ID: 1192493645

View in Genome Browser
Species Human (GRCh38)
Location X:71598387-71598409
Sequence CGTCATTCCCACACATAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493645_1192493648 -9 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493645_1192493652 30 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493652 X:71598440-71598462 CATTCTTCCTTCCAGCTTGAAGG 0: 1
1: 0
2: 2
3: 18
4: 255
1192493645_1192493650 5 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493645_1192493649 0 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493645 Original CRISPR CGTCATTCCCACACATAGAG CGG (reversed) Intronic
905262655 1:36730564-36730586 GGTCATTACCAAACATCGAGAGG + Intergenic
906847929 1:49214469-49214491 AGTCAGTCCCACACCTGGAGAGG - Intronic
910879628 1:91911246-91911268 TGTAATCCCCACACATTGAGAGG - Intergenic
922037681 1:221865483-221865505 GCTCCTGCCCACACATAGAGGGG + Intergenic
1064284713 10:13982359-13982381 TGTAATTCCAACACTTAGAGAGG + Intronic
1066349766 10:34626420-34626442 CTGTATTCCCACACAGAGAGGGG - Intronic
1083386055 11:62311195-62311217 CTTCATTGCCACACACAGAGTGG - Intergenic
1093653544 12:21671129-21671151 CCTCATCCCCACACTTATAGGGG + Intronic
1096621652 12:52869269-52869291 CCTCATTCCCAGCCACAGAGAGG + Intergenic
1097074151 12:56379893-56379915 TGTCATTCCAACACTTTGAGAGG - Intergenic
1104916999 12:132270855-132270877 AGTCATTGCCACACACAGGGAGG + Intronic
1108325008 13:49321619-49321641 GGTCACTGCCACACATGGAGAGG - Intronic
1113842728 13:113369546-113369568 CGTCACTCCCACGGACAGAGGGG - Intergenic
1116135446 14:40917288-40917310 GGTCATTCCCACACACACTGGGG + Intergenic
1117960676 14:61158758-61158780 TGTCATTCCAACACTTTGAGAGG - Intergenic
1126462218 15:48926364-48926386 TGCCATTCCCAAGCATAGAGAGG - Intronic
1127304180 15:57685901-57685923 GGTCATTCCCACATAGGGAGTGG + Intronic
1128238122 15:66081183-66081205 CTTCATTCCCAGACCTGGAGAGG - Intronic
1132385080 15:101394583-101394605 CGTCCTTCCCAAACAAACAGAGG + Intronic
1132411849 15:101585453-101585475 CCTTATTCCCAAACTTAGAGGGG + Intergenic
1132554726 16:567453-567475 TGCCATTCCCACACACAGTGGGG + Exonic
1133776152 16:8896872-8896894 CGTCATTCCCAGACTCAGTGGGG - Intronic
1134676034 16:16091170-16091192 TGTAATCCCAACACATAGAGAGG + Intronic
1136911557 16:34148230-34148252 TGTCATTCCAACACTTTGAGAGG + Intergenic
1137972109 16:52995819-52995841 TGTAATTCCAACACTTAGAGAGG + Intergenic
1141472605 16:84249717-84249739 CCTCATTTCCAGACACAGAGGGG - Intergenic
1141805019 16:86336582-86336604 CCTCATCCCCACGCAGAGAGGGG + Intergenic
1147548835 17:41423896-41423918 CGTAAATACCACACATGGAGTGG - Intronic
1150435992 17:65154635-65154657 CCTCACCCCCACACACAGAGAGG - Intronic
1153691489 18:7599009-7599031 CGTCATTCCCAAACACACTGTGG + Intronic
1157480367 18:48050069-48050091 CCTCATTCCCACATCTGGAGAGG - Intronic
1160035830 18:75300853-75300875 CCTCATTCCAACCCAAAGAGAGG - Intergenic
1162317534 19:9948991-9949013 AGCCATTCCCACACTCAGAGGGG + Intergenic
937340324 2:121086976-121086998 AGTGTTTCCCACACTTAGAGGGG + Intergenic
945925302 2:215797098-215797120 CCACAACCCCACACATAGAGCGG + Intergenic
959456394 3:106568111-106568133 TGTCATTCCAACACTTAGGGAGG + Intergenic
971633910 4:29032010-29032032 CCTCATTCCCAATCATAGATTGG - Intergenic
972405105 4:38738192-38738214 CACCATTCCCACTCATAGATGGG + Intergenic
976187700 4:82458823-82458845 AGACATTCCCACACAGAGAGGGG + Intronic
977668238 4:99665975-99665997 CCCCATCCCCACACACAGAGTGG + Intergenic
977764915 4:100785893-100785915 CGACATTCCCACAGATATTGTGG + Intronic
980057724 4:128095005-128095027 TGTCATTTCCACACTTTGAGAGG - Intronic
986427117 5:7644654-7644676 AGTCATTCACAGAAATAGAGAGG - Intronic
990669258 5:58109119-58109141 AGTCATTCACACACACCGAGGGG + Intergenic
994565022 5:101433465-101433487 GCTCATGGCCACACATAGAGTGG - Intergenic
994741182 5:103621471-103621493 CATAATTCCCACCCACAGAGTGG + Intergenic
997131461 5:131280862-131280884 CCTCATTCTCACACATAAAAAGG - Intronic
998137582 5:139682231-139682253 CGTCAAGCCCACTCATAGAGGGG - Intronic
1001459339 5:171895934-171895956 TGTTCTTGCCACACATAGAGAGG - Intronic
1001985395 5:176070341-176070363 TGTCTTTTCCACACATACAGTGG + Intronic
1002231477 5:177767779-177767801 TGTCTTTTCCACACATACAGTGG - Intronic
1002263863 5:178015965-178015987 TGTCTTTTCCACACATACAGTGG + Intronic
1004864630 6:19839332-19839354 CGTCATTCCAAGAGAGAGAGAGG + Exonic
1006738580 6:36292181-36292203 CTTCCTTCCCCCACATACAGGGG + Intronic
1011284786 6:85711465-85711487 CTTCATTTGCACACACAGAGAGG + Intergenic
1021281501 7:18725022-18725044 CTTCATAGCCACACATAGAGGGG + Intronic
1022892047 7:34711377-34711399 CTTCATTCCATCTCATAGAGAGG - Intronic
1029590741 7:101505380-101505402 AGTCATGCACACACATGGAGTGG - Intronic
1033511232 7:142062133-142062155 TGTCATTCCCACTGAGAGAGGGG - Intronic
1038475588 8:27864357-27864379 CTTCATTACATCACATAGAGTGG - Intergenic
1039447363 8:37643447-37643469 CGTCGATGCCACACACAGAGGGG + Intergenic
1042012994 8:64270470-64270492 TGTCATTCCAATACATAGAGAGG + Intergenic
1047171582 8:122498292-122498314 ACTCACTCCCACACATAGATAGG + Intergenic
1048749195 8:137651575-137651597 CGTGGTCCCCACACCTAGAGGGG - Intergenic
1059367529 9:113798282-113798304 TGTAATTCCCACACTTTGAGAGG - Intergenic
1059834931 9:118141293-118141315 AGCCATTTCCACACTTAGAGAGG + Intergenic
1060127864 9:121067304-121067326 TGTAATTCCCACACTTTGAGAGG + Intergenic
1061198023 9:129118949-129118971 GGTCCTTCCCACCCACAGAGCGG + Intronic
1062057998 9:134478679-134478701 CCTCATGTCCACACATAGTGGGG - Intergenic
1062487971 9:136790774-136790796 CCTCATTCCCACACTTGCAGAGG - Intergenic
1188698008 X:33220791-33220813 CCTCACTCCCACTCATAGATGGG + Intronic
1192493645 X:71598387-71598409 CGTCATTCCCACACATAGAGCGG - Intronic
1192589509 X:72348180-72348202 CTGAACTCCCACACATAGAGTGG + Intronic
1200892806 Y:8341637-8341659 TGTCATTCCTACACATAAACAGG + Intergenic
1201673353 Y:16550641-16550663 TGTAATTCCCACACTTTGAGAGG - Intergenic