52963670-52963692 AACATTCCTATACATAGAGCAGG + Intergenic
1082452920 11:52984070-52984092 AACATTCCTATACATAGAGCAGG + Intergenic
1082454356 11:53005320-53005342 AACATTCCTATACATAGAGCAGG + Intergenic
1082455759 11:53025720-53025742 AACATTCCTATACATAGAGCAGG + Intergenic
1082460510 11:53094577-53094599 AACATTCCTATACATAGAGCAGG + Intergenic
1082461863 11:53114125-53114147 AACATTCCTATACATAGAGCAGG + Intergenic
1082464333 11:53149830-53149852 AACATTCCTATACATAGAGCAGG + Intergenic
1082464816 11:53156633-53156655 AACATTCCTATACATAGAGCAGG + Intergenic
1082465662 11:53168533-53168555 AACATTCCTATACATAGAGCAGG + Intergenic
1082468634 11:53211894-53211916 AACATTCCTATACATAGAGCAGG + Intergenic
1082469069 11:53218052-53218074 ATCATTCCTATAGATAGAGCAGG + Intergenic
1082469243 11:53220601-53220623 AACATTCCTATACATAGAGCAGG + Intergenic
1082469421 11:53223151-53223173 AACATTCCTATACATAGAGCAGG + Intergenic
1082470314 11:53235911-53235933 AACATTCCTATACATAGAGCAGG + Intergenic
1082470842 11:53243559-53243581 AACATTCCTATACATAGAGCAGG + Intergenic
1082471014 11:53246111-53246133 AACATTCCTATACATAGAGCAGG + Intergenic
1082471820 11:53258012-53258034 AACATTCCTATACATAGAGCAGG + Intergenic
1082472049 11:53261412-53261434 AACATTCCTATACATAGAGCAGG + Intergenic
1082472167 11:53263112-53263134 AACATTCCTATACATAGAGCAGG + Intergenic
1082472637 11:53269912-53269934 AACATTCCTATACATAGAGCAGG + Intergenic
1082474110 11:53291165-53291187 AACATTCCTATACATAGAGCAGG + Intergenic
1082474401 11:53295415-53295437 AACATTCCTATACATAGAGCAGG + Intergenic
1082476808 11:53330271-53330293 AACATTCCTATACATAGAGCAGG + Intergenic
1082476984 11:53332820-53332842 AACATTCCCATAGATAGAGCAGG + Intergenic
1082478330 11:53352375-53352397 AACATTCCTATACATAGAGCAGG + Intergenic
1082480753 11:53387245-53387267 AACATTCCTATACATAGAGCAGG + Intergenic
1082481344 11:53395745-53395767 AACATTCCTATACATAGAGCAGG + Intergenic
1082483607 11:53428058-53428080 AACATTCCTATACATAGAGCAGG + Intergenic
1082485026 11:53448444-53448466 AACATTCCTATACATAGAGCAGG + Intergenic
1082486318 11:53467140-53467162 AACATTCCCATAGATAGAGCAGG + Intergenic
1082486733 11:53473091-53473113 AACATTCCTATACATAGAGCAGG + Intergenic
1082487675 11:53486689-53486711 AACATTCCTATACATAGAGCAGG + Intergenic
1082490311 11:53524784-53524806 AACATTCCTATACATAGAGCAGG + Intergenic
1082491196 11:53536449-53536471 AACATTCCTACAGATAGAGCAGG + Intergenic
1082492605 11:53556851-53556873 AACATTCCTATACATAGAGCAGG + Intergenic
1082492725 11:53558550-53558572 AACATTCCTATACATAGAGCAGG + Intergenic
1082492842 11:53560250-53560272 AACATTCCTATACATAGAGCAGG + Intergenic
1082492956 11:53561951-53561973 AACATTCCTATACATAGAGCAGG + Intergenic
1082493597 11:53571300-53571322 AACATTCCTATACATAGAGCAGG + Intergenic
1082493654 11:53572150-53572172 AACATTCCTATACATAGAGCAGG + Intergenic
1082494349 11:53582352-53582374 AACATTCCTATACATAGAGCAGG + Intergenic
1082494638 11:53586603-53586625 AACATTCCTACAGATAGAGCAGG + Intergenic
1082494929 11:53590853-53590875 AACATTCCCATAGATAGAGCAGG + Intergenic
1082495169 11:53594258-53594280 AACATTCCCATAGATAGAGCAGG + Intergenic
1082495579 11:53600208-53600230 AACATTCCTATACATAGAGCAGG + Intergenic
1082495694 11:53601910-53601932 AACATTCCTATACATAGAGCAGG + Intergenic
1082496756 11:53617219-53617241 AACATTCCTATACATAGAGCAGG + Intergenic
1082496875 11:53618919-53618941 AACATTCCTATACATAGAGCAGG + Intergenic
1082497107 11:53622321-53622343 AACATTCCTATACATAGAGCAGG + Intergenic
1082497232 11:53624021-53624043 AACATTCCTATACATAGAGCAGG + Intergenic
1082497818 11:53632504-53632526 AACATTCCCATAGATAGAGCAGG + Intergenic
1082497936 11:53634204-53634226 AACATTCCCATAGATAGAGCAGG + Intergenic
1082501322 11:53683181-53683203 AACATTCCTATACATAGAGCAGG + Intergenic
1082501682 11:53688281-53688303 AACATTCCTATACATAGAGCAGG + Intergenic
1082501853 11:53690834-53690856 AACATTCCTATACATAGAGCAGG + Intergenic
1082502957 11:53706987-53707009 AACATTCCTATACATAGAGCAGG + Intergenic
1082504121 11:53723984-53724006 AACATTCCTATACATAGAGCAGG + Intergenic
1082505817 11:53748647-53748669 GACATTCCTATAGATAGAGCAGG + Intergenic
1082507217 11:53769042-53769064 AACATTCCTATACATAGAGCAGG + Intergenic
1082507453 11:53772443-53772465 AACATTCCTATACATAGAGCAGG + Intergenic
1082507925 11:53779248-53779270 AACATTCCTATACATAGAGCAGG + Intergenic
1082509210 11:53797954-53797976 AACATTCCTATACATAGAGCAGG + Intergenic
1082509267 11:53798804-53798826 AACATTCCTATACATAGAGCAGG + Intergenic
1082509805 11:53806454-53806476 AACATTCCTATACATAGAGCAGG + Intergenic
1082510983 11:53823461-53823483 AACATTCCTATACATAGAGCAGG + Intergenic
1082512231 11:53841324-53841346 AACATTCCTATACATAGAGCAGG + Intergenic
1082514833 11:53878738-53878760 AACATTCCTATACATAGAGCAGG + Intergenic
1082515134 11:53882988-53883010 AACATTCCTATACATAGAGCAGG + Intergenic
1082516082 11:53896591-53896613 AACATTCCCATAGATAGAGCAGG + Intergenic
1082516605 11:53904240-53904262 AACATTCCTATACATAGAGCAGG + Intergenic
1082517067 11:53911041-53911063 AACATTCCCATAGATAGAGCAGG + Intergenic
1082518001 11:53924650-53924672 AACATTCCTATACATAGAGCAGG + Intergenic
1082518705 11:53934856-53934878 AACATTCCTATACATAGAGCAGG + Intergenic
1082519056 11:53939956-53939978 AACATTCCTATACATAGAGCAGG + Intergenic
1082519934 11:53952711-53952733 AACATTCCTATACATAGAGCAGG + Intergenic
1082521254 11:53971428-53971450 AACATTCCTATACATAGAGCAGG + Intergenic
1082521831 11:53979931-53979953 AACATTCCTATACATAGAGCAGG + Intergenic
1082521888 11:53980781-53980803 AACATTCCTACAGATAGAGCAGG + Intergenic
1082523667 11:54006613-54006635 AACATTCCTATACATAGAGCAGG + Intergenic
1082524786 11:54022772-54022794 AACATTCCTATACATAGAGCAGG + Intergenic
1082525949 11:54039605-54039627 AACATTCCTATACATAGAGCAGG + Intergenic
1082526944 11:54054039-54054061 AACATTCCTATACATAGAGCAGG + Intergenic
1082527063 11:54055739-54055761 AACATTCCTATACATAGAGCAGG + Intergenic
1082528112 11:54071045-54071067 AACATTCCTATACATAGAGCAGG + Intergenic
1082528653 11:54078696-54078718 AACATTCCTATACATAGAGCAGG + Intergenic
1082528828 11:54081246-54081268 AACATTCCTATACATAGAGCAGG + Intergenic
1082529714 11:54094004-54094026 AACATTCCTATACATAGAGCAGG + Intergenic
1082530002 11:54098254-54098276 AACATTCCTATACATAGAGCAGG + Intergenic
1082530301 11:54102508-54102530 AACATTCCTACAGATAGAGCAGG + Intergenic
1082531657 11:54122074-54122096 AACATTCCTATACATAGAGCAGG + Intergenic
1082532886 11:54139923-54139945 AACATTCCTATACATAGAGCAGG + Intergenic
1082533231 11:54145025-54145047 AACATTCCTATACATAGAGCAGG + Intergenic
1082533809 11:54153527-54153549 AACATTCCTATACATAGAGCAGG + Intergenic
1082533925 11:54155227-54155249 AACATTCCTATACATAGAGCAGG + Intergenic
1082534099 11:54157776-54157798 AACATTCCTATACATAGAGCAGG + Intergenic
1082534507 11:54163727-54163749 AACATTCCTATACATAGAGCAGG + Intergenic
1082534744 11:54167127-54167149 AACATTCCTATACATAGAGCAGG + Intergenic
1082536491 11:54192636-54192658 AACATTCCTATACATAGAGCAGG + Intergenic
1082536668 11:54195188-54195210 AACATTCCTATACATAGAGCAGG + Intergenic
1082537444 11:54206241-54206263 AACATTCCTATACATAGAGCAGG + Intergenic
1082539050 11:54229197-54229219 AACATTCCTATACATAGAGCAGG + Intergenic
1082539995 11:54242969-54242991 AACATTCCTATACATAGAGCAGG + Intergenic
1082540054 11:54243819-54243841 AACATTCCTATACATAGAGCAGG + Intergenic
1082540402 11:54248922-54248944 AACATTCCTATACATAGAGCAGG + Intergenic
1082543341 11:54291440-54291462 AACATTCCTATACATAGAGCAGG + Intergenic
1082543457 11:54293139-54293161 AACATTCCTATACATAGAGCAGG + Intergenic
1082545327 11:54320341-54320363 AACATTCCTATACATAGAGCAGG + Intergenic
1082545386 11:54321191-54321213 AACATTCCTATACATAGAGCAGG + Intergenic
1083386054 11:62311194-62311216 TTCATTGCCACACACAGAGTGGG - Intergenic
1086010292 11:82094678-82094700 GTCATGCACACACATGAAGCTGG + Intergenic
1092603908 12:10098618-10098640 ATAATTCCCACACTTAGAGAAGG - Intronic
1093720335 12:22435232-22435254 GTCATTTCAACAAATAGTGCTGG + Intronic
1098066836 12:66627746-66627768 GTCATTCCCTCAGACATAGCAGG + Intronic
1099958053 12:89370439-89370461 GTCATCTCCATACATTGAGCAGG + Intergenic
1106234848 13:27853069-27853091 GTCCTTACCACAAACAGAGCAGG - Intergenic
1108325007 13:49321618-49321640 GTCACTGCCACACATGGAGAGGG - Intronic
1117166064 14:53035064-53035086 GGCGTTCCCACACATTAAGCTGG + Intergenic
1117915951 14:60678038-60678060 GTCATTCCCAAACACACATCAGG + Intergenic
1119537181 14:75411941-75411963 TTCATTCCCATACTTAGACCAGG - Intergenic
1123321838 15:18687355-18687377 AACATTCCCATTCATAGAGCAGG + Intergenic
1123363975 15:19386611-19386633 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1123367863 15:19451085-19451107 AACATTCCCATTCATAGAGCAGG + Intergenic
1123370657 15:19496955-19496977 AACATTCCCATTCATAGAGCAGG + Intergenic
1123501192 15:20882610-20882632 GTCCTTCCCATACAGAGAACTGG - Intergenic
1123558444 15:21456315-21456337 GTCCTTCCCATACAGAGAACTGG - Intergenic
1123594675 15:21893590-21893612 GTCCTTCCCATACAGAGAACTGG - Intergenic
1126496128 15:49292567-49292589 GTTATTCCCTCACTTACAGCTGG + Intronic
1127304181 15:57685902-57685924 GTCATTCCCACATAGGGAGTGGG + Intronic
1127566120 15:60190133-60190155 GTCCTTCCCACACATTGATTAGG + Intergenic
1127708186 15:61567809-61567831 GTGATTCCCACAGTTAGAGGTGG - Intergenic
1127756618 15:62098395-62098417 GTCCTACACACACAAAGAGCTGG - Intergenic
1128213965 15:65921739-65921761 GTTTTTCCCCCACAAAGAGCTGG + Intronic
1202966794 15_KI270727v1_random:183465-183487 GTCCTTCCCATACAGAGAACTGG - Intergenic
1132496940 16:268378-268400 GCCATCCCCACCCATAGGGCTGG - Exonic
1134131172 16:11651218-11651240 GTCATCCCCACAGCTACAGCTGG + Intergenic
1136951832 16:34729657-34729679 GACATTCCCTTTCATAGAGCAGG - Intergenic
1137393570 16:48101170-48101192 GCCATTCCCACACCTGGGGCAGG - Intronic
1138579140 16:57928375-57928397 TTCATTCCGGCACATGGAGCTGG + Intronic
1140471769 16:75219220-75219242 GTCCTTCCCACTCCTGGAGCAGG - Intronic
1149696914 17:58623301-58623323 TTCATTCCCAGGCATAGATCTGG + Intronic
1154536351 18:15467755-15467777 AACATTCCCTCTCATAGAGCAGG + Intergenic
1154551973 18:15696020-15696042 AACATTCCCTCTCATAGAGCAGG + Intergenic
1154557192 18:15772094-15772116 AACATTCCCTCTCATAGAGCAGG + Intergenic
1154557304 18:15773794-15773816 AACATTCCCTCTCATAGAGCAGG + Intergenic
1154613586 18:16548581-16548603 AACATTCCCTCTCATAGAGCAGG + Intergenic
1154644854 18:16977917-16977939 GACATTCCCTATCATAGAGCAGG + Intergenic
1154703898 18:17786745-17786767 AACATTCCCAATCATAGAGCAGG + Intergenic
1154773906 18:18746571-18746593 AACATTCCCAATCATAGAGCAGG + Intergenic
1154837554 18:19622744-19622766 ATCATTCCCTATCATAGAGCAGG + Intergenic
1154842482 18:19690576-19690598 GACATTCCCTATCATAGAGCAGG + Intergenic
1154908392 18:20609758-20609780 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154908913 18:20617924-20617946 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154910191 18:20637945-20637967 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154910542 18:20643442-20643464 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154911165 18:20653263-20653285 AACATTCCCATTCATAGAGCAGG + Intergenic
1154911314 18:20655641-20655663 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154911651 18:20661089-20661111 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154912167 18:20669085-20669107 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154912643 18:20676574-20676596 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154912799 18:20679131-20679153 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154912817 18:20679473-20679495 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154913268 18:20686450-20686472 AACATTCCCTTACATAGAGCAGG + Intergenic
1154913680 18:20692932-20692954 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154919134 18:20776050-20776072 AACATTCCCATTCATAGAGCAGG + Intergenic
1154921735 18:20817093-20817115 AACATTCCCATTCATAGAGCAGG - Intergenic
1154922060 18:20821970-20821992 AACATTCCCTTACATAGAGCAGG - Intergenic
1154925734 18:20930692-20930714 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154926016 18:20935438-20935460 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1154926035 18:20935780-20935802 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1155861293 18:30903685-30903707 CTCATTCTCACACCTAGACCTGG + Intergenic
1157999547 18:52600241-52600263 GTCATTTCAATAAATAGAGCTGG - Intronic
1158825018 18:61208897-61208919 GTCACTACCACACCTAGGGCTGG + Intergenic
1159095843 18:63900644-63900666 GTCATTGCCACAGAAAGAGGTGG + Intronic
1161216363 19:3096847-3096869 GTCAGTGCCACGCAGAGAGCCGG + Intronic
932924748 2:75959945-75959967 CTGATTCACACACATACAGCAGG - Intergenic
934333131 2:92092911-92092933 AATATTCCCATACATAGAGCAGG + Intergenic
934338107 2:92220136-92220158 ATCATTCCCTTTCATAGAGCAGG + Intergenic
934348971 2:92392485-92392507 GACATTCCCTTTCATAGAGCAGG + Intergenic
934368737 2:92706823-92706845 ATCATTCCCTTTCATAGAGCAGG + Intergenic
934371048 2:92743695-92743717 AACATTCCCATTCATAGAGCAGG + Intergenic
934371116 2:92744718-92744740 CACATTCCCTCTCATAGAGCAGG + Intergenic
934381844 2:92916546-92916568 GACATTCCCTTTCATAGAGCAGG + Intergenic
934386066 2:92984813-92984835 AACATTCCCTCTCATAGAGCAGG + Intergenic
934404034 2:93276025-93276047 AACATTCCCTCTCATAGAGCAGG + Intergenic
934406985 2:93323238-93323260 GACATTCCCTTTCATAGAGCAGG + Intergenic
934418600 2:93509708-93509730 ATCATTCCCTTTCATAGAGCAGG + Intergenic
934437732 2:93817601-93817623 AACATTCCCATTCATAGAGCAGG + Intergenic
934452069 2:94049186-94049208 GACATTCCCTTTCATAGAGCAGG + Intergenic
934456015 2:94162482-94162504 GACATTCCCTTTCATAGAGCAGG + Intergenic
934469380 2:94503452-94503474 GACATTCCCTTTCATAGAGCAGG - Intergenic
935121746 2:100189100-100189122 TACATTCCCACCCATAGTGCAGG + Intergenic
938407619 2:131041154-131041176 GCCCTTCCCACACATGCAGCTGG + Intronic
942591494 2:177552075-177552097 GTCATGCCCACACCTAGCTCAGG + Exonic
942598620 2:177618013-177618035 GTCATGCCCACACCTAGCTCAGG + Exonic
943744888 2:191451824-191451846 GTCTTTTCAACACATAGTGCTGG - Intergenic
946012384 2:216575940-216575962 CTCTTGCCCACACATATAGCTGG + Intronic
1170754414 20:19186857-19186879 GTCTTTCCAACAAATAGTGCTGG - Intergenic
1171218456 20:23371391-23371413 CTCATTTCCACACCTAGAGATGG + Exonic
1171578805 20:26372710-26372732 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1171579076 20:26377619-26377641 AACATTCCCTTACATAGAGCAGG + Intergenic
1171579231 20:26380158-26380180 AACATTCCCTTACATAGAGCAGG + Intergenic
1171592243 20:26620262-26620284 AACATTCCCATTCATAGAGCAGG + Intergenic
1171592909 20:26630117-26630139 AACATTCCCATTCATAGAGCAGG + Intergenic
1171593450 20:26638683-26638705 AACATTCCCATTCATAGAGCAGG + Intergenic
1171593631 20:26641403-26641425 AACATTCCCATTCATAGAGCAGG + Intergenic
1171593929 20:26645996-26646018 AACATTCCCATTCATAGAGCAGG + Intergenic
1171594359 20:26652243-26652265 AACATTCCCATTCATAGAGCAGG + Intergenic
1171594541 20:26654963-26654985 AACATTCCCATTCATAGAGCAGG + Intergenic
1171595085 20:26663122-26663144 AACATTCCCATTCATAGAGCAGG + Intergenic
1171595377 20:26667544-26667566 AACATTCCCATTCATAGAGCAGG + Intergenic
1171595563 20:26670264-26670286 AACATTCCCATTCATAGAGCAGG + Intergenic
1171596109 20:26678423-26678445 AACATTCCCATTCATAGAGCAGG + Intergenic
1171596278 20:26680972-26680994 AACATTCCCATTCATAGAGCAGG + Intergenic
1171596462 20:26683691-26683713 AACATTCCCATTCATAGAGCAGG + Intergenic
1171597187 20:26694568-26694590 AACATTCCCATTCATAGAGCAGG + Intergenic
1171597529 20:26699667-26699689 AACATTCCCATTCATAGAGCAGG + Intergenic
1171597707 20:26702385-26702407 AACATTCCCATTCATAGAGCAGG + Intergenic
1171598250 20:26710543-26710565 AACATTCCCATTCATAGAGCAGG + Intergenic
1171598397 20:26712751-26712773 AACATTCCCATTCATAGAGCAGG + Intergenic
1171598578 20:26715470-26715492 AACATTCCCATTCATAGAGCAGG + Intergenic
1171598760 20:26718190-26718212 AACATTCCCATTCATAGAGCAGG + Intergenic
1171599123 20:26723629-26723651 AACATTCCCATTCATAGAGCAGG + Intergenic
1171600015 20:26737049-26737071 AACATTCCCATTCATAGAGCAGG + Intergenic
1171600401 20:26742833-26742855 AACATTCCCATTCATAGAGCAGG + Intergenic
1171600577 20:26745552-26745574 AACATTCCCATTCATAGAGCAGG + Intergenic
1171601153 20:26754048-26754070 AACATTCCCATTCATAGAGCAGG + Intergenic
1171601334 20:26756767-26756789 AACATTCCCATTCATAGAGCAGG + Intergenic
1171601402 20:26757785-26757807 AACATTCCCATTCATAGAGCAGG + Intergenic
1171601563 20:26760162-26760184 AACATTCCCATTCATAGAGCAGG + Intergenic
1171602295 20:26771037-26771059 AACATTCCCATTCATAGAGCAGG + Intergenic
1171602656 20:26776476-26776498 AACATTCCCATTCATAGAGCAGG + Intergenic
1171602854 20:26779537-26779559 AACATTCCCATTCATAGAGCAGG + Intergenic
1171603035 20:26782256-26782278 AACATTCCCATTCATAGAGCAGG + Intergenic
1171603145 20:26783957-26783979 AACATTCCCATTCATAGAGCAGG + Intergenic
1171603485 20:26789052-26789074 AACATTCCCATTCATAGAGCAGG + Intergenic
1171603668 20:26791771-26791793 AACATTCCCATTCATAGAGCAGG + Intergenic
1171603959 20:26796192-26796214 AACATTCCCATTCATAGAGCAGG + Intergenic
1171604121 20:26798570-26798592 AACATTCCCATTCATAGAGCAGG + Intergenic
1171604305 20:26801289-26801311 AACATTCCCATTCATAGAGCAGG + Intergenic
1171605612 20:26821007-26821029 AACATTCCCATTCATAGAGCAGG + Intergenic
1171605952 20:26826108-26826130 AACATTCCCATTCATAGAGCAGG + Intergenic
1171606205 20:26829848-26829870 AACATTCCCATTCATAGAGCAGG + Intergenic
1171606388 20:26832565-26832587 AACATTCCCATTCATAGAGCAGG + Intergenic
1171607333 20:26846846-26846868 AACATTCCCATTCATAGAGCAGG + Intergenic
1171608464 20:26863846-26863868 AACATTCCCATTCATAGAGCAGG + Intergenic
1171608646 20:26866565-26866587 AACATTCCCATTCATAGAGCAGG + Intergenic
1171608755 20:26868266-26868288 AACATTCCCATTCATAGAGCAGG + Intergenic
1171609097 20:26873361-26873383 AACATTCCCATTCATAGAGCAGG + Intergenic
1171609460 20:26878800-26878822 AACATTCCCATTCATAGAGCAGG + Intergenic
1171609569 20:26880501-26880523 AACATTCCCATTCATAGAGCAGG + Intergenic
1171609656 20:26881860-26881882 GGCATTCCCTTTCATAGAGCAGG + Intergenic
1171609938 20:26885939-26885961 AACATTCCCATTCATAGAGCAGG + Intergenic
1171610326 20:26891718-26891740 AACATTCCCATTCATAGAGCAGG + Intergenic
1171610917 20:26900553-26900575 AACATTCCCATTCATAGAGCAGG + Intergenic
1171611101 20:26903272-26903294 AACATTCCCATTCATAGAGCAGG + Intergenic
1171611284 20:26905992-26906014 AACATTCCCATTCATAGAGCAGG + Intergenic
1171611463 20:26908714-26908736 AACATTCCCATTCATAGAGCAGG + Intergenic
1171611645 20:26911434-26911456 AACATTCCCATTCATAGAGCAGG + Intergenic
1171611827 20:26914153-26914175 AACATTCCCATTCATAGAGCAGG + Intergenic
1171612185 20:26919589-26919611 AACATTCCCATTCATAGAGCAGG + Intergenic
1171612368 20:26922307-26922329 AACATTCCCATTCATAGAGCAGG + Intergenic
1171612477 20:26924008-26924030 AACATTCCCATTCATAGAGCAGG + Intergenic
1171613202 20:26934891-26934913 AACATTCCCATTCATAGAGCAGG + Intergenic
1171613569 20:26940330-26940352 AACATTCCCATTCATAGAGCAGG + Intergenic
1171613749 20:26943049-26943071 AACATTCCCATTCATAGAGCAGG + Intergenic
1171613931 20:26945769-26945791 AACATTCCCATTCATAGAGCAGG + Intergenic
1171614111 20:26948490-26948512 AACATTCCCATTCATAGAGCAGG + Intergenic
1171614294 20:26951209-26951231 AACATTCCCATTCATAGAGCAGG + Intergenic
1171614477 20:26953928-26953950 AACATTCCCATTCATAGAGCAGG + Intergenic
1171614968 20:26961408-26961430 AACATTCCCATTCATAGAGCAGG + Intergenic
1171615396 20:26967693-26967715 AACATTCCCATTCATAGAGCAGG + Intergenic
1171615778 20:26973474-26973496 AACATTCCCATTCATAGAGCAGG + Intergenic
1171616839 20:26989279-26989301 AACATTCCCATTCATAGAGCAGG + Intergenic
1171617017 20:26992000-26992022 AACATTCCCATTCATAGAGCAGG + Intergenic
1171617591 20:27000500-27000522 AACATTCCCATTCATAGAGCAGG + Intergenic
1171617959 20:27006110-27006132 AACATTCCCATTCATAGAGCAGG + Intergenic
1171618118 20:27008488-27008510 AACATTCCCATTCATAGAGCAGG + Intergenic
1171618228 20:27010190-27010212 AACATTCCCATTCATAGAGCAGG + Intergenic
1171618411 20:27012910-27012932 AACATTCCCATTCATAGAGCAGG + Intergenic
1171618883 20:27020050-27020072 AACATTCCCATTCATAGAGCAGG + Intergenic
1171619085 20:27023113-27023135 AACATTCCCATTCATAGAGCAGG + Intergenic
1171619177 20:27024472-27024494 AACATTCCCATTCATAGAGCAGG + Intergenic
1171619656 20:27031610-27031632 AACATTCCCATTCATAGAGCAGG + Intergenic
1171619993 20:27036712-27036734 AACATTCCCATTCATAGAGCAGG + Intergenic
1171620103 20:27038413-27038435 AACATTCCCATTCATAGAGCAGG + Intergenic
1171620600 20:27045894-27045916 AACATTCCCATTCATAGAGCAGG + Intergenic
1171621272 20:27055916-27055938 AACATTCCCATTCATAGAGCAGG + Intergenic
1171621456 20:27058636-27058658 AACATTCCCATTCATAGAGCAGG + Intergenic
1171621826 20:27064073-27064095 AACATTCCCATTCATAGAGCAGG + Intergenic
1171622148 20:27069175-27069197 AACATTCCCATTCATAGAGCAGG + Intergenic
1171622512 20:27074616-27074638 AACATTCCCATTCATAGAGCAGG + Intergenic
1171622696 20:27077341-27077363 AACATTCCCATTCATAGAGCAGG + Intergenic
1171623153 20:27084135-27084157 AACATTCCCATTCATAGAGCAGG + Intergenic
1171623324 20:27086683-27086705 AACATTCCCATTCATAGAGCAGG + Intergenic
1171623819 20:27094167-27094189 AACATTCCCATTCATAGAGCAGG + Intergenic
1171624151 20:27099272-27099294 AACATTCCCATTCATAGAGCAGG + Intergenic
1171624333 20:27101991-27102013 AACATTCCCATTCATAGAGCAGG + Intergenic
1171624879 20:27110147-27110169 AACATTCCCATTCATAGAGCAGG + Intergenic
1171625171 20:27114568-27114590 AACATTCCCATTCATAGAGCAGG + Intergenic
1171625519 20:27119832-27119854 AACATTCCCATTCATAGAGCAGG + Intergenic
1171625706 20:27122553-27122575 AACATTCCCATTCATAGAGCAGG + Intergenic
1171625954 20:27126293-27126315 AACATTCCCATTCATAGAGCAGG + Intergenic
1171626184 20:27129688-27129710 AACATTCCCATTCATAGAGCAGG + Intergenic
1171626477 20:27134111-27134133 AACATTCCCATTCATAGAGCAGG + Intergenic
1171626954 20:27141247-27141269 AACATTCCCATTCATAGAGCAGG + Intergenic
1171627247 20:27145668-27145690 AACATTCCCATTCATAGAGCAGG + Intergenic
1171627610 20:27151107-27151129 AACATTCCCATTCATAGAGCAGG + Intergenic
1171627770 20:27153484-27153506 AACATTCCCATTCATAGAGCAGG + Intergenic
1171628433 20:27163337-27163359 AACATTCCCATTCATAGAGCAGG + Intergenic
1171628729 20:27167758-27167780 AACATTCCCATTCATAGAGCAGG + Intergenic
1171629183 20:27174555-27174577 AACATTCCCATTCATAGAGCAGG + Intergenic
1171629899 20:27185262-27185284 AACATTCCCATTCATAGAGCAGG + Intergenic
1171630079 20:27187983-27188005 AACATTCCCATTCATAGAGCAGG + Intergenic
1171630189 20:27189684-27189706 AACATTCCCATTCATAGAGCAGG + Intergenic
1171631005 20:27201921-27201943 GGCATTCCCTTTCATAGAGCAGG + Intergenic
1171631283 20:27206000-27206022 AACATTCCCATTCATAGAGCAGG + Intergenic
1171631465 20:27208719-27208741 AACATTCCCATTCATAGAGCAGG + Intergenic
1171631754 20:27213139-27213161 AACATTCCCATTCATAGAGCAGG + Intergenic
1171632155 20:27219261-27219283 AACATTCCCATTCATAGAGCAGG + Intergenic
1171632334 20:27221978-27222000 AACATTCCCATTCATAGAGCAGG + Intergenic
1171632878 20:27230137-27230159 AACATTCCCATTCATAGAGCAGG + Intergenic
1171633064 20:27232860-27232882 AACATTCCCATTCATAGAGCAGG + Intergenic
1171633428 20:27238299-27238321 AACATTCCCATTCATAGAGCAGG + Intergenic
1171633987 20:27246627-27246649 AACATTCCCATTCATAGAGCAGG + Intergenic
1171634170 20:27249347-27249369 AACATTCCCATTCATAGAGCAGG + Intergenic
1171634951 20:27260911-27260933 AACATTCCCATTCATAGAGCAGG + Intergenic
1171635135 20:27263628-27263650 AACATTCCCATTCATAGAGCAGG + Intergenic
1171635318 20:27266347-27266369 AACATTCCCATTCATAGAGCAGG + Intergenic
1171635822 20:27273823-27273845 AACATTCCCATTCATAGAGCAGG + Intergenic
1171636002 20:27276542-27276564 AACATTCCCATTCATAGAGCAGG + Intergenic
1171636424 20:27282830-27282852 AACATTCCCATTCATAGAGCAGG + Intergenic
1171636608 20:27285553-27285575 AACATTCCCATTCATAGAGCAGG + Intergenic
1171636788 20:27288274-27288296 AACATTCCCATTCATAGAGCAGG + Intergenic
1171637374 20:27297243-27297265 AACATTCCCATTCATAGAGCAGG + Intergenic
1171637621 20:27300978-27301000 AACATTCCCATTCATAGAGCAGG + Intergenic
1171637803 20:27303698-27303720 AACATTCCCATTCATAGAGCAGG + Intergenic
1171638552 20:27314916-27314938 AACATTCCCATTCATAGAGCAGG + Intergenic
1171638955 20:27321039-27321061 AACATTCCCATTCATAGAGCAGG + Intergenic
1171639501 20:27329197-27329219 AACATTCCCATTCATAGAGCAGG + Intergenic
1171639595 20:27330556-27330578 AACATTCCCATTCATAGAGCAGG + Intergenic
1171639852 20:27334292-27334314 AACATTCCCATTCATAGAGCAGG + Intergenic
1171640749 20:27347719-27347741 AACATTCCCATTCATAGAGCAGG + Intergenic
1171641032 20:27351971-27351993 AACATTCCCATTCATAGAGCAGG + Intergenic
1171642557 20:27374746-27374768 AACATTCCCATTCATAGAGCAGG + Intergenic
1171643102 20:27382902-27382924 AACATTCCCATTCATAGAGCAGG + Intergenic
1171643463 20:27388339-27388361 AACATTCCCATTCATAGAGCAGG + Intergenic
1171644195 20:27399220-27399242 AACATTCCCATTCATAGAGCAGG + Intergenic
1171644327 20:27401264-27401286 AACATTCCCATTCATAGAGCAGG + Intergenic
1171644508 20:27403984-27404006 AACATTCCCATTCATAGAGCAGG + Intergenic
1171645169 20:27413844-27413866 AACATTCCCATTCATAGAGCAGG + Intergenic
1171645549 20:27419623-27419645 AACATTCCCATTCATAGAGCAGG + Intergenic
1171647225 20:27444423-27444445 AACATTCCCATTCATAGAGCAGG + Intergenic
1171647405 20:27447142-27447164 AACATTCCCATTCATAGAGCAGG + Intergenic
1171648546 20:27464143-27464165 AACATTCCCATTCATAGAGCAGG + Intergenic
1171648842 20:27468563-27468585 AACATTCCCATTCATAGAGCAGG + Intergenic
1171649793 20:27482839-27482861 AACATTCCCATTCATAGAGCAGG + Intergenic
1171650342 20:27490996-27491018 AACATTCCCATTCATAGAGCAGG + Intergenic
1171650524 20:27493714-27493736 AACATTCCCATTCATAGAGCAGG + Intergenic
1171650885 20:27499151-27499173 AACATTCCCATTCATAGAGCAGG + Intergenic
1171651069 20:27501869-27501891 AACATTCCCATTCATAGAGCAGG + Intergenic
1171651329 20:27505862-27505884 AACATTCCCATTCATAGAGCAGG + Intergenic
1171651706 20:27511643-27511665 AACATTCCCATTCATAGAGCAGG + Intergenic
1171652053 20:27516740-27516762 AACATTCCCATTCATAGAGCAGG + Intergenic
1171652337 20:27521233-27521255 AACATTCCCATTCATAGAGCAGG + Intergenic
1171652937 20:27530416-27530438 AACATTCCCATTCATAGAGCAGG + Intergenic
1171654061 20:27547417-27547439 AACATTCCCATTCATAGAGCAGG + Intergenic
1171654243 20:27550136-27550158 AACATTCCCATTCATAGAGCAGG + Intergenic
1171654607 20:27555573-27555595 AACATTCCCATTCATAGAGCAGG + Intergenic
1171654788 20:27558295-27558317 AACATTCCCATTCATAGAGCAGG + Intergenic
1171655159 20:27563731-27563753 AACATTCCCATTCATAGAGCAGG + Intergenic
1171655634 20:27570873-27570895 AACATTCCCATTCATAGAGCAGG + Intergenic
1171655749 20:27572571-27572593 AACATTCCCATTCATAGAGCAGG + Intergenic
1171656278 20:27580556-27580578 AACATTCCCATTCATAGAGCAGG + Intergenic
1171656919 20:27590241-27590263 AACATTCCCATTCATAGAGCAGG + Intergenic
1171657465 20:27598399-27598421 AACATTCCCATTCATAGAGCAGG + Intergenic
1171657861 20:27604347-27604369 AACATTCCCATTCATAGAGCAGG + Intergenic
1171658353 20:27611829-27611851 AACATTCCCATTCATAGAGCAGG + Intergenic
1171658554 20:27614890-27614912 AACATTCCCATTCATAGAGCAGG + Intergenic
1171658733 20:27617609-27617631 AACATTCCCATTCATAGAGCAGG + Intergenic
1171659020 20:27622027-27622049 AACATTCCCATTCATAGAGCAGG + Intergenic
1171659181 20:27624404-27624426 AACATTCCCATTCATAGAGCAGG + Intergenic
1171659364 20:27627123-27627145 AACATTCCCATTCATAGAGCAGG + Intergenic
1171659614 20:27630860-27630882 GGCATTCCCTTTCATAGAGCAGG + Intergenic
1171659700 20:27632049-27632071 AACATTCCCATTCATAGAGCAGG + Intergenic
1171660441 20:27643093-27643115 AACATTCCCATTCATAGAGCAGG + Intergenic
1171660645 20:27646154-27646176 AACATTCCCATTCATAGAGCAGG + Intergenic
1171660894 20:27649894-27649916 AACATTCCCATTCATAGAGCAGG + Intergenic
1171661259 20:27655335-27655357 AACATTCCCATTCATAGAGCAGG + Intergenic
1171661582 20:27660096-27660118 AACATTCCCATTCATAGAGCAGG + Intergenic
1171662199 20:27669270-27669292 AACATTCCCATTCATAGAGCAGG + Intergenic
1171662383 20:27671987-27672009 AACATTCCCATTCATAGAGCAGG + Intergenic
1171662566 20:27674706-27674728 AACATTCCCATTCATAGAGCAGG + Intergenic
1171662747 20:27677426-27677448 AACATTCCCATTCATAGAGCAGG + Intergenic
1171663220 20:27684568-27684590 AACATTCCCATTCATAGAGCAGG + Intergenic
1171663392 20:27687117-27687139 AACATTCCCATTCATAGAGCAGG + Intergenic
1171663726 20:27692044-27692066 AACATTCCCATTCATAGAGCAGG + Intergenic
1171663897 20:27694592-27694614 AACATTCCCATTCATAGAGCAGG + Intergenic
1171664078 20:27697312-27697334 AACATTCCCATTCATAGAGCAGG + Intergenic
1171664437 20:27702750-27702772 AACATTCCCATTCATAGAGCAGG + Intergenic
1171664547 20:27704451-27704473 AACATTCCCATTCATAGAGCAGG + Intergenic
1171664926 20:27710235-27710257 AACATTCCCATTCATAGAGCAGG + Intergenic
1171665256 20:27715159-27715181 AACATTCCCATTCATAGAGCAGG + Intergenic
1171665435 20:27717878-27717900 AACATTCCCATTCATAGAGCAGG + Intergenic
1171665615 20:27720597-27720619 AACATTCCCATTCATAGAGCAGG + Intergenic
1171665724 20:27722299-27722321 AACATTCCCATTCATAGAGCAGG + Intergenic
1171665903 20:27725016-27725038 AACATTCCCATTCATAGAGCAGG + Intergenic
1171666075 20:27727564-27727586 AACATTCCCATTCATAGAGCAGG + Intergenic
1171666625 20:27735723-27735745 AACATTCCCATTCATAGAGCAGG + Intergenic
1171667867 20:27754415-27754437 AACATTCCCATTCATAGAGCAGG + Intergenic
1171668035 20:27756962-27756984 AACATTCCCATTCATAGAGCAGG + Intergenic
1171668219 20:27759682-27759704 AACATTCCCATTCATAGAGCAGG + Intergenic
1171668485 20:27763588-27763610 AACATTCCCATTCATAGAGCAGG + Intergenic
1171668834 20:27768856-27768878 AACATTCCCATTCATAGAGCAGG + Intergenic
1171669014 20:27771573-27771595 AACATTCCCATTCATAGAGCAGG + Intergenic
1171669124 20:27773275-27773297 AACATTCCCATTCATAGAGCAGG + Intergenic
1171669304 20:27775993-27776015 AACATTCCCATTCATAGAGCAGG + Intergenic
1171669484 20:27778712-27778734 AACATTCCCATTCATAGAGCAGG + Intergenic
1171669668 20:27781434-27781456 AACATTCCCATTCATAGAGCAGG + Intergenic
1171669782 20:27783136-27783158 AACATTCCCATTCATAGAGCAGG + Intergenic
1171670163 20:27788916-27788938 AACATTCCCATTCATAGAGCAGG + Intergenic
1171670526 20:27794356-27794378 AACATTCCCATTCATAGAGCAGG + Intergenic
1171670614 20:27795715-27795737 GGCATTCCCTTTCATAGAGCAGG + Intergenic
1171670770 20:27797922-27797944 AACATTCCCATTCATAGAGCAGG + Intergenic
1171670979 20:27800979-27801001 AACATTCCCATTCATAGAGCAGG + Intergenic
1171671159 20:27803698-27803720 AACATTCCCATTCATAGAGCAGG + Intergenic
1171671327 20:27806246-27806268 AACATTCCCATTCATAGAGCAGG + Intergenic
1171671764 20:27812701-27812723 AACATTCCCATTCATAGAGCAGG + Intergenic
1171672126 20:27818139-27818161 AACATTCCCATTCATAGAGCAGG + Intergenic
1171673098 20:27832758-27832780 AACATTCCCATTCATAGAGCAGG + Intergenic
1171673211 20:27834459-27834481 AACATTCCCATTCATAGAGCAGG + Intergenic
1171673395 20:27837179-27837201 AACATTCCCATTCATAGAGCAGG + Intergenic
1171673760 20:27842620-27842642 AACATTCCCATTCATAGAGCAGG + Intergenic
1171673871 20:27844321-27844343 AACATTCCCATTCATAGAGCAGG + Intergenic
1171674053 20:27847040-27847062 AACATTCCCATTCATAGAGCAGG + Intergenic
1171674222 20:27849588-27849610 AACATTCCCATTCATAGAGCAGG + Intergenic
1171674876 20:27859449-27859471 AACATTCCCATTCATAGAGCAGG + Intergenic
1171675396 20:27867274-27867296 AACATTCCCATTCATAGAGCAGG + Intergenic
1171675579 20:27869995-27870017 AACATTCCCATTCATAGAGCAGG + Intergenic
1171675833 20:27873799-27873821 AACATTCCCATTCATAGAGCAGG + Intergenic
1171676003 20:27876347-27876369 AACATTCCCATTCATAGAGCAGG + Intergenic
1171676189 20:27879067-27879089 AACATTCCCATTCATAGAGCAGG + Intergenic
1171676717 20:27887053-27887075 AACATTCCCATTCATAGAGCAGG + Intergenic
1171676897 20:27889770-27889792 AACATTCCCATTCATAGAGCAGG + Intergenic
1171677077 20:27892488-27892510 AACATTCCCATTCATAGAGCAGG + Intergenic
1171677356 20:27896735-27896757 AACATTCCCATTCATAGAGCAGG + Intergenic
1171677538 20:27899453-27899475 AACATTCCCATTCATAGAGCAGG + Intergenic
1171678016 20:27906590-27906612 AACATTCCCATTCATAGAGCAGG + Intergenic
1171678172 20:27908971-27908993 AACATTCCCATTCATAGAGCAGG + Intergenic
1171678342 20:27911519-27911541 AACATTCCCATTCATAGAGCAGG + Intergenic
1171678525 20:27914240-27914262 AACATTCCCATTCATAGAGCAGG + Intergenic
1171679389 20:27927162-27927184 AACATTCCCATTCATAGAGCAGG + Intergenic
1171679501 20:27928864-27928886 AACATTCCCATTCATAGAGCAGG + Intergenic
1171679671 20:27931413-27931435 AACATTCCCATTCATAGAGCAGG + Intergenic
1171679961 20:27935831-27935853 AACATTCCCATTCATAGAGCAGG + Intergenic
1171680131 20:27938379-27938401 AACATTCCCATTCATAGAGCAGG + Intergenic
1171681098 20:27952827-27952849 AACATTCCCATTCATAGAGCAGG + Intergenic
1171681351 20:27956565-27956587 AACATTCCCATTCATAGAGCAGG + Intergenic
1171682183 20:27968966-27968988 AACATTCCCATTCATAGAGCAGG + Intergenic
1171682366 20:27971684-27971706 AACATTCCCATTCATAGAGCAGG + Intergenic
1171682799 20:27978140-27978162 AACATTCCCATTCATAGAGCAGG + Intergenic
1171682958 20:27980516-27980538 AACATTCCCATTCATAGAGCAGG + Intergenic
1171683157 20:27983575-27983597 AACATTCCCATTCATAGAGCAGG + Intergenic
1171683335 20:27986299-27986321 AACATTCCCATTCATAGAGCAGG + Intergenic
1171683517 20:27989019-27989041 AACATTCCCATTCATAGAGCAGG + Intergenic
1171683886 20:27994461-27994483 AACATTCCCATTCATAGAGCAGG + Intergenic
1171684610 20:28005342-28005364 AACATTCCCATTCATAGAGCAGG + Intergenic
1171684853 20:28009076-28009098 AACATTCCCATTCATAGAGCAGG + Intergenic
1171685020 20:28011624-28011646 AACATTCCCATTCATAGAGCAGG + Intergenic
1171685204 20:28014343-28014365 AACATTCCCATTCATAGAGCAGG + Intergenic
1171685492 20:28018762-28018784 AACATTCCCATTCATAGAGCAGG + Intergenic
1171685915 20:28025047-28025069 AACATTCCCATTCATAGAGCAGG + Intergenic
1171686465 20:28033205-28033227 AACATTCCCATTCATAGAGCAGG + Intergenic
1171686836 20:28038645-28038667 AACATTCCCATTCATAGAGCAGG + Intergenic
1171687176 20:28043740-28043762 AACATTCCCATTCATAGAGCAGG + Intergenic
1171687218 20:28044420-28044442 AACATTCCCATTCATAGAGCAGG + Intergenic
1171687681 20:28051385-28051407 AACATTCCCATTCATAGAGCAGG + Intergenic
1171687790 20:28053087-28053109 AACATTCCCATTCATAGAGCAGG + Intergenic
1171687898 20:28054786-28054808 AACATTCCCATTCATAGAGCAGG + Intergenic
1171688570 20:28064814-28064836 AACATTCCCATTCATAGAGCAGG + Intergenic
1171689336 20:28076194-28076216 AACATTCCCATTCATAGAGCAGG + Intergenic
1171689742 20:28082318-28082340 AACATTCCCATTCATAGAGCAGG + Intergenic
1171690743 20:28097276-28097298 AACATTCCCATTCATAGAGCAGG + Intergenic
1171691284 20:28105440-28105462 AACATTCCCATTCATAGAGCAGG + Intergenic
1171691457 20:28107988-28108010 AACATTCCCATTCATAGAGCAGG + Intergenic
1171692160 20:28118527-28118549 AACATTCCCATTCATAGAGCAGG + Intergenic
1171692518 20:28123794-28123816 AACATTCCCATTCATAGAGCAGG + Intergenic
1171692859 20:28128893-28128915 AACATTCCCATTCATAGAGCAGG + Intergenic
1171693047 20:28131614-28131636 AACATTCCCATTCATAGAGCAGG + Intergenic
1171693663 20:28140790-28140812 AACATTCCCATTCATAGAGCAGG + Intergenic
1171693776 20:28142492-28142514 AACATTCCCATTCATAGAGCAGG + Intergenic
1171694020 20:28146061-28146083 AACATTCCCATTCATAGAGCAGG + Intergenic
1171694191 20:28148608-28148630 AACATTCCCATTCATAGAGCAGG + Intergenic
1171694376 20:28151329-28151351 AACATTCCCATTCATAGAGCAGG + Intergenic
1171694674 20:28155752-28155774 AACATTCCCATTCATAGAGCAGG + Intergenic
1171694991 20:28160516-28160538 AACATTCCCATTCATAGAGCAGG + Intergenic
1171695173 20:28163233-28163255 AACATTCCCATTCATAGAGCAGG + Intergenic
1171695342 20:28165780-28165802 AACATTCCCATTCATAGAGCAGG + Intergenic
1171695512 20:28168329-28168351 AACATTCCCATTCATAGAGCAGG + Intergenic
1171695643 20:28170372-28170394 AACATTCCCATTCATAGAGCAGG + Intergenic
1171696050 20:28176492-28176514 AACATTCCCATTCATAGAGCAGG + Intergenic
1171696881 20:28188667-28188689 AACATTCCCATTCATAGAGCAGG + Intergenic
1171697246 20:28194109-28194131 AACATTCCCATTCATAGAGCAGG + Intergenic
1171697644 20:28200053-28200075 AACATTCCCATTCATAGAGCAGG + Intergenic
1171697814 20:28202602-28202624 AACATTCCCATTCATAGAGCAGG + Intergenic
1171697984 20:28205151-28205173 AACATTCCCATTCATAGAGCAGG + Intergenic
1171698152 20:28207699-28207721 AACATTCCCATTCATAGAGCAGG + Intergenic
1171698574 20:28214161-28214183 AACATTCCCATTCATAGAGCAGG + Intergenic
1171698682 20:28215688-28215710 AACATTCCCATTCATAGAGCAGG + Intergenic
1171698861 20:28218409-28218431 AACATTCCCATTCATAGAGCAGG + Intergenic
1171699030 20:28220957-28220979 AACATTCCCATTCATAGAGCAGG + Intergenic
1171699141 20:28222658-28222680 AACATTCCCATTCATAGAGCAGG + Intergenic
1171699419 20:28226907-28226929 AACATTCCCATTCATAGAGCAGG + Intergenic
1171699605 20:28229797-28229819 AACATTCCCATTCATAGAGCAGG + Intergenic
1171699773 20:28232345-28232367 AACATTCCCATTCATAGAGCAGG + Intergenic
1171699943 20:28234893-28234915 AACATTCCCATTCATAGAGCAGG + Intergenic
1171700180 20:28238466-28238488 AACATTCCCATTCATAGAGCAGG + Intergenic
1171700346 20:28241015-28241037 AACATTCCCATTCATAGAGCAGG + Intergenic
1171700610 20:28245104-28245126 AACATTCCCATTCATAGAGCAGG + Intergenic
1171700779 20:28247650-28247672 AACATTCCCATTCATAGAGCAGG + Intergenic
1171700887 20:28249351-28249373 AACATTCCCATTCATAGAGCAGG + Intergenic
1171700999 20:28251050-28251072 AACATTCCCATTCATAGAGCAGG + Intergenic
1171701249 20:28254788-28254810 AACATTCCCATTCATAGAGCAGG + Intergenic
1171701593 20:28260141-28260163 AACATTCCCATTCATAGAGCAGG + Intergenic
1171701813 20:28263543-28263565 AACATTCCCATTCATAGAGCAGG + Intergenic
1171702113 20:28268135-28268157 AACATTCCCATTCATAGAGCAGG + Intergenic
1171702224 20:28269836-28269858 AACATTCCCATTCATAGAGCAGG + Intergenic
1171702407 20:28272555-28272577 AACATTCCCATTCATAGAGCAGG + Intergenic
1171703080 20:28282757-28282779 AACATTCCCATTCATAGAGCAGG + Intergenic
1171703210 20:28284800-28284822 AACATTCCCATTCATAGAGCAGG + Intergenic
1171703383 20:28287350-28287372 AACATTCCCATTCATAGAGCAGG + Intergenic
1171703633 20:28291086-28291108 AACATTCCCATTCATAGAGCAGG + Intergenic
1171703798 20:28293633-28293655 AACATTCCCATTCATAGAGCAGG + Intergenic
1171703970 20:28296180-28296202 AACATTCCCATTCATAGAGCAGG + Intergenic
1171704140 20:28298729-28298751 AACATTCCCATTCATAGAGCAGG + Intergenic
1171704762 20:28308254-28308276 AACATTCCCATTCATAGAGCAGG + Intergenic
1171704931 20:28310801-28310823 AACATTCCCATTCATAGAGCAGG + Intergenic
1171705411 20:28318064-28318086 AACATTCCCATTCATAGAGCAGG + Intergenic
1171705880 20:28325030-28325052 AACATTCCCATTCATAGAGCAGG + Intergenic
1171706157 20:28329281-28329303 AACATTCCCATTCATAGAGCAGG + Intergenic
1171706327 20:28331830-28331852 AACATTCCCATTCATAGAGCAGG + Intergenic
1171706497 20:28334377-28334399 AACATTCCCATTCATAGAGCAGG + Intergenic
1171706609 20:28336079-28336101 AACATTCCCATTCATAGAGCAGG + Intergenic
1171706751 20:28338282-28338304 AACATTCCCATTCATAGAGCAGG + Intergenic
1171707545 20:28350176-28350198 AACATTCCCATTCATAGAGCAGG + Intergenic
1171707825 20:28354425-28354447 AACATTCCCATTCATAGAGCAGG + Intergenic
1171708221 20:28360375-28360397 AACATTCCCATTCATAGAGCAGG + Intergenic
1171708844 20:28369721-28369743 AACATTCCCATTCATAGAGCAGG + Intergenic
1171709349 20:28377365-28377387 AACATTCCCATTCATAGAGCAGG + Intergenic
1171710175 20:28389767-28389789 AACATTCCCATTCATAGAGCAGG + Intergenic
1171710514 20:28394864-28394886 AACATTCCCATTCATAGAGCAGG + Intergenic
1171711387 20:28407949-28407971 AACATTCCCATTCATAGAGCAGG + Intergenic
1171711557 20:28410495-28410517 AACATTCCCATTCATAGAGCAGG + Intergenic
1171711727 20:28413047-28413069 AACATTCCCATTCATAGAGCAGG + Intergenic
1171712005 20:28417300-28417322 AACATTCCCATTCATAGAGCAGG + Intergenic
1171712263 20:28421209-28421231 AACATTCCCATTCATAGAGCAGG + Intergenic
1171712949 20:28431409-28431431 AACATTCCCATTCATAGAGCAGG + Intergenic
1171713118 20:28433957-28433979 AACATTCCCATTCATAGAGCAGG + Intergenic
1171713457 20:28439052-28439074 AACATTCCCATTCATAGAGCAGG + Intergenic
1171713626 20:28441600-28441622 AACATTCCCATTCATAGAGCAGG + Intergenic
1171713795 20:28444146-28444168 AACATTCCCATTCATAGAGCAGG + Intergenic
1171714156 20:28449565-28449587 AACATTCCCATTCATAGAGCAGG + Intergenic
1171714330 20:28452114-28452136 AACATTCCCATTCATAGAGCAGG + Intergenic
1171714501 20:28454661-28454683 AACATTCCCATTCATAGAGCAGG + Intergenic
1171714840 20:28459760-28459782 AACATTCCCATTCATAGAGCAGG + Intergenic
1171715013 20:28462307-28462329 AACATTCCCATTCATAGAGCAGG + Intergenic
1171715185 20:28464855-28464877 AACATTCCCATTCATAGAGCAGG + Intergenic
1171715351 20:28467403-28467425 AACATTCCCATTCATAGAGCAGG + Intergenic
1171715688 20:28472499-28472521 AACATTCCCATTCATAGAGCAGG + Intergenic
1171716194 20:28480145-28480167 AACATTCCCATTCATAGAGCAGG + Intergenic
1171716702 20:28487793-28487815 AACATTCCCATTCATAGAGCAGG + Intergenic
1172478667 20:35257667-35257689 GTCCTTCCCACACATACCACCGG - Intronic
1202721161 2_KI270715v1_random:82487-82509 AACATTCCCTCTCATAGAGCAGG + Intergenic
1202727552 2_KI270716v1_random:19519-19541 AATATTCCCATACATAGAGCAGG + Intergenic
1202731220 2_KI270716v1_random:75677-75699 AACATTCCCTCTCATAGAGCAGG + Intergenic
1202731435 2_KI270716v1_random:79077-79099 AACATTCCCTCTCATAGAGCAGG + Intergenic
1202732100 2_KI270716v1_random:89269-89291 GACATTCCCTTTCATAGAGCAGG + Intergenic
953208526 3:40853584-40853606 GACATAACCACCCATAGAGCTGG + Intergenic
956042115 3:65155588-65155610 GTCATTGCCACACTTTGAGAAGG - Intergenic
956852734 3:73245686-73245708 GCCCTTACCACACTTAGAGCAGG + Intergenic
957705942 3:83784000-83784022 GTATTTCCCACACATAAAGTTGG - Intergenic
960051108 3:113240383-113240405 GTTATTGCCACACATACAGTAGG + Intronic
961772300 3:129258829-129258851 GGTATTCCCACACCCAGAGCAGG - Intronic
962780863 3:138715110-138715132 TTCTTTCCTACACATAGAGAAGG - Intronic
963729453 3:148957362-148957384 TTAACTTCCACACATAGAGCAGG + Intergenic
965750122 3:171966985-171967007 TGTTTTCCCACACATAGAGCTGG - Intergenic
970103665 4:12555382-12555404 GTGCTTCCCACAAATTGAGCAGG + Intergenic
975582210 4:75917362-75917384 TCCCTTCCCACACAAAGAGCTGG + Intronic
977147904 4:93469098-93469120 GTCATCACCACAAATACAGCTGG - Intronic
980592337 4:134906497-134906519 GTCATTGCCACACCTACACCTGG + Intergenic
983112042 4:163763279-163763301 GTCATTCTCATTCATTGAGCAGG + Intronic
983289230 4:165780493-165780515 GTCATTCCTGCTCTTAGAGCAGG + Intergenic
986427116 5:7644653-7644675 GTCATTCACAGAAATAGAGAGGG - Intronic
987591571 5:19934477-19934499 GTCATTCACACACAGACAGATGG + Intronic
999744125 5:154578591-154578613 CTCATTCACTCACATAGAGAAGG + Intergenic
1000265499 5:159632346-159632368 GTCCTTCCCACCCAAAGAGATGG - Intergenic
1000487908 5:161871054-161871076 GTCATTAGCACAAATAAAGCTGG + Intronic
1001459338 5:171895933-171895955 GTTCTTGCCACACATAGAGAGGG - Intronic
1003389207 6:5698851-5698873 ATCATTCTCACACACAGAGCTGG + Intronic
1003471665 6:6441903-6441925 GTCATTTCAACAAAAAGAGCTGG + Intergenic
1011786361 6:90849874-90849896 CTCATTTCCACTCATTGAGCAGG - Intergenic
1014757340 6:125316012-125316034 ATCATTCCCCCTTATAGAGCTGG + Intergenic
1021650351 7:22826965-22826987 GTAATTCCCACATATACAGTTGG + Intergenic
1022212192 7:28222368-28222390 GACATTTCCACATATTGAGCTGG - Intergenic
1024413063 7:49069480-49069502 ATCATCCTCACATATAGAGCAGG - Intergenic
1025316093 7:58031816-58031838 AACATTCCCATTCATAGAGCAGG + Intergenic
1026099952 7:67376468-67376490 CTCATTCCCACACATTGGGGAGG + Intergenic
1026529875 7:71187672-71187694 GCCATTCCCCCACACAGACCAGG - Intronic
1030175977 7:106653997-106654019 GTTATTCCCAATCTTAGAGCTGG + Intergenic
1034225628 7:149478404-149478426 TTCTTTCCCACACATAGCCCTGG - Intronic
1036513920 8:9425927-9425949 GTCAATCCCACACCAAGAGGTGG - Intergenic
1038884428 8:31647767-31647789 TTCATTCCCATCCATAGAGATGG + Intronic
1039618744 8:38977386-38977408 GTCCTTCCTACACATAGTACTGG + Intronic
1040142482 8:43939004-43939026 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144182 8:43968579-43968601 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144306 8:43970451-43970473 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144436 8:43972319-43972341 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144567 8:43974187-43974209 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144699 8:43976054-43976076 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144828 8:43977922-43977944 AACATTCCCATTCATAGAGCAGG + Intergenic
1040144960 8:43979791-43979813 AACATTCCCATTCATAGAGCAGG + Intergenic
1040145096 8:43981658-43981680 AACATTCCCATTCATAGAGCAGG + Intergenic
1040145228 8:43983527-43983549 AACATTCCCATTCATAGAGCAGG + Intergenic
1040146111 8:44046728-44046750 AACATTCCCATTCATAGAGCAGG + Intergenic
1040146453 8:44051827-44051849 AACATTCCCATTCATAGAGCAGG + Intergenic
1040146544 8:44053183-44053205 AACATTCCCATTCATAGAGCAGG + Intergenic
1040146794 8:44056926-44056948 AACATTCCCATTCATAGAGCAGG + Intergenic
1040146886 8:44058283-44058305 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147011 8:44060153-44060175 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147184 8:44062702-44062724 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147357 8:44065251-44065273 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147608 8:44068991-44069013 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147697 8:44070347-44070369 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147822 8:44072215-44072237 AACATTCCCATTCATAGAGCAGG + Intergenic
1040147914 8:44073572-44073594 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148007 8:44074928-44074950 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148133 8:44076798-44076820 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148266 8:44078667-44078689 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148399 8:44080539-44080561 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148525 8:44082407-44082429 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148697 8:44084957-44084979 AACATTCCCATTCATAGAGCAGG + Intergenic
1040148789 8:44086314-44086336 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149072 8:44090569-44090591 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149162 8:44091925-44091947 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149334 8:44094476-44094498 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149426 8:44095832-44095854 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149517 8:44097187-44097209 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149648 8:44099055-44099077 AACATTCCCATTCATAGAGCAGG + Intergenic
1040149821 8:44101604-44101626 AACATTCCCATTCATAGAGCAGG + Intergenic
1040150485 8:44111473-44111495 AACATTCCCATTCATAGAGCAGG + Intergenic
1040150658 8:44114023-44114045 AACATTCCCATTCATAGAGCAGG + Intergenic
1040150748 8:44115379-44115401 AACATTCCCATTCATAGAGCAGG + Intergenic
1040150873 8:44117248-44117270 AACATTCCCATTCATAGAGCAGG + Intergenic
1040151468 8:44126086-44126108 AACATTCCCATTCATAGAGCAGG + Intergenic
1040151640 8:44128635-44128657 AACATTCCCATTCATAGAGCAGG + Intergenic
1040151765 8:44130503-44130525 AACATTCCCATTCATAGAGCAGG + Intergenic
1040151972 8:44133564-44133586 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152065 8:44134920-44134942 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152157 8:44136276-44136298 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152285 8:44138144-44138166 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152414 8:44140015-44140037 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152504 8:44141371-44141393 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152627 8:44143242-44143264 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152800 8:44145790-44145812 AACATTCCCATTCATAGAGCAGG + Intergenic
1040152890 8:44147144-44147166 AACATTCCCATTCATAGAGCAGG + Intergenic
1040153141 8:44150887-44150909 AACATTCCCATTCATAGAGCAGG + Intergenic
1040153233 8:44152243-44152265 AACATTCCCATTCATAGAGCAGG + Intergenic
1040153404 8:44154791-44154813 AACATTCCCATTCATAGAGCAGG + Intergenic
1040153494 8:44156145-44156167 AACATTCCCATTCATAGAGCAGG + Intergenic
1040153745 8:44159890-44159912 AACATTCCCATTCATAGAGCAGG + Intergenic
1040153914 8:44162440-44162462 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154042 8:44164308-44164330 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154133 8:44165664-44165686 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154227 8:44167020-44167042 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154319 8:44168377-44168399 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154411 8:44169733-44169755 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154537 8:44171601-44171623 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154748 8:44174663-44174685 AACATTCCCATTCATAGAGCAGG + Intergenic
1040154918 8:44177212-44177234 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155010 8:44178568-44178590 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155264 8:44182310-44182332 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155356 8:44183666-44183688 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155446 8:44185023-44185045 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155742 8:44189442-44189464 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155865 8:44191310-44191332 AACATTCCCATTCATAGAGCAGG + Intergenic
1040155957 8:44192666-44192688 AACATTCCCATTCATAGAGCAGG + Intergenic
1040156048 8:44194022-44194044 AACATTCCCATTCATAGAGCAGG + Intergenic
1040156141 8:44195380-44195402 AACATTCCCATTCATAGAGCAGG + Intergenic
1040156233 8:44196736-44196758 AACATTCCCATTCATAGAGCAGG + Intergenic
1040156563 8:44201672-44201694 AACATTCCCATTCATAGAGCAGG + Intergenic
1040156860 8:44205928-44205950 AACATTCCCATTCATAGAGCAGG + Intergenic
1040156950 8:44207286-44207308 AACATTCCCATTCATAGAGCAGG + Intergenic
1040157042 8:44208642-44208664 AACATTCCCATTCATAGAGCAGG + Intergenic
1040157247 8:44211703-44211725 AACATTCCCATTCATAGAGCAGG + Intergenic
1040157373 8:44213571-44213593 AACATTCCCATTCATAGAGCGGG + Intergenic
1040157547 8:44216120-44216142 AACATTCCCATTCATAGAGCAGG + Intergenic
1040157639 8:44217476-44217498 AACATTCCCATTCATAGAGCAGG + Intergenic
1040157766 8:44219344-44219366 AACATTCCCATTCATAGAGCAGG + Intergenic
1040157856 8:44220700-44220722 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158028 8:44223249-44223271 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158119 8:44224605-44224627 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158436 8:44229314-44229336 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158528 8:44230669-44230691 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158621 8:44232025-44232047 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158714 8:44233381-44233403 AACATTCCCATTCATAGAGCAGG + Intergenic
1040158886 8:44235931-44235953 AACATTCCCATTCATAGAGCAGG + Intergenic
1040159102 8:44239162-44239184 AACATTCCCATTCATAGAGCAGG + Intergenic
1040159274 8:44241711-44241733 AACATTCCCATTCATAGAGCAGG + Intergenic
1040159638 8:44247158-44247180 AACATTCCCATTCATAGAGCAGG + Intergenic
1040159766 8:44249027-44249049 AACATTCCCATTCATAGAGCAGG + Intergenic
1040159892 8:44250896-44250918 AACATTCCCATTCATAGAGCAGG + Intergenic
1040160014 8:44252764-44252786 AACATTCCCATTCATAGAGCAGG + Intergenic
1040160218 8:44255826-44255848 AACATTCCCATTCATAGAGCAGG + Intergenic
1040160505 8:44260081-44260103 AACATTCCCATTCATAGAGCAGG + Intergenic
1040160710 8:44263143-44263165 AACATTCCCATTCATAGAGCAGG + Intergenic
1040160840 8:44265012-44265034 AACATTCCCATTCATAGAGCAGG + Intergenic
1040161011 8:44267561-44267583 AACATTCCCATTCATAGAGCAGG + Intergenic
1040161390 8:44273176-44273198 AACATTCCCATTCATAGAGCAGG + Intergenic
1040161853 8:44279979-44280001 AACATTCCCATTCATAGAGCAGG + Intergenic
1040161943 8:44281334-44281356 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162034 8:44282690-44282712 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162288 8:44286432-44286454 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162379 8:44287789-44287811 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162551 8:44290339-44290361 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162753 8:44293229-44293251 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162882 8:44295098-44295120 AACATTCCCATTCATAGAGCAGG + Intergenic
1040162974 8:44296455-44296477 AACATTCCCATTCATAGAGCAGG + Intergenic
1040163102 8:44298326-44298348 AACATTCCCATTCATAGAGCAGG + Intergenic
1040163194 8:44299682-44299704 AACATTCCCATTCATAGAGCAGG + Intergenic
1040163286 8:44301038-44301060 AACATTCCCATTCATAGAGCAGG + Intergenic
1040163377 8:44302394-44302416 AACATTCCCATTCATAGAGCAGG + Intergenic
1040163502 8:44304264-44304286 AACATTCCCATTCATAGAGCAGG + Intergenic
1040163724 8:44307488-44307510 AACATTCCCATTCATAGAGCAGG + Intergenic
1040164058 8:44312424-44312446 AACATTCCCATTCATAGAGCAGG + Intergenic
1040164264 8:44315489-44315511 AACATTCCCATTCATAGAGCAGG + Intergenic
1040164391 8:44317359-44317381 AACATTCCCATTCATAGAGCAGG + Intergenic
1040164645 8:44321104-44321126 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165021 8:44326716-44326738 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165224 8:44329777-44329799 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165397 8:44332327-44332349 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165488 8:44333683-44333705 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165661 8:44336232-44336254 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165833 8:44338781-44338803 AACATTCCCATTCATAGAGCAGG + Intergenic
1040165962 8:44340649-44340671 AACATTCCCATTCATAGAGCAGG + Intergenic
1040166054 8:44342005-44342027 AACATTCCCATTCATAGAGCAGG + Intergenic
1040166307 8:44345749-44345771 AACATTCCCATTCATAGAGCAGG + Intergenic
1040166399 8:44347106-44347128 AACATTCCCATTCATAGAGCAGG + Intergenic
1040166762 8:44352555-44352577 AACATTCCCATTCATAGAGCAGG + Intergenic
1040166924 8:44355104-44355126 AACATTCCCATTCATAGAGCAGG + Intergenic
1040167305 8:44360714-44360736 AACATTCCCATTCATAGAGCAGG + Intergenic
1040167395 8:44362070-44362092 AACATTCCCATTCATAGAGCAGG + Intergenic
1040167524 8:44363941-44363963 AACATTCCCATTCATAGAGCAGG + Intergenic
1040167615 8:44365297-44365319 AACATTCCCATTCATAGAGCAGG + Intergenic
1040167707 8:44366652-44366674 AACATTCCCATTCATAGAGCAGG + Intergenic
1040168042 8:44371583-44371605 AACATTCCCATTCATAGAGCAGG + Intergenic
1040168216 8:44374133-44374155 AACATTCCCATTCATAGAGCAGG + Intergenic
1040168345 8:44376002-44376024 AACATTCCCATTCATAGAGCAGG + Intergenic
1040168630 8:44380257-44380279 AACATTCCCATTCATAGAGCAGG + Intergenic
1040168761 8:44382126-44382148 AACATTCCCATTCATAGAGCAGG + Intergenic
1040168880 8:44383995-44384017 AACATTCCCATTCATAGAGCAGG + Intergenic
1040169003 8:44385864-44385886 AACATTCCCATTCATAGAGCAGG + Intergenic
1040169211 8:44388925-44388947 AACATTCCCATTCATAGAGCAGG + Intergenic
1040169544 8:44393861-44393883 AACATTCCCATTCATAGAGCAGG + Intergenic
1040169671 8:44395729-44395751 AACATTCCCATTCATAGAGCAGG + Intergenic
1040169797 8:44397598-44397620 AACATTCCCATTCATAGAGCAGG + Intergenic
1040169967 8:44400149-44400171 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170097 8:44402017-44402039 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170272 8:44404566-44404588 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170399 8:44406434-44406456 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170489 8:44407790-44407812 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170581 8:44409147-44409169 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170706 8:44411016-44411038 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170798 8:44412372-44412394 AACATTCCCATTCATAGAGCAGG + Intergenic
1040170922 8:44414242-44414264 AACATTCCCATTCATAGAGCAGG + Intergenic
1040171041 8:44415940-44415962 AACATTCCCATTCATAGAGCAGG + Intergenic
1040171131 8:44417296-44417318 AACATTCCCATTCATAGAGCAGG + Intergenic
1040171222 8:44418652-44418674 AACATTCCCATTCATAGAGCAGG + Intergenic
1040171428 8:44421712-44421734 AACATTCCCATTCATAGAGCAGG + Intergenic
1040171811 8:44427324-44427346 AACATTCCCATTCATAGAGCAGG + Intergenic
1040171936 8:44429194-44429216 AACATTCCCATTCATAGAGCAGG + Intergenic
1040172189 8:44432937-44432959 AACATTCCCATTCATAGAGCAGG + Intergenic
1040172317 8:44434806-44434828 AACATTCCCATTCATAGAGCAGG + Intergenic
1040172489 8:44437357-44437379 AACATTCCCATTCATAGAGCAGG + Intergenic
1040172824 8:44442292-44442314 AACATTCCCATTCATAGAGCAGG + Intergenic
1040172998 8:44444843-44444865 AACATTCCCATTCATAGAGCAGG + Intergenic
1040173609 8:44453872-44453894 AACATTCCCATTCATAGAGCAGG + Intergenic
1040173737 8:44455741-44455763 AACATTCCCATTCATAGAGCAGG + Intergenic
1040173864 8:44457610-44457632 AACATTCCCATTCATAGAGCAGG + Intergenic
1040173988 8:44459479-44459501 AACATTCCCATTCATAGAGCAGG + Intergenic
1040174112 8:44461347-44461369 AACATTCCCATTCATAGAGCAGG + Intergenic
1040174364 8:44465089-44465111 AACATTCCCATTCATAGAGCAGG + Intergenic
1040174456 8:44466445-44466467 AACATTCCCATTCATAGAGCAGG + Intergenic
1040174581 8:44468314-44468336 AACATTCCCATTCATAGAGCAGG + Intergenic
1040174673 8:44469671-44469693 AACATTCCCATTCATAGAGCAGG + Intergenic
1040174927 8:44473414-44473436 AACATTCCCATTCATAGAGCAGG + Intergenic
1040175292 8:44478864-44478886 AACATTCCCATTCATAGAGCAGG + Intergenic
1040175383 8:44480221-44480243 AACATTCCCATTCATAGAGCAGG + Intergenic
1040175474 8:44481577-44481599 AACATTCCCATTCATAGAGCAGG + Intergenic
1040175682 8:44484639-44484661 AACATTCCCATTCATAGAGCAGG + Intergenic
1040175814 8:44486508-44486530 AACATTCCCATTCATAGAGCAGG + Intergenic
1040175941 8:44488376-44488398 AACATTCCCATTCATAGAGCAGG + Intergenic
1040176216 8:44492456-44492478 AACATTCCCATTCATAGAGCAGG + Intergenic
1040176310 8:44493812-44493834 AACATTCCCATTCATAGAGCAGG + Intergenic
1040176678 8:44499261-44499283 AACATTCCCATTCATAGAGCAGG + Intergenic
1040176770 8:44500617-44500639 AACATTCCCATTCATAGAGCAGG + Intergenic
1040176861 8:44501972-44501994 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177034 8:44504522-44504544 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177162 8:44506392-44506414 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177423 8:44510130-44510152 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177592 8:44512683-44512705 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177683 8:44514040-44514062 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177771 8:44515397-44515419 AACATTCCCATTCATAGAGCAGG + Intergenic
1040177901 8:44517265-44517287 AACATTCCCATTCATAGAGCAGG + Intergenic
1040178227 8:44522201-44522223 AACATTCCCATTCATAGAGCAGG + Intergenic
1040178359 8:44524070-44524092 AACATTCCCATTCATAGAGCAGG + Intergenic
1040178612 8:44527812-44527834 AACATTCCCATTCATAGAGCAGG + Intergenic
1040178818 8:44530874-44530896 AACATTCCCATTCATAGAGCAGG + Intergenic
1040178943 8:44532743-44532765 AACATTCCCATTCATAGAGCAGG + Intergenic
1040179152 8:44535805-44535827 AACATTCCCATTCATAGAGCAGG + Intergenic
1040179243 8:44537162-44537184 AACATTCCCATTCATAGAGCAGG + Intergenic
1040179570 8:44542099-44542121 AACATTCCCATTCATAGAGCAGG + Intergenic
1040179823 8:44545841-44545863 AACATTCCCATTCATAGAGCAGG + Intergenic
1040179949 8:44547709-44547731 AACATTCCCATTCATAGAGCAGG + Intergenic
1040180120 8:44550258-44550280 AACATTCCCATTCATAGAGCAGG + Intergenic
1040180289 8:44552807-44552829 AACATTCCCATTCATAGAGCAGG + Intergenic
1040180380 8:44554163-44554185 AACATTCCCATTCATAGAGCAGG + Intergenic
1040180472 8:44555519-44555541 AACATTCCCATTCATAGAGCAGG + Intergenic
1040180644 8:44558067-44558089 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181059 8:44564197-44564219 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181188 8:44566065-44566087 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181279 8:44567421-44567443 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181402 8:44569285-44569307 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181496 8:44570638-44570660 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181591 8:44571994-44572016 AACATTCCCATTCATAGAGCAGG + Intergenic
1040181932 8:44577097-44577119 AACATTCCCATTCATAGAGCAGG + Intergenic
1040182268 8:44582033-44582055 AACATTCCCATTCATAGAGCAGG + Intergenic
1040182518 8:44585776-44585798 AACATTCCCATTCATAGAGCAGG + Intergenic
1040182608 8:44587132-44587154 AACATTCCCATTCATAGAGCAGG + Intergenic
1040183263 8:44596841-44596863 AACATTCCCATTCATAGAGCAGG + Intergenic
1040183714 8:44603481-44603503 AACATTCCCATTCATAGAGCAGG + Intergenic
1040183806 8:44604837-44604859 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184059 8:44608579-44608601 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184187 8:44610447-44610469 AACATTCCCATTCATAGAGCGGG + Intergenic
1040184277 8:44611803-44611825 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184402 8:44613671-44613693 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184496 8:44615028-44615050 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184625 8:44616896-44616918 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184773 8:44619109-44619131 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184866 8:44620465-44620487 AACATTCCCATTCATAGAGCAGG + Intergenic
1040184958 8:44621821-44621843 AACATTCCCATTCATAGAGCAGG + Intergenic
1040185128 8:44624370-44624392 AACATTCCCATTCATAGAGCAGG + Intergenic
1040185221 8:44625726-44625748 AACATTCCCATTCATAGAGCAGG + Intergenic
1040185392 8:44628276-44628298 AACATTCCCATTCATAGAGCAGG + Intergenic
1040185840 8:44634918-44634940 AACATTCCCATTCATAGAGCAGG + Intergenic
1040186323 8:44642069-44642091 AACATTCCCATTCATAGAGCAGG + Intergenic
1040186413 8:44643428-44643450 AACATTCCCATTCATAGAGCAGG + Intergenic
1040186538 8:44645295-44645317 AACATTCCCATTCATAGAGCAGG + Intergenic
1040186829 8:44649550-44649572 AACATTCCCATTCATAGAGCAGG + Intergenic
1040186921 8:44650907-44650929 AACATTCCCATTCATAGAGCAGG + Intergenic
1040187013 8:44652263-44652285 AACATTCCCATTCATAGAGCAGG + Intergenic
1040187218 8:44655325-44655347 AACATTCCCATTCATAGAGCAGG + Intergenic
1040187509 8:44659583-44659605 AACATTCCCATTCATAGAGCAGG + Intergenic
1040187639 8:44661452-44661474 AACATTCCCATTCATAGAGCAGG + Intergenic
1040187812 8:44664001-44664023 AACATTCCCATTCATAGAGCAGG + Intergenic
1040187939 8:44665869-44665891 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188030 8:44667224-44667246 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188121 8:44668580-44668602 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188214 8:44669938-44669960 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188386 8:44672489-44672511 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188478 8:44673844-44673866 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188650 8:44676394-44676416 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188819 8:44678943-44678965 AACATTCCCATTCATAGAGCAGG + Intergenic
1040188990 8:44681491-44681513 AACATTCCCATTCATAGAGCAGG + Intergenic
1040189081 8:44682847-44682869 AACATTCCCATTCATAGAGCAGG + Intergenic
1040189172 8:44684203-44684225 AACATTCCCATTCATAGAGCAGG + Intergenic
1040189299 8:44686074-44686096 AACATTCCCATTCATAGAGCAGG + Intergenic
1040189484 8:44688784-44688806 AACATTCCCATTCATAGAGCAGG + Intergenic
1040189735 8:44692526-44692548 AACATTCCCATTCATAGAGCAGG + Intergenic
1040189989 8:44696268-44696290 AACATTCCCATTCATAGAGCAGG + Intergenic
1040190118 8:44698136-44698158 AACATTCCCATTCATAGAGCAGG + Intergenic
1040190323 8:44701197-44701219 AACATTCCCATTCATAGAGCAGG + Intergenic
1040190450 8:44703068-44703090 AACATTCCCATTCATAGAGCAGG + Intergenic
1040190542 8:44704424-44704446 AACATTCCCATTCATAGAGCAGG + Intergenic
1040190714 8:44706974-44706996 AACATTCCCATTCATAGAGCAGG + Intergenic
1040191205 8:44714293-44714315 AACATTCCCATTCATAGAGCAGG + Intergenic
1040191456 8:44718035-44718057 AACATTCCCATTCATAGAGCAGG + Intergenic
1040191587 8:44719903-44719925 AACATTCCCATTCATAGAGCAGG + Intergenic
1040191989 8:44725860-44725882 AACATTCCCATTCATAGAGCAGG + Intergenic
1040192161 8:44728409-44728431 AACATTCCCATTCATAGAGCAGG + Intergenic
1040192367 8:44731473-44731495 AACATTCCCATTCATAGAGCAGG + Intergenic
1040192495 8:44733341-44733363 AACATTCCCATTCATAGAGCAGG + Intergenic
1040192622 8:44735209-44735231 AACATTCCCATTCATAGAGCAGG + Intergenic
1040193262 8:44744558-44744580 AACATTCCCATTCATAGAGCAGG + Intergenic
1040193558 8:44748982-44749004 AACATTCCCATTCATAGAGCAGG + Intergenic
1040193728 8:44751530-44751552 AACATTCCCATTCATAGAGCAGG + Intergenic
1040194341 8:44760561-44760583 AACATTCCCATTCATAGAGCAGG + Intergenic
1040194432 8:44761917-44761939 AACATTCCCATTCATAGAGCAGG + Intergenic
1040194604 8:44764466-44764488 AACATTCCCATTCATAGAGCAGG + Intergenic
1040194696 8:44765822-44765844 AACATTCCCATTCATAGAGCAGG + Intergenic
1040194868 8:44768374-44768396 AACATTCCCATTCATAGAGCAGG + Intergenic
1040195324 8:44775185-44775207 AACATTCCCATTCATAGAGCAGG + Intergenic
1040195413 8:44776541-44776563 AACATTCCCATTCATAGAGCAGG + Intergenic
1040195540 8:44778408-44778430 AACATTCCCATTCATAGAGCAGG + Intergenic
1040195702 8:44780786-44780808 AACATTCCCATTCATAGAGCAGG + Intergenic
1040195828 8:44782655-44782677 AACATTCCCATTCATAGAGCAGG + Intergenic
1040196031 8:44785718-44785740 AACATTCCCATTCATAGAGCAGG + Intergenic
1040196203 8:44788267-44788289 AACATTCCCATTCATAGAGCAGG + Intergenic
1040196332 8:44790137-44790159 AACATTCCCATTCATAGAGCAGG + Intergenic
1040196463 8:44792006-44792028 AACATTCCCATTCATAGAGCAGG + Intergenic
1040196672 8:44795066-44795088 AACATTCCCATTCATAGAGCAGG + Intergenic
1040197006 8:44800000-44800022 AACATTCCCATTCATAGAGCAGG + Intergenic
1040197177 8:44802548-44802570 AACATTCCCATTCATAGAGCAGG + Intergenic
1040197589 8:44808673-44808695 AACATTCCCATTCATAGAGCAGG + Intergenic
1040197681 8:44810029-44810051 AACATTCCCATTCATAGAGCAGG + Intergenic
1040197774 8:44811385-44811407 AACATTCCCATTCATAGAGCAGG + Intergenic
1040197902 8:44813254-44813276 AACATTCCCATTCATAGAGCAGG + Intergenic
1040198187 8:44817506-44817528 AACATTCCCATTCATAGAGCAGG + Intergenic
1040198358 8:44820056-44820078 AACATTCCCATTCATAGAGCAGG + Intergenic
1040198448 8:44821412-44821434 AACATTCCCATTCATAGAGCAGG + Intergenic
1040198653 8:44824475-44824497 AACATTCCCATTCATAGAGCAGG + Intergenic
1040198867 8:44827700-44827722 AACATTCCCATTCATAGAGCAGG + Intergenic
1040198990 8:44829567-44829589 AACATTCCCATTCATAGAGCAGG + Intergenic
1040199288 8:44833984-44834006 AACATTCCCATTCATAGAGCAGG + Intergenic
1040199569 8:44838238-44838260 AACATTCCCATTCATAGAGCAGG + Intergenic
1040199696 8:44840105-44840127 AACATTCCCATTCATAGAGCAGG + Intergenic
1040199950 8:44843847-44843869 AACATTCCCATTCATAGAGCAGG + Intergenic
1040200123 8:44846396-44846418 AACATTCCCATTCATAGAGCAGG + Intergenic
1040200214 8:44847753-44847775 AACATTCCCATTCATAGAGCAGG + Intergenic
1040200305 8:44849109-44849131 AACATTCCCATTCATAGAGCAGG + Intergenic
1040200603 8:44853527-44853549 AACATTCCCATTCATAGAGCAGG + Intergenic
1040200888 8:44857783-44857805 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201145 8:44861527-44861549 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201238 8:44862883-44862905 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201328 8:44864240-44864262 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201454 8:44866109-44866131 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201548 8:44867464-44867486 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201641 8:44868820-44868842 AACATTCCCATTCATAGAGCAGG + Intergenic
1040201927 8:44873075-44873097 AACATTCCCATTCATAGAGCAGG + Intergenic
1040202264 8:44878173-44878195 AACATTCCCATTCATAGAGCAGG + Intergenic
1040202354 8:44879528-44879550 AACATTCCCATTCATAGAGCAGG + Intergenic
1040202444 8:44880884-44880906 AACATTCCCATTCATAGAGCAGG + Intergenic
1040202696 8:44884626-44884648 AACATTCCCATTCATAGAGCAGG + Intergenic
1040202788 8:44885983-44886005 AACATTCCCATTCATAGAGCAGG + Intergenic
1040203032 8:44889555-44889577 AACATTCCCATTCATAGAGCAGG + Intergenic
1040203123 8:44890911-44890933 AACATTCCCATTCATAGAGCAGG + Intergenic
1040203213 8:44892267-44892289 AACATTCCCATTCATAGAGCAGG + Intergenic
1040203303 8:44893623-44893645 AACATTCCCATTCATAGAGCAGG + Intergenic
1040203635 8:44898559-44898581 AACATTCCCATTCATAGAGCAGG + Intergenic
1040203919 8:44902815-44902837 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204191 8:44906895-44906917 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204320 8:44908763-44908785 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204458 8:44910800-44910822 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204662 8:44913860-44913882 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204788 8:44915728-44915750 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204879 8:44917084-44917106 AACATTCCCATTCATAGAGCAGG + Intergenic
1040204971 8:44918438-44918460 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205233 8:44922344-44922366 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205327 8:44923699-44923721 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205420 8:44925055-44925077 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205545 8:44926923-44926945 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205635 8:44928279-44928301 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205727 8:44929636-44929658 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205890 8:44932014-44932036 AACATTCCCATTCATAGAGCAGG + Intergenic
1040205981 8:44933371-44933393 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206073 8:44934727-44934749 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206359 8:44938983-44939005 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206488 8:44940852-44940874 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206579 8:44942208-44942230 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206751 8:44944757-44944779 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206843 8:44946113-44946135 AACATTCCCATTCATAGAGCAGG + Intergenic
1040206935 8:44947469-44947491 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207026 8:44948825-44948847 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207119 8:44950182-44950204 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207243 8:44952051-44952073 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207353 8:44953745-44953767 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207483 8:44955614-44955636 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207574 8:44956970-44956992 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207703 8:44958838-44958860 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207831 8:44960706-44960728 AACATTCCCATTCATAGAGCAGG + Intergenic
1040207994 8:44963085-44963107 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208118 8:44964953-44964975 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208371 8:44968698-44968720 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208456 8:44970054-44970076 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208549 8:44971410-44971432 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208641 8:44972766-44972788 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208735 8:44974123-44974145 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208829 8:44975479-44975501 AACATTCCCATTCATAGAGCAGG + Intergenic
1040208954 8:44977348-44977370 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209124 8:44979900-44979922 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209247 8:44981768-44981790 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209451 8:44984830-44984852 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209621 8:44987381-44987403 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209712 8:44988737-44988759 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209803 8:44990093-44990115 AACATTCCCATTCATAGAGCAGG + Intergenic
1040209976 8:44992639-44992661 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210150 8:44995188-44995210 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210242 8:44996544-44996566 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210331 8:44997900-44997922 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210456 8:44999768-44999790 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210583 8:45001636-45001658 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210673 8:45002992-45003014 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210797 8:45004860-45004882 AACATTCCCATTCATAGAGCAGG + Intergenic
1040210973 8:45007410-45007432 AACATTCCCATTCATAGAGCAGG + Intergenic
1040211182 8:45010474-45010496 AACATTCCCATTCATAGAGCAGG + Intergenic
1040211307 8:45012342-45012364 AACATTCCCATTCATAGAGCAGG + Intergenic
1040211432 8:45014211-45014233 AACATTCCCATTCATAGAGCAGG + Intergenic
1040211557 8:45016079-45016101 AACATTCCCATTCATAGAGCAGG + Intergenic
1040211688 8:45017946-45017968 AACATTCCCATTCATAGAGCAGG + Intergenic
1040211986 8:45022364-45022386 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212078 8:45023721-45023743 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212170 8:45025077-45025099 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212296 8:45026946-45026968 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212468 8:45029497-45029519 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212598 8:45031367-45031389 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212850 8:45035104-45035126 AACATTCCCATTCATAGAGCAGG + Intergenic
1040212978 8:45036973-45036995 AACATTCCCATTCATAGAGCAGG + Intergenic
1040213268 8:45041227-45041249 AACATTCCCATTCATAGAGCAGG + Intergenic
1040213638 8:45046676-45046698 AACATTCCCATTCATAGAGCAGG + Intergenic
1040213811 8:45049225-45049247 AACATTCCCATTCATAGAGCAGG + Intergenic
1040213937 8:45051093-45051115 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214107 8:45053642-45053664 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214199 8:45054998-45055020 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214290 8:45056354-45056376 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214417 8:45058225-45058247 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214591 8:45060777-45060799 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214763 8:45063326-45063348 AACATTCCCATTCATAGAGCAGG + Intergenic
1040214935 8:45065875-45065897 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215060 8:45067743-45067765 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215233 8:45070293-45070315 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215325 8:45071649-45071671 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215497 8:45074198-45074220 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215589 8:45075553-45075575 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215877 8:45079807-45079829 AACATTCCCATTCATAGAGCAGG + Intergenic
1040215986 8:45081505-45081527 AACATTCCCATTCATAGAGCAGG + Intergenic
1040216356 8:45086954-45086976 AACATTCCCATTCATAGAGCAGG + Intergenic
1040216528 8:45089503-45089525 AACATTCCCATTCATAGAGCAGG + Intergenic
1040216620 8:45090860-45090882 AACATTCCCATTCATAGAGCAGG + Intergenic
1040216790 8:45093409-45093431 AACATTCCCATTCATAGAGCAGG + Intergenic
1040216885 8:45094764-45094786 AACATTCCCATTCATAGAGCAGG + Intergenic
1040217058 8:45097313-45097335 AACATTCCCATTCATAGAGCAGG + Intergenic
1040217316 8:45101056-45101078 AACATTCCCATTCATAGAGCAGG + Intergenic
1040217442 8:45102925-45102947 AACATTCCCATTCATAGAGCAGG + Intergenic
1040217571 8:45104795-45104817 AACATTCCCATTCATAGAGCAGG + Intergenic
1040217777 8:45107858-45107880 AACATTCCCATTCATAGAGCAGG + Intergenic
1040218189 8:45113988-45114010 AACATTCCCATTCATAGAGCAGG + Intergenic
1040218316 8:45115857-45115879 AACATTCCCATTCATAGAGCAGG + Intergenic
1040218408 8:45117213-45117235 AACATTCCCATTCATAGAGCAGG + Intergenic
1040218579 8:45119762-45119784 AACATTCCCATTCATAGAGCAGG + Intergenic
1040218751 8:45122311-45122333 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219035 8:45126560-45126582 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219206 8:45129109-45129131 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219332 8:45130977-45130999 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219459 8:45132845-45132867 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219551 8:45134200-45134222 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219677 8:45136068-45136090 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219770 8:45137424-45137446 AACATTCCCATTCATAGAGCAGG + Intergenic
1040219898 8:45139293-45139315 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220024 8:45141162-45141184 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220114 8:45142518-45142540 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220207 8:45143874-45143896 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220303 8:45145230-45145252 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220672 8:45150678-45150700 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220763 8:45152033-45152055 AACATTCCCATTCATAGAGCAGG + Intergenic
1040220966 8:45155094-45155116 AACATTCCCATTCATAGAGCAGG + Intergenic
1040221054 8:45156450-45156472 AACATTCCCATTCATAGAGCAGG + Intergenic
1040221229 8:45159000-45159022 AACATTCCCATTCATAGAGCAGG + Intergenic
1040221479 8:45162742-45162764 AACATTCCCATTCATAGAGCAGG + Intergenic
1040221570 8:45164098-45164120 AACATTCCCATTCATAGAGCAGG + Intergenic
1040221701 8:45165967-45165989 AACATTCCCATTCATAGAGCAGG + Intergenic
1040221951 8:45169710-45169732 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222043 8:45171066-45171088 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222253 8:45174127-45174149 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222347 8:45175483-45175505 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222439 8:45176840-45176862 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222563 8:45178708-45178730 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222654 8:45180063-45180085 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222858 8:45183124-45183146 AACATTCCCATTCATAGAGCAGG + Intergenic
1040222950 8:45184479-45184501 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223043 8:45185835-45185857 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223166 8:45187704-45187726 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223367 8:45190764-45190786 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223540 8:45193314-45193336 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223633 8:45194670-45194692 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223759 8:45196538-45196560 AACATTCCCATTCATAGAGCAGG + Intergenic
1040223924 8:45198459-45198481 AACATTCCCATTCATAGAGCAGG + Intergenic
1040224049 8:45200327-45200349 AACATTCCCATTCATAGAGCAGG + Intergenic
1040224254 8:45203389-45203411 AACATTCCCATTCATAGAGCAGG + Intergenic
1040224379 8:45205257-45205279 AACATTCCCATTCATAGAGCAGG + Intergenic
1040224503 8:45207126-45207148 AACATTCCCATTCATAGAGCAGG + Intergenic
1040224754 8:45210869-45210891 AACATTCCCATTCATAGAGCAGG + Intergenic
1040224843 8:45212225-45212247 AACATTCCCATTCATAGAGCAGG + Intergenic
1040225053 8:45215284-45215306 AACATTCCCATTCATAGAGCAGG + Intergenic
1040225226 8:45217834-45217856 AACATTCCCATTCATAGAGCAGG + Intergenic
1040225318 8:45219187-45219209 AACATTCCCATTCATAGAGCAGG + Intergenic
1040225490 8:45221736-45221758 AACATTCCCATTCATAGAGCAGG + Intergenic
1040225581 8:45223092-45223114 AACATTCCCATTCATAGAGCAGG + Intergenic
1040225833 8:45226833-45226855 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226056 8:45230057-45230079 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226232 8:45232607-45232629 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226356 8:45234476-45234498 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226487 8:45236344-45236366 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226692 8:45239407-45239429 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226785 8:45240764-45240786 AACATTCCCATTCATAGAGCAGG + Intergenic
1040226877 8:45242120-45242142 AACATTCCCATTCATAGAGCAGG + Intergenic
1040227085 8:45245184-45245206 AACATTCCCATTCATAGAGCAGG + Intergenic
1040227215 8:45247053-45247075 AACATTCCCATTCATAGAGCAGG + Intergenic
1040227424 8:45250114-45250136 AACATTCCCATTCATAGAGCAGG + Intergenic
1040227631 8:45253176-45253198 AACATTCCCATTCATAGAGCAGG + Intergenic
1040227881 8:45256919-45256941 AACATTCCCATTCATAGAGCAGG + Intergenic
1040228168 8:45261176-45261198 AACATTCCCATTCATAGAGCAGG + Intergenic
1040228297 8:45263044-45263066 AACATTCCCATTCATAGAGCAGG + Intergenic
1040228502 8:45266105-45266127 AACATTCCCATTCATAGAGCAGG + Intergenic
1040228594 8:45267461-45267483 AACATTCCCATTCATAGAGCAGG + Intergenic
1040228685 8:45268818-45268840 AACATTCCCATTCATAGAGCAGG + Intergenic
1040228813 8:45270686-45270708 AACATTCCCATTCATAGAGCAGG + Intergenic
1040229268 8:45277492-45277514 AACATTCCCATTCATAGAGCAGG + Intergenic
1040229440 8:45280041-45280063 AACATTCCCATTCATAGAGCAGG + Intergenic
1040229573 8:45281911-45281933 AACATTCCCATTCATAGAGCAGG + Intergenic
1040229743 8:45284460-45284482 AACATTCCCATTCATAGAGCAGG + Intergenic
1040229869 8:45286328-45286350 AACATTCCCATTCATAGAGCAGG + Intergenic
1040229996 8:45288197-45288219 AACATTCCCATTCATAGAGCAGG + Intergenic
1040230379 8:45293809-45293831 AACATTCCCATTCATAGAGCAGG + Intergenic
1040230588 8:45296876-45296898 AACATTCCCATTCATAGAGCAGG + Intergenic
1040230683 8:45298232-45298254 AACATTCCCATTCATAGAGCAGG + Intergenic
1040230887 8:45301294-45301316 AACATTCCCATTCATAGAGCAGG + Intergenic
1040230981 8:45302648-45302670 AACATTCCCATTCATAGAGCAGG + Intergenic
1040231073 8:45304005-45304027 AACATTCCCATTCATAGAGCAGG + Intergenic
1040231163 8:45305361-45305383 AACATTCCCATTCATAGAGCAGG + Intergenic
1040231548 8:45310975-45310997 AACATTCCCATTCATAGAGCAGG + Intergenic
1040231685 8:45313013-45313035 AACATTCCCATTCATAGAGCAGG + Intergenic
1040231858 8:45315563-45315585 AACATTCCCATTCATAGAGCAGG + Intergenic
1040231947 8:45316919-45316941 AACATTCCCATTCATAGAGCAGG + Intergenic
1040232042 8:45318276-45318298 AACATTCCCATTCATAGAGCAGG + Intergenic
1040232168 8:45320144-45320166 AACATTCCCATTCATAGAGCAGG + Intergenic
1040232454 8:45324397-45324419 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233111 8:45334103-45334125 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233202 8:45335459-45335481 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233329 8:45337327-45337349 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233453 8:45339197-45339219 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233578 8:45341064-45341086 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233883 8:45345419-45345441 AACATTCCCATTCATAGAGCAGG + Intergenic
1040233977 8:45346776-45346798 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234068 8:45348132-45348154 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234278 8:45351197-45351219 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234369 8:45352556-45352578 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234493 8:45354424-45354446 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234618 8:45356291-45356313 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234710 8:45357646-45357668 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234803 8:45359000-45359022 AACATTCCCATTCATAGAGCAGG + Intergenic
1040234930 8:45360868-45360890 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235022 8:45362224-45362246 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235200 8:45364773-45364795 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235328 8:45366641-45366663 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235452 8:45368510-45368532 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235578 8:45370379-45370401 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235701 8:45372248-45372270 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235827 8:45374117-45374139 AACATTCCCATTCATAGAGCAGG + Intergenic
1040235955 8:45375985-45376007 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236089 8:45377855-45377877 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236260 8:45380404-45380426 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236387 8:45382272-45382294 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236559 8:45384821-45384843 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236778 8:45388046-45388068 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236902 8:45389914-45389936 AACATTCCCATTCATAGAGCAGG + Intergenic
1040236995 8:45391269-45391291 AACATTCCCATTCATAGAGCAGG + Intergenic
1040237293 8:45395687-45395709 AACATTCCCATTCATAGAGCAGG + Intergenic
1040237419 8:45397556-45397578 AACATTCCCATTCATAGAGCAGG + Intergenic
1040237508 8:45398912-45398934 AACATTCCCATTCATAGAGCAGG + Intergenic
1040237762 8:45402656-45402678 AACATTCCCATTCATAGAGCAGG + Intergenic
1040237857 8:45404012-45404034 AACATTCCCATTCATAGAGCAGG + Intergenic
1040237980 8:45405882-45405904 AACATTCCCATTCATAGAGCAGG + Intergenic
1040238268 8:45410141-45410163 AACATTCCCATTCATAGAGCAGG + Intergenic
1040238360 8:45411497-45411519 AACATTCCCATTCATAGAGCAGG + Intergenic
1040238453 8:45412853-45412875 AACATTCCCATTCATAGAGCAGG + Intergenic
1040238749 8:45417111-45417133 AACATTCCCATTCATAGAGCAGG + Intergenic
1040238873 8:45418980-45419002 AACATTCCCATTCATAGAGCAGG + Intergenic
1040238967 8:45420336-45420358 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239095 8:45422205-45422227 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239186 8:45423560-45423582 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239278 8:45424916-45424938 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239402 8:45426783-45426805 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239569 8:45429326-45429348 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239698 8:45431194-45431216 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239825 8:45433063-45433085 AACATTCCCATTCATAGAGCAGG + Intergenic
1040239915 8:45434419-45434441 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240007 8:45435776-45435798 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240134 8:45437645-45437667 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240226 8:45439001-45439023 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240433 8:45442063-45442085 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240561 8:45443932-45443954 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240693 8:45445800-45445822 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240820 8:45447668-45447690 AACATTCCCATTCATAGAGCAGG + Intergenic
1040240945 8:45449538-45449560 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241037 8:45450894-45450916 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241164 8:45452762-45452784 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241254 8:45454118-45454140 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241377 8:45455986-45456008 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241586 8:45459052-45459074 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241677 8:45460408-45460430 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241847 8:45462958-45462980 AACATTCCCATTCATAGAGCAGG + Intergenic
1040241944 8:45464312-45464334 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242035 8:45465668-45465690 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242160 8:45467536-45467558 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242290 8:45469405-45469427 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242382 8:45470761-45470783 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242474 8:45472117-45472139 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242644 8:45474666-45474688 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242771 8:45476536-45476558 AACATTCCCATTCATAGAGCAGG + Intergenic
1040242899 8:45478405-45478427 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243072 8:45480958-45480980 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243242 8:45483507-45483529 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243371 8:45485376-45485398 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243501 8:45487243-45487265 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243628 8:45489112-45489134 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243721 8:45490467-45490489 AACATTCCCATTCATAGAGCAGG + Intergenic
1040243893 8:45493017-45493039 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244125 8:45496417-45496439 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244217 8:45497772-45497794 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244309 8:45499128-45499150 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244401 8:45500484-45500506 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244544 8:45502533-45502555 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244634 8:45503890-45503912 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244766 8:45505758-45505780 AACATTCCCATTCATAGAGCAGG + Intergenic
1040244890 8:45507626-45507648 AACATTCCCATTCATAGAGCAGG + Intergenic
1040245015 8:45509497-45509519 AACATTCCCATTCATAGAGCAGG + Intergenic
1040245314 8:45513916-45513938 AACATTCCCATTCATAGAGCAGG + Intergenic
1040245648 8:45518849-45518871 AACATTCCCATTCATAGAGCAGG + Intergenic
1040245771 8:45520717-45520739 AACATTCCCATTCATAGAGCAGG + Intergenic
1040245940 8:45523264-45523286 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246067 8:45525132-45525154 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246245 8:45527681-45527703 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246377 8:45529549-45529571 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246510 8:45531417-45531439 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246603 8:45532773-45532795 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246732 8:45534641-45534663 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246823 8:45535997-45536019 AACATTCCCATTCATAGAGCAGG + Intergenic
1040246918 8:45537353-45537375 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247011 8:45538709-45538731 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247135 8:45540578-45540600 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247264 8:45542451-45542473 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247390 8:45544319-45544341 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247515 8:45546187-45546209 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247639 8:45548055-45548077 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247766 8:45549924-45549946 AACATTCCCATTCATAGAGCAGG + Intergenic
1040247972 8:45552989-45553011 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248098 8:45554857-45554879 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248268 8:45557408-45557430 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248362 8:45558767-45558789 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248537 8:45561317-45561339 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248663 8:45563186-45563208 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248789 8:45565054-45565076 AACATTCCCATTCATAGAGCAGG + Intergenic
1040248909 8:45566923-45566945 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249034 8:45568791-45568813 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249160 8:45570658-45570680 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249287 8:45572528-45572550 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249460 8:45575077-45575099 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249589 8:45576945-45576967 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249760 8:45579492-45579514 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249851 8:45580848-45580870 AACATTCCCATTCATAGAGCAGG + Intergenic
1040249980 8:45582718-45582740 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250107 8:45584587-45584609 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250276 8:45587136-45587158 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250367 8:45588492-45588514 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250491 8:45590360-45590382 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250619 8:45592229-45592251 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250746 8:45594097-45594119 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250872 8:45595965-45595987 AACATTCCCATTCATAGAGCAGG + Intergenic
1040250961 8:45597321-45597343 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251088 8:45599189-45599211 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251213 8:45601059-45601081 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251341 8:45602927-45602949 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251470 8:45604795-45604817 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251598 8:45606664-45606686 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251721 8:45608533-45608555 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251811 8:45609888-45609910 AACATTCCCATTCATAGAGCAGG + Intergenic
1040251905 8:45611244-45611266 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252037 8:45613115-45613137 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252160 8:45614985-45615007 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252254 8:45616342-45616364 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252346 8:45617698-45617720 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252477 8:45619569-45619591 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252602 8:45621438-45621460 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252730 8:45623306-45623328 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252857 8:45625174-45625196 AACATTCCCATTCATAGAGCAGG + Intergenic
1040252983 8:45627042-45627064 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253076 8:45628398-45628420 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253169 8:45629755-45629777 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253295 8:45631623-45631645 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253386 8:45632979-45633001 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253478 8:45634335-45634357 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253605 8:45636206-45636228 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253729 8:45638074-45638096 AACATTCCCATTCATAGAGCAGG + Intergenic
1040253856 8:45639945-45639967 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254067 8:45643007-45643029 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254160 8:45644363-45644385 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254292 8:45646231-45646253 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254418 8:45648100-45648122 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254546 8:45649972-45649994 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254672 8:45651841-45651863 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254798 8:45653711-45653733 AACATTCCCATTCATAGAGCAGG + Intergenic
1040254889 8:45655067-45655089 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255013 8:45656936-45656958 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255140 8:45658804-45658826 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255269 8:45660675-45660697 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255491 8:45663898-45663920 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255617 8:45665767-45665789 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255742 8:45667635-45667657 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255868 8:45669504-45669526 AACATTCCCATTCATAGAGCAGG + Intergenic
1040255993 8:45671372-45671394 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256122 8:45673241-45673263 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256216 8:45674598-45674620 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256346 8:45676468-45676490 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256470 8:45678336-45678358 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256596 8:45680206-45680228 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256723 8:45682075-45682097 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256816 8:45683431-45683453 AACATTCCCATTCATAGAGCAGG + Intergenic
1040256940 8:45685300-45685322 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257034 8:45686656-45686678 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257159 8:45688524-45688546 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257251 8:45689881-45689903 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257377 8:45691748-45691770 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257501 8:45693617-45693639 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257592 8:45694973-45694995 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257722 8:45696842-45696864 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257850 8:45698710-45698732 AACATTCCCATTCATAGAGCAGG + Intergenic
1040257941 8:45700065-45700087 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258031 8:45701421-45701443 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258122 8:45702777-45702799 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258251 8:45704645-45704667 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258368 8:45706343-45706365 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258462 8:45707698-45707720 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258587 8:45709567-45709589 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258681 8:45710922-45710944 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258809 8:45712790-45712812 AACATTCCCATTCATAGAGCAGG + Intergenic
1040258898 8:45714146-45714168 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259024 8:45716016-45716038 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259281 8:45719753-45719775 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259408 8:45721622-45721644 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259498 8:45722978-45723000 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259620 8:45724848-45724870 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259710 8:45726203-45726225 AACATTCCCATTCATAGAGCAGG + Intergenic
1040259801 8:45727560-45727582 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260053 8:45731298-45731320 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260180 8:45733166-45733188 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260305 8:45735036-45735058 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260435 8:45736904-45736926 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260562 8:45738774-45738796 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260687 8:45740642-45740664 AACATTCCCATTCATAGAGCAGG + Intergenic
1040260813 8:45742510-45742532 AACATTCCCATTCATAGAGCAGG + Intergenic
1040261034 8:45745735-45745757 AACATTCCCATTCATAGAGCAGG + Intergenic
1040261163 8:45747603-45747625 AACATTCCCATTCATAGAGCAGG + Intergenic
1040261289 8:45749471-45749493 AACATTCCCATTCATAGAGCAGG + Intergenic
1040261413 8:45751340-45751362 AACATTCCCATTCATAGAGCAGG + Intergenic
1040261538 8:45753208-45753230 AACATTCCCATTCATAGAGCAGG + Intergenic
1040261664 8:45755076-45755098 AACATTCCCATTCATAGAGCAGG + Intergenic
1040262042 8:45760683-45760705 AACATTCCCATTCATAGAGCAGG + Intergenic
1040262167 8:45762551-45762573 AACATTCCCATTCATAGAGCAGG + Intergenic
1040262296 8:45764421-45764443 AACATTCCCATTCATAGAGCAGG + Intergenic
1040262420 8:45766289-45766311 AACATTCCCATTCATAGAGCAGG + Intergenic
1040262672 8:45770026-45770048 AACATTCCCATTCATAGAGCAGG + Intergenic
1040262798 8:45771896-45771918 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263054 8:45775634-45775656 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263179 8:45777504-45777526 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263308 8:45779373-45779395 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263439 8:45781242-45781264 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263566 8:45783110-45783132 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263690 8:45784979-45785001 AACATTCCCATTCATAGAGCAGG + Intergenic
1040263812 8:45786847-45786869 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264065 8:45790583-45790605 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264192 8:45792451-45792473 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264284 8:45793806-45793828 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264411 8:45795676-45795698 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264535 8:45797544-45797566 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264661 8:45799413-45799435 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264786 8:45801283-45801305 AACATTCCCATTCATAGAGCAGG + Intergenic
1040264911 8:45803150-45803172 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265040 8:45805020-45805042 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265165 8:45806888-45806910 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265296 8:45808756-45808778 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265423 8:45810624-45810646 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265551 8:45812493-45812515 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265677 8:45814362-45814384 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265801 8:45816230-45816252 AACATTCCCATTCATAGAGCAGG + Intergenic
1040265925 8:45818099-45818121 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266054 8:45819969-45819991 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266181 8:45821839-45821861 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266304 8:45823710-45823732 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266429 8:45825579-45825601 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266553 8:45827448-45827470 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266684 8:45829317-45829339 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266809 8:45831187-45831209 AACATTCCCATTCATAGAGCAGG + Intergenic
1040266933 8:45833056-45833078 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267057 8:45834926-45834948 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267183 8:45836795-45836817 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267309 8:45838663-45838685 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267435 8:45840533-45840555 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267564 8:45842403-45842425 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267687 8:45844272-45844294 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267813 8:45846139-45846161 AACATTCCCATTCATAGAGCAGG + Intergenic
1040267945 8:45848007-45848029 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268072 8:45849875-45849897 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268198 8:45851743-45851765 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268328 8:45853611-45853633 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268456 8:45855480-45855502 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268546 8:45856835-45856857 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268674 8:45858704-45858726 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268799 8:45860573-45860595 AACATTCCCATTCATAGAGCAGG + Intergenic
1040268950 8:45862780-45862802 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269084 8:45864740-45864762 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269208 8:45866609-45866631 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269334 8:45868481-45868503 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269459 8:45870350-45870372 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269590 8:45872218-45872240 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269715 8:45874086-45874108 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269839 8:45875955-45875977 AACATTCCCATTCATAGAGCAGG + Intergenic
1040269984 8:45928050-45928072 AACATTCCCATTCATAGAGCAGG + Intergenic
1040270108 8:45929918-45929940 ATCATTCCCATTCATAGAGCAGG + Intergenic
1040270231 8:45931786-45931808 AACATTCCCATTCATAGAGCAGG + Intergenic
1040270352 8:45933654-45933676 AACATTCCCATTCATAGAGCAGG + Intergenic
1040270601 8:45937392-45937414 AACATTCCCATTCATAGAGCAGG + Intergenic
1040270731 8:45939261-45939283 AACATTCCCATTCATAGAGCAGG + Intergenic
1040271141 8:45945205-45945227 AACATTCCCATTCATAGAGCAGG + Intergenic
1042012995 8:64270471-64270493 GTCATTCCAATACATAGAGAGGG + Intergenic
1044864980 8:96562231-96562253 GTCTTTTCAACAAATAGAGCTGG - Intronic
1050596075 9:7205847-7205869 GACATACCCTCACACAGAGCTGG + Intergenic
1053953866 9:43434454-43434476 AACATTCCCATTCATAGAGCAGG + Intergenic
1054021200 9:44602473-44602495 AACATTCCCATTCATAGAGCAGG + Intergenic
1054077554 9:60554013-60554035 AACATTCCCATTCATAGAGCAGG - Intergenic
1054077773 9:60557926-60557948 AACATTCCCATTCATAGAGCAGG - Intergenic
1054082959 9:60646365-60646387 AACATTCCCATTCATAGAGCAGG - Intergenic
1054083178 9:60650278-60650300 AACATTCCCATTCATAGAGCAGG - Intergenic
1056315816 9:85388877-85388899 GTAATTCCCACACACAAAGCTGG - Intergenic
1056618674 9:88191513-88191535 GTCATTGCCACAGAAAGAGGTGG + Intergenic
1060493987 9:124104647-124104669 GGCATTCCCACGCCTTGAGCAGG - Intergenic
1061198024 9:129118950-129118972 GTCCTTCCCACCCACAGAGCGGG + Intronic
1062157485 9:135061149-135061171 GTCATTCCCACTCCCAGGGCTGG - Intergenic
1203418414 Un_KI270378v1:588-610 AACATTCCCATTCATAGAGCAGG + Intergenic
1203378004 Un_KI270465v1:1000-1022 AACATTCCCATTCATAGAGCAGG - Intergenic
1203392916 Un_KI270468v1:1957-1979 ATCATTCCCTTTCATAGAGCAGG + Intergenic
1190969993 X:55339459-55339481 GTCATTCTCACACAAAGAGGTGG + Intergenic
1192493644 X:71598386-71598408 GTCATTCCCACACATAGAGCGGG - Intronic
1194097998 X:89666616-89666638 GACATTCCCCCACATACACCTGG - Intergenic
1200451020 Y:3328005-3328027 GACATTCCCCCACATACACCTGG - Intergenic