ID: 1192493648

View in Genome Browser
Species Human (GRCh38)
Location X:71598401-71598423
Sequence GGAATGACGAGGAAGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1151
Summary {0: 1, 1: 0, 2: 11, 3: 102, 4: 1037}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493644_1192493648 -8 Left 1192493644 X:71598386-71598408 CCCGCTCTATGTGTGGGAATGAC 0: 1
1: 0
2: 0
3: 8
4: 1578
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493639_1192493648 7 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493638_1192493648 8 Left 1192493638 X:71598370-71598392 CCCTCTTCCTCTCTTCCCCGCTC 0: 1
1: 1
2: 21
3: 250
4: 2061
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493643_1192493648 -7 Left 1192493643 X:71598385-71598407 CCCCGCTCTATGTGTGGGAATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493640_1192493648 1 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037
1192493645_1192493648 -9 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG 0: 1
1: 0
2: 11
3: 102
4: 1037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493648 Original CRISPR GGAATGACGAGGAAGAGGAA AGG Intronic
900030101 1:365015-365037 GGAAAGAGGAGGAGGAGGACGGG - Intergenic
900050753 1:594079-594101 GGAAAGAGGAGGAGGAGGACGGG - Intergenic
900508042 1:3039409-3039431 GGAGGGAGGAGGAAGGGGAAGGG - Intergenic
900918549 1:5656139-5656161 GGGATGGAGAGAAAGAGGAAGGG + Intergenic
900926756 1:5710783-5710805 GGAAGGAGAAGGAAGTGGAAGGG + Intergenic
900943083 1:5813765-5813787 GGAAGGAGGAGGAAGAGAAAAGG + Intergenic
901029942 1:6301158-6301180 GGAAGGAGGAGGGAAAGGAAGGG + Intronic
901421545 1:9154537-9154559 TGACTCAGGAGGAAGAGGAAGGG - Intergenic
901487618 1:9575946-9575968 AGCATGACCAGGAAGGGGAAGGG - Intronic
901811415 1:11768828-11768850 GGAATGAATAGGCAGAGTAATGG + Intronic
902170408 1:14605680-14605702 AGGAGGAGGAGGAAGAGGAAGGG + Intronic
902373202 1:16017897-16017919 AGGAGGAAGAGGAAGAGGAATGG + Exonic
902767435 1:18626751-18626773 GGAAGGAAGAGGAAGAGAAAGGG + Intergenic
903751488 1:25624202-25624224 GGAGTGAGGAGGAAGACGGAGGG - Intronic
903805679 1:26004171-26004193 GGAAGGAAGGGGAAGAAGAAGGG - Intergenic
903864762 1:26389919-26389941 AGAATGAGGAGGAAGGGGCAGGG + Intergenic
904599112 1:31664153-31664175 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
904899109 1:33842256-33842278 GGAGTGAAGATGAAAAGGAAGGG - Intronic
905544360 1:38785999-38786021 GGAATGGAGAGGAAAGGGAAGGG + Intergenic
906103572 1:43278406-43278428 GGAATGAGGAGGAAGGAGATGGG + Intergenic
906501031 1:46341944-46341966 GGACTGATGAGCAAGGGGAAAGG - Intronic
906544445 1:46611588-46611610 GGAATGGTGAGGAAGAGGAGGGG - Intronic
906962921 1:50430351-50430373 GAAATGACCAGGAGGAGGGAGGG + Intergenic
907676427 1:56521754-56521776 GGAAGGAAGAGAAAGAGGGAAGG - Intronic
908090741 1:60683183-60683205 AGAATGAAGGAGAAGAGGAAGGG + Intergenic
908187773 1:61668993-61669015 GGAAAGAAGAGAAAGAAGAAAGG + Intergenic
908252473 1:62275888-62275910 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
908634026 1:66142171-66142193 AGGTTGAGGAGGAAGAGGAAGGG + Intronic
908638722 1:66198183-66198205 GGAATCACTAGGAAAGGGAACGG - Intronic
909334486 1:74455761-74455783 AGAATGAGGAGGCAGAGGAAGGG - Intronic
909524067 1:76602421-76602443 GGAGGGACCAGGAAGGGGAATGG + Intronic
909610617 1:77548082-77548104 AGAATGGAGAGGAAGAGAAAAGG + Intronic
909686523 1:78355115-78355137 GGGAGGAGGAGGAAGAGGAGAGG - Intronic
909706877 1:78595937-78595959 GGAATAACCAGGTAGAAGAATGG + Intergenic
909885282 1:80934400-80934422 AGAAAGAGGAGGAAGAGGAGGGG + Intergenic
910094726 1:83508302-83508324 GGAGTGCCAAGGAAGAGAAAGGG + Intergenic
910201629 1:84706062-84706084 GGAATAAAGAGATAGAGGAATGG - Intergenic
910224262 1:84920145-84920167 GGAATGGCTAGGCAGAGGAGAGG + Intergenic
910666191 1:89728129-89728151 GAAATAAGGAGGAAGAGGCAGGG - Intronic
910711528 1:90187138-90187160 TGAAAGACGAGGAGGAGGCAAGG - Intergenic
910760714 1:90728793-90728815 GGGAGGAGGAGGAGGAGGAAGGG + Intergenic
910858514 1:91720046-91720068 GGAATGAAGAGGGAGAAGATGGG - Exonic
911377606 1:97070055-97070077 GGAAAGAAAAGGAAGAGGTAGGG + Intergenic
911473663 1:98349701-98349723 GGAAGAAAGAAGAAGAGGAAAGG - Intergenic
912191571 1:107346990-107347012 GGAAGGAAGAGGAAGAGGTAGGG + Intronic
912440141 1:109691518-109691540 GGAAAAAAGAGGAAGAGGAGTGG - Intronic
912667392 1:111594507-111594529 GGAAGGAAGGGGAAGGGGAAAGG + Intronic
912870733 1:113302958-113302980 GGAAAGAAGAGAAAGATGAAGGG + Intergenic
912904762 1:113692562-113692584 AGACTGAGGAGGAAGAGGAGCGG - Intergenic
913372811 1:118119364-118119386 GGAGTGAGGTGGCAGAGGAAAGG + Intronic
913542738 1:119837328-119837350 ATGATGATGAGGAAGAGGAAGGG - Intergenic
915165199 1:153944473-153944495 GGAAGGACTAGGAAGAGGAGGGG - Intronic
915211455 1:154312780-154312802 GGAAAGTGGAGGAAGAAGAAAGG - Intergenic
915212589 1:154321757-154321779 GGAAAGTGGAGGAAGAAGAAAGG - Intronic
915304436 1:154969613-154969635 GGAATGAGGAGAAAAAGAAAAGG + Intronic
916025047 1:160826251-160826273 AGGCTGAGGAGGAAGAGGAAGGG + Intronic
916438928 1:164803056-164803078 AGGATGACAAGAAAGAGGAAAGG + Intronic
916540451 1:165748572-165748594 GAAAAGAAGAGGGAGAGGAAGGG + Intronic
916729094 1:167550503-167550525 GGAATGAAGAGGAAGGGGCAAGG + Intronic
917176038 1:172236594-172236616 AGAAGGAGGAGGAAAAGGAAAGG + Intronic
917359522 1:174160103-174160125 GGAAGGGCGAGGGAGAGAAATGG - Intronic
918328996 1:183438192-183438214 GGAAGGAAGGGGAAGGGGAAAGG + Intergenic
918434665 1:184499147-184499169 GGGAAGAGGAGGAGGAGGAAGGG - Intronic
918733089 1:188022912-188022934 GGAATAAAGGGGAAGAGGAGAGG + Intergenic
918761863 1:188420588-188420610 GGAAGAAGGAGGAAGGGGAAGGG - Intergenic
918827817 1:189349371-189349393 GGAATGGGGAGATAGAGGAAGGG + Intergenic
919010450 1:191954520-191954542 AGCAGGAGGAGGAAGAGGAAGGG - Intergenic
919449351 1:197751937-197751959 AGAAGGAGGAGGAGGAGGAAGGG + Intronic
919482240 1:198104791-198104813 GGAAATACGAGAAAAAGGAAGGG + Intergenic
919684053 1:200465222-200465244 GGAAGAAAGAGGAAGAGGGACGG + Intergenic
919795658 1:201320081-201320103 GGAAGGAAGGAGAAGAGGAAAGG - Intronic
919947252 1:202328618-202328640 GGAAGGACAAGGAAGAGGTGTGG - Intergenic
920199761 1:204252339-204252361 GGGATGAGGAGGAAGAGGAAGGG + Intronic
920690755 1:208144689-208144711 GGAGTGATGAGGCACAGGAATGG - Intronic
920711015 1:208295132-208295154 AGAAGGAAGAGGAAAAGGAAAGG - Intergenic
920987551 1:210904690-210904712 GAAAGGAAGAGGAAGAGGAATGG + Intronic
921191094 1:212709282-212709304 GGGAAGGAGAGGAAGAGGAAGGG - Intergenic
921291303 1:213660222-213660244 GGAGTGACAGGGAGGAGGAACGG + Intergenic
921458168 1:215396583-215396605 AGGAGGAGGAGGAAGAGGAAGGG + Intergenic
921784696 1:219215976-219215998 GGAATGAAGAGCAATAGAAAAGG - Intergenic
921818378 1:219589427-219589449 AGAATGATGAGGAAGAGTAAGGG + Intergenic
922001371 1:221481868-221481890 AGGAGGAAGAGGAAGAGGAAGGG - Intergenic
922036854 1:221857155-221857177 GGAATGAATAGGAAGAGTACAGG - Intergenic
922068557 1:222168497-222168519 GGAAGGAGGAGGAGGAGGCAAGG + Intergenic
922442825 1:225670613-225670635 GCAATAACGAGGAACAGAAAAGG - Intergenic
922553263 1:226512986-226513008 GGAATTACGGTGAACAGGAAAGG + Intergenic
922724380 1:227915639-227915661 GGAAGGACGAGGAGGAGGAGGGG - Intergenic
922787822 1:228291928-228291950 GGAATGAAGAGGCCGTGGAAGGG + Exonic
922905060 1:229168048-229168070 GGAAGGAGGAGGAAGAGGAGGGG + Intergenic
923432476 1:233936608-233936630 AGAATGAGGAGGAGGAGGAGAGG - Intronic
923771225 1:236939290-236939312 GGAAAGAAGGGGAAGAAGAAAGG - Intergenic
923777524 1:236993153-236993175 AGAATAAAGAGGCAGAGGAAAGG + Intergenic
923893064 1:238237052-238237074 AGAAGGAGGAGGAAGAGGAGGGG + Intergenic
924155187 1:241168178-241168200 GGAATGATGAGAAAGAGGATGGG + Intronic
924226312 1:241924579-241924601 AGGCTGAGGAGGAAGAGGAAGGG - Intergenic
924424082 1:243934153-243934175 GGAAGGAGAAGGGAGAGGAAGGG - Intergenic
924545848 1:245026588-245026610 GGAAAAACATGGAAGAGGAATGG + Intronic
924952109 1:248894758-248894780 GGAAGGAAGGAGAAGAGGAAGGG - Intergenic
924956989 1:248939134-248939156 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1063197677 10:3758671-3758693 TGAAGGAGGAGGCAGAGGAAAGG - Intergenic
1063223115 10:3989462-3989484 GGGAAGAGGAAGAAGAGGAAGGG - Intergenic
1063296365 10:4810808-4810830 GGAAGGAAGAGAAAGAGGGAAGG + Intronic
1063693228 10:8307029-8307051 CCAATGCCAAGGAAGAGGAATGG - Intergenic
1063761164 10:9078652-9078674 GAATTTATGAGGAAGAGGAAGGG + Intergenic
1063884366 10:10562725-10562747 GGAAGGAATGGGAAGAGGAAGGG - Intergenic
1064106436 10:12504458-12504480 GGAATGAAAAGGCAGAGGAAGGG - Intronic
1064299793 10:14113289-14113311 GGGCTGAGGAGGAAGAGGAGAGG - Intronic
1064341534 10:14489963-14489985 GGAAAGGAAAGGAAGAGGAAGGG + Intergenic
1064407797 10:15079947-15079969 GGACTGAGGCAGAAGAGGAAGGG - Intronic
1064504281 10:16012453-16012475 GCAATAATAAGGAAGAGGAAAGG - Intergenic
1064700191 10:18010875-18010897 GGACGGAGGAGGAGGAGGAACGG - Intronic
1064704694 10:18059670-18059692 TGCGTGACCAGGAAGAGGAAAGG - Intergenic
1065188250 10:23189614-23189636 GGGAGGAGGAGGAGGAGGAAGGG + Intergenic
1065562809 10:26980570-26980592 GGAATGACCAGTAACAGGTAGGG - Intergenic
1065578538 10:27148529-27148551 GGGCTGAGGAGGAAGAGGAGGGG - Intronic
1065866580 10:29919998-29920020 GAAAGGAGGAGGAAGAGGAGGGG - Intergenic
1065904807 10:30240792-30240814 AGAAGGAAGAGGAGGAGGAAAGG + Intergenic
1066002660 10:31118896-31118918 TAAGTGACGAGGAATAGGAAAGG - Intergenic
1066011573 10:31199144-31199166 AGAAGGAGGAGAAAGAGGAAGGG - Intergenic
1066221862 10:33343055-33343077 GGAAGGAGGAGGAAGAGGAGGGG + Intergenic
1066671481 10:37844978-37845000 GGAAGGAGAAGGAAGGGGAAAGG - Intronic
1066677740 10:37905992-37906014 TGAGTGACTGGGAAGAGGAATGG - Intergenic
1066700370 10:38121382-38121404 GGAATCAAAAGAAAGAGGAATGG - Exonic
1066991319 10:42516833-42516855 GGAATCAAAAGAAAGAGGAAGGG + Intergenic
1067177767 10:43962238-43962260 AGAATGGGGAGGAGGAGGAAAGG + Intergenic
1067394602 10:45902991-45903013 GGAATGAGGAGGAAAACAAAAGG + Intergenic
1067552130 10:47243626-47243648 GGACTGAAGAGGGAGAGGCAGGG - Intergenic
1067784689 10:49236879-49236901 GAAATGGCGAGGAAGGGGCAGGG - Intergenic
1067862925 10:49872122-49872144 GGAATGAGGAGGAAAACAAAAGG + Intronic
1068018904 10:51555772-51555794 GGAAGGTAGGGGAAGAGGAAGGG + Intronic
1068052350 10:51966790-51966812 GCATTGACAAGGATGAGGAAAGG - Intronic
1068435744 10:56989044-56989066 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1068638419 10:59373992-59374014 GGAAGGAAGAGGTGGAGGAAGGG + Intergenic
1068744414 10:60513984-60514006 AGGCTGAGGAGGAAGAGGAAGGG - Intronic
1068847562 10:61695993-61696015 GGAATGAAGAGCAAGTGAAACGG + Intronic
1069074459 10:64023860-64023882 AGAAGGAGGAGGAAGAGGAGGGG + Intergenic
1069272021 10:66540639-66540661 GAAAGGAAGAGAAAGAGGAAGGG - Intronic
1069308582 10:67004362-67004384 GTAATGATGAGGATGAGAAAAGG + Intronic
1069332941 10:67315030-67315052 AGAATGAGGAGGAATAGCAAGGG - Intronic
1069716811 10:70526378-70526400 GGAATGCGGAGGAGGAGGCATGG + Intronic
1070045308 10:72828488-72828510 GGAATGCTGAGGGGGAGGAAGGG - Intronic
1070326105 10:75390332-75390354 TGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1070444608 10:76484107-76484129 AGAAAGAGGAGGAAGAAGAAGGG - Intronic
1070974826 10:80597991-80598013 GGAAAGAGGAGGCAGAGCAAAGG + Intronic
1071348940 10:84720027-84720049 GGAATGACAGGGACCAGGAAAGG + Intergenic
1071370724 10:84948894-84948916 TGAAAGACAAGGAAGAGGCAGGG - Intergenic
1071660913 10:87502006-87502028 GGATTGACAACTAAGAGGAATGG - Intergenic
1071729905 10:88237304-88237326 GGAAGGAAGGGGAAGAGGGAAGG - Intergenic
1071766543 10:88672351-88672373 GGAAAGAGGAGGGAAAGGAAGGG + Intronic
1071805055 10:89109614-89109636 AGGAGGAGGAGGAAGAGGAAGGG + Intergenic
1072611361 10:97019459-97019481 GGCATGAGGGGAAAGAGGAAGGG - Intronic
1072818935 10:98537207-98537229 GGAATGGAGAGGTAGGGGAATGG + Intronic
1073046466 10:100641961-100641983 GGAATGAGGAGGAAGGTGAGGGG + Intergenic
1073049280 10:100656986-100657008 GGAAAGAAGATGGAGAGGAAAGG + Intergenic
1073210289 10:101795574-101795596 GGAGAGAGGAGGAAAAGGAAGGG + Intronic
1074183446 10:111082306-111082328 GGAGTGAGGAGGGAGAGGAGAGG - Intergenic
1074253300 10:111775616-111775638 GGAAGGGAGAGGTAGAGGAAGGG + Intergenic
1074365874 10:112857114-112857136 AGAATGAAAAGGCAGAGGAAAGG - Intergenic
1074604670 10:114949641-114949663 GGTATGAATTGGAAGAGGAAGGG + Intronic
1074681161 10:115909161-115909183 GGCATGAAGAGGAAGGGGAGGGG - Intronic
1074691140 10:116005099-116005121 AGAAAGAGGAGGAGGAGGAAGGG - Intergenic
1074921529 10:118019357-118019379 GGGAAGAGGAGGAAGAGGGAAGG + Intronic
1075049899 10:119175732-119175754 GGAAAGAGGAGCAGGAGGAAGGG + Intronic
1075301718 10:121330658-121330680 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1075372356 10:121948129-121948151 GCTATGAGGAGGAAGTGGAACGG + Intergenic
1075458944 10:122603019-122603041 GGAATGAGGAGGGAAAGAAATGG - Intronic
1075459576 10:122607078-122607100 GGAATGAGGAGGGAAAGAAATGG - Intronic
1075460208 10:122611137-122611159 GGAATGAGGAGGGAAAGAAATGG - Intronic
1075460840 10:122615196-122615218 GGAATGAGGAGGGAAAGAAATGG - Intronic
1075570881 10:123543738-123543760 GGAATGAAGAGGACCAGAAATGG - Intergenic
1075851964 10:125596365-125596387 GGGAAGAGGAGGAAGAGGGAGGG + Intronic
1075993649 10:126859363-126859385 GAGATGAAGAGGAAGAGGGAAGG - Intergenic
1076693223 10:132234350-132234372 GGAATGTGGCAGAAGAGGAAGGG - Intronic
1076921446 10:133456602-133456624 GGGAGGACGAGGAGGAGGACTGG + Intergenic
1076962895 10:133780977-133780999 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1077010860 11:378730-378752 GGAATGAGGAGGAAGGGGCCAGG + Intronic
1077210774 11:1370092-1370114 GGAAGGAGGAGGAGGAGGAGGGG + Intergenic
1077318471 11:1929551-1929573 GGAAGGGTGAGGAAGAGGTAGGG - Intronic
1077372777 11:2191273-2191295 GGAAGGAGGAGGATGAGGGAGGG + Intergenic
1077603447 11:3590379-3590401 TGCATGTCCAGGAAGAGGAATGG - Intergenic
1078064415 11:8068521-8068543 GGAATGAGTAGGGAGAAGAAGGG - Intronic
1078362566 11:10680531-10680553 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1078365241 11:10700832-10700854 GGAAGGCCAAGGAAGAGCAAAGG - Intergenic
1078391434 11:10938619-10938641 ACAAGGATGAGGAAGAGGAAGGG - Intergenic
1078456219 11:11477511-11477533 GAAAGGAGGAGGGAGAGGAAAGG - Intronic
1078638893 11:13077317-13077339 GAAAGGAGGAGGAAGAGGAATGG + Intergenic
1078854620 11:15196945-15196967 GGGAGGAAGAGGAAGAGGAGGGG - Intronic
1079222236 11:18573364-18573386 GGAAGGGAGAGGAAGAGGGAAGG - Intronic
1079400050 11:20099398-20099420 GGACTGAGGAGTAAAAGGAATGG + Intronic
1079511723 11:21217954-21217976 GAAATGAGAAGGAAGAAGAAAGG + Intronic
1079566660 11:21891094-21891116 GGAAGGAGGAAGAAAAGGAAGGG - Intergenic
1080040124 11:27751165-27751187 GGAATAAGGAGGAATTGGAAAGG - Intergenic
1080111736 11:28575601-28575623 GGAATGGAAAGGAAAAGGAAGGG - Intergenic
1080242788 11:30146368-30146390 GGAAAGAAAAGGAAAAGGAAAGG + Intergenic
1080921970 11:36718144-36718166 GGAATGTTGAGGGAGAGGATGGG + Intergenic
1081231806 11:40594097-40594119 GCAATGACGAGGGAGAGCTAAGG - Intronic
1081632992 11:44701958-44701980 GGAAAGAAGGAGAAGAGGAAAGG - Intergenic
1082002467 11:47400520-47400542 GGTCTGAGAAGGAAGAGGAAAGG + Intergenic
1083023967 11:59534248-59534270 GGAATGAGGAGGAATTTGAAAGG - Intergenic
1083067458 11:59939639-59939661 AGAAAGAAGAGGAAGAGAAAGGG - Intergenic
1083431111 11:62613889-62613911 GGGAGGAGGAGGAGGAGGAAGGG - Intronic
1083799560 11:65038665-65038687 GGCAGGAGGAGGAAGAGGATGGG + Exonic
1083912194 11:65716739-65716761 GTCATGACGTAGAAGAGGAAAGG - Exonic
1084259348 11:67964924-67964946 TGCATGTCCAGGAAGAGGAATGG - Intergenic
1084627267 11:70318037-70318059 GCAATGAAGTGGAAGAGGCAAGG - Intronic
1084813427 11:71630260-71630282 TGCATGTCCAGGAAGAGGAATGG + Intergenic
1084943269 11:72625613-72625635 GGATGGACCAGGAAGAAGAAAGG + Intronic
1085225874 11:74920842-74920864 GGAAGGACCAGCCAGAGGAATGG + Intronic
1085449313 11:76622567-76622589 GGGATGACTAGGACCAGGAATGG - Intergenic
1085551969 11:77382495-77382517 GGAATTAACAGGAAGAAGAAAGG - Intronic
1085776033 11:79367406-79367428 GAAAAGAAGAGGGAGAGGAAGGG - Intronic
1085818154 11:79763407-79763429 GGAATGGGGAGGATGAGGTATGG + Intergenic
1086109369 11:83182436-83182458 GGGATGAAGAAGAGGAGGAATGG + Exonic
1086304968 11:85470004-85470026 AGAATGAAGAGGAAGTAGAAAGG - Intronic
1086582068 11:88410855-88410877 GGAAAGAAAAGGAAAAGGAAGGG - Intergenic
1087474839 11:98622152-98622174 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1087501141 11:98955943-98955965 GGAATGAAGGGGGAAAGGAAGGG - Intergenic
1087915762 11:103808726-103808748 GGAAGGAAGAGAAGGAGGAAAGG - Intergenic
1088320384 11:108549444-108549466 GGAAAGACAAAGAAGAGGAGGGG - Intronic
1088367299 11:109053065-109053087 AGAATGAAAAGGCAGAGGAAAGG - Intergenic
1088676270 11:112196855-112196877 AGAAGGAGGAGGAGGAGGAAAGG - Intronic
1088706581 11:112469392-112469414 GGAATGAGAAGGAAAGGGAATGG + Intergenic
1088803256 11:113326540-113326562 GGGATGTTGAGGAAGAGGACTGG + Intronic
1089315588 11:117588851-117588873 GGGAAGAAGAGGAAGAGAAAAGG - Intronic
1089778842 11:120858910-120858932 GGAAGGACAAGGAAGGGGGAGGG - Intronic
1090018770 11:123108614-123108636 GGAAAGGAAAGGAAGAGGAAGGG + Intronic
1090075351 11:123577312-123577334 GGAAAGAGAAGGAGGAGGAAAGG - Intronic
1090169146 11:124582853-124582875 AGTATGATGTGGAAGAGGAAGGG - Intergenic
1090309716 11:125724446-125724468 AGAAAGAGGAGGGAGAGGAAAGG - Intergenic
1090336891 11:125974974-125974996 GGAATGGGGATGAAGAGGAAGGG - Intronic
1090986845 11:131774918-131774940 GGAACGGAGAGGAAGAGAAAGGG - Intronic
1091248252 11:134118623-134118645 GGAGAGAGGAGGAAGAGTAAAGG - Intronic
1091638363 12:2215266-2215288 GGAATGATGAGGAAGTGCAAAGG - Intronic
1091726456 12:2849584-2849606 GGAGAGACGGGGAAGGGGAAGGG + Intronic
1091809719 12:3386400-3386422 GGCATGAAAAGTAAGAGGAACGG - Intronic
1092430664 12:8405921-8405943 TGCATGTAGAGGAAGAGGAATGG - Intergenic
1092528864 12:9327749-9327771 GGGATGGCGATGAGGAGGAAAGG + Intergenic
1092588595 12:9926583-9926605 GGAATGAGGAAGGAAAGGAAAGG + Intronic
1092808437 12:12249490-12249512 TGAATGAGGGGGAAGAGGAAGGG - Intronic
1092985246 12:13838737-13838759 GGAAGGGCGAGGAAGGGGAGTGG + Intronic
1093133957 12:15427161-15427183 GGAATAAAGAGAAAAAGGAATGG - Intronic
1093859325 12:24143866-24143888 AGAAGGAGGAGGAGGAGGAAAGG + Intergenic
1094032080 12:26023920-26023942 GAAATGAAGAGAACGAGGAATGG + Intronic
1094825370 12:34265460-34265482 GAGAGGAAGAGGAAGAGGAAGGG - Intergenic
1095085187 12:38052643-38052665 GAGAGGAAGAGGAAGAGGAAGGG + Intergenic
1095290376 12:40472816-40472838 GGGAGGAGGAGGAAGAGGAGGGG - Intronic
1095530007 12:43175809-43175831 GGAATGACTAGACAAAGGAAGGG - Intergenic
1095974123 12:47927659-47927681 GGAATGATCTGAAAGAGGAAAGG + Intronic
1095981388 12:47976665-47976687 GGAGGGAGGAGGAAGTGGAAAGG - Intronic
1096172233 12:49481253-49481275 GGAATGCTGAGGCAGAAGAATGG + Intronic
1096217174 12:49804090-49804112 GGAATGAGGAGGAAGTGAGAAGG + Intronic
1096282197 12:50265906-50265928 GGAAGGAGGAGGATAAGGAAGGG - Intronic
1096502126 12:52070415-52070437 GGCGTGAGGAGGAGGAGGAAGGG + Exonic
1096749089 12:53747466-53747488 GAGAGGAAGAGGAAGAGGAAGGG + Intergenic
1096833234 12:54330850-54330872 GGAGTAATTAGGAAGAGGAAAGG + Intronic
1096882010 12:54680815-54680837 GGAATGAAGGGGAAGGGGCAGGG + Intergenic
1097406106 12:59192488-59192510 GAAAGGAGGAGGAAGTGGAAAGG + Intergenic
1097547080 12:61016960-61016982 TGAAAGACTAGGAAAAGGAAGGG - Intergenic
1099477861 12:83129732-83129754 GAAATGATAAGGAAAAGGAAAGG + Intronic
1100324731 12:93530247-93530269 GAAAGGAGGAGGAAGAGGAAAGG - Intergenic
1101004444 12:100388019-100388041 TGAATGAGGAGGAAGAGAATAGG - Intronic
1101009325 12:100432487-100432509 AGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1102238548 12:111309597-111309619 GGAAGGAGGAGGAGGAGGGAAGG - Intronic
1102430345 12:112878222-112878244 GGAAGGACCAGGATGAGGGAAGG - Intronic
1102737869 12:115179180-115179202 GGAAGGAGGAGGGGGAGGAAGGG + Intergenic
1102844012 12:116158254-116158276 GGAATGAAGGGGAAGGTGAAGGG + Intronic
1103013365 12:117475112-117475134 GGAATGAAGAAGGAGAGGATGGG - Intronic
1103373523 12:120437716-120437738 AGGATGGCGAGGAAGGGGAACGG + Intergenic
1103587998 12:121970492-121970514 TGGATGAGGAGGAGGAGGAATGG - Intronic
1103703245 12:122858731-122858753 AGGAGGAGGAGGAAGAGGAAAGG - Intronic
1103798978 12:123524785-123524807 GGAATGACTGGGAATAGGTACGG + Intronic
1104668767 12:130666689-130666711 GGAATGAGGAGGAAGGGAGAAGG + Intronic
1104958206 12:132476030-132476052 TGAAGGACAAGGAAGAGGTAAGG - Intergenic
1105828337 13:24142653-24142675 AGAAGGATGAGGAAGAGGAAAGG - Intronic
1106095814 13:26641985-26642007 GAAATGAGGAGAGAGAGGAAAGG - Intronic
1106653700 13:31719534-31719556 GGAATAAAAAGGTAGAGGAAGGG - Intergenic
1107007400 13:35629436-35629458 GCAAAGAAGAGGAAAAGGAAGGG + Intronic
1107283025 13:38757888-38757910 GAAATGTAGAGAAAGAGGAATGG - Intronic
1107618017 13:42192557-42192579 AGAAGGAGGAGGAGGAGGAAGGG - Intronic
1107829069 13:44358221-44358243 GGAAGGAAGGAGAAGAGGAAGGG + Intergenic
1107974207 13:45674057-45674079 GGGATGAAGGGGCAGAGGAAAGG + Intergenic
1108392067 13:49956287-49956309 GAAAGGAGGAGGAGGAGGAAGGG - Intergenic
1108437781 13:50417587-50417609 GGAATGAAGAGGGACAGGCAAGG - Intronic
1108470948 13:50766499-50766521 GGAAGGAGAAAGAAGAGGAAGGG - Intronic
1108492419 13:50994543-50994565 GGGATGATGAGGAAGAGACACGG + Intergenic
1108781138 13:53835571-53835593 AGAAAGAGGAGGAAGAGGAGGGG - Intergenic
1108850998 13:54728799-54728821 AGAATGTGGAGGAAGAGCAAGGG - Intergenic
1109140217 13:58705540-58705562 GGAAGGGATAGGAAGAGGAAGGG - Intergenic
1109466499 13:62740404-62740426 CTAATAATGAGGAAGAGGAACGG - Intergenic
1110171853 13:72510632-72510654 GGAATGACTGGGAACAGGAAAGG + Intergenic
1110268730 13:73569222-73569244 AGGAGGAAGAGGAAGAGGAAGGG + Intergenic
1110686687 13:78383787-78383809 AGAATGGGGAGGAAGAGAAAGGG - Intergenic
1110975480 13:81828565-81828587 GGAAGGAGGAGGAGGAGGAGGGG + Intergenic
1111145007 13:84167951-84167973 GGAAAGAGGAGAAAGAGGAAAGG + Intergenic
1111362788 13:87197082-87197104 AGAAGGAGGAGGAGGAGGAAGGG + Intergenic
1111510505 13:89255684-89255706 ATAATGAAGAGAAAGAGGAAAGG - Intergenic
1111675628 13:91384800-91384822 GGAAGGAAGAGAGAGAGGAAGGG + Intergenic
1112301844 13:98238267-98238289 GGGCTGAGGAGGAAGAGGAGGGG - Intronic
1112406966 13:99129819-99129841 GGGCTGAGGAGGAGGAGGAAGGG + Intergenic
1112634228 13:101197306-101197328 TGAAGGAGGAGGAAAAGGAAAGG - Intronic
1112903728 13:104391523-104391545 GCAATGATGAGGAAGTTGAAAGG + Intergenic
1112910486 13:104477072-104477094 TGAAAGATTAGGAAGAGGAATGG - Intergenic
1113421536 13:110174958-110174980 GGATGGAGGACGAAGAGGAATGG - Intronic
1113595300 13:111527518-111527540 GGAAGGAGGAGGAAGAGAAAGGG - Intergenic
1113608178 13:111625038-111625060 GAAATGACGAGGGACAGGGAAGG - Intronic
1113833193 13:113312980-113313002 GGCTTGAAGAGGAAAAGGAAGGG + Intronic
1113909866 13:113836683-113836705 GGAATGAGGAGGAAGAAGAGGGG + Intronic
1113909871 13:113836704-113836726 GGAATGAGGAGGAAGAAGAGGGG + Intronic
1114378709 14:22177426-22177448 GTAATAAGAAGGAAGAGGAAAGG + Intergenic
1114388516 14:22280894-22280916 GGAATAAACATGAAGAGGAAAGG - Intergenic
1114720606 14:24877393-24877415 GGAAGGCAGGGGAAGAGGAATGG - Intronic
1114875345 14:26710487-26710509 GAAATGAAGAGGAGGAGGAGAGG + Intergenic
1115027786 14:28764448-28764470 GGAATGGAGAGACAGAGGAATGG + Intergenic
1115107070 14:29774403-29774425 AGAAAGAAGAGGAAAAGGAAGGG + Intronic
1115150377 14:30277664-30277686 AGAATGAGGAGGAGGAGGAAAGG + Intergenic
1115491330 14:33960954-33960976 GGACAGAAGAGGAAGAGGAGAGG - Intronic
1115529445 14:34313854-34313876 GGTATGACGAGGAGCAAGAAGGG + Intronic
1115795456 14:36930495-36930517 GCAATGTGGATGAAGAGGAATGG - Intronic
1117718530 14:58605569-58605591 GGAAGGGAGAGGAATAGGAAAGG - Intergenic
1117912699 14:60649679-60649701 GGGAGGAGAAGGAAGAGGAAAGG + Intronic
1118091663 14:62487513-62487535 AAAATGGAGAGGAAGAGGAAAGG - Intergenic
1118583169 14:67325241-67325263 AGGGTGAAGAGGAAGAGGAAGGG - Intronic
1118808155 14:69255505-69255527 GGAAGGGAGAGGAAGAGGGAAGG - Intergenic
1118832257 14:69445293-69445315 AGGATGAGGAGGAAGAGGAGGGG - Intronic
1118860072 14:69656108-69656130 TGGAGGAAGAGGAAGAGGAAGGG - Intronic
1119679936 14:76584710-76584732 GGTATCACTGGGAAGAGGAAAGG + Intergenic
1119714263 14:76847547-76847569 GGAGGGAGGAGGGAGAGGAACGG + Intronic
1119886627 14:78149031-78149053 CCAATCACTAGGAAGAGGAATGG + Intergenic
1120051603 14:79873511-79873533 GGAAGAATGAGGAAGAGAAAGGG - Intergenic
1120279286 14:82419428-82419450 GGAATGGGGAGAAAGGGGAAGGG - Intergenic
1120420866 14:84284290-84284312 GGAAAGAAGAGGAGGAGGGAGGG + Intergenic
1120583852 14:86287158-86287180 GGAAGGAGGAAGAAAAGGAAAGG + Intergenic
1120690552 14:87588094-87588116 GGAATGATGAGGAGGAAGTAGGG + Intergenic
1121132346 14:91459941-91459963 GAAATGATGAGGAAGAGTCAGGG - Intronic
1121209765 14:92199492-92199514 GGTATGAGGAGGAAGAGAAGAGG + Intergenic
1121338404 14:93090950-93090972 GGGATGAGGAGGAAGAGCAGGGG - Intronic
1121783197 14:96635855-96635877 GGAAGGGCGAGGAAGAAGACTGG + Intergenic
1121813109 14:96908723-96908745 GGGAGGAAGAGGAAGAGCAAGGG + Intronic
1122007756 14:98719252-98719274 GGGAGGAGAAGGAAGAGGAAAGG + Intergenic
1122031233 14:98914167-98914189 GGAAAGAAGGGAAAGAGGAAGGG + Intergenic
1122043726 14:99008633-99008655 GGAATGAGACGGAAGAGCAAAGG - Intergenic
1122169553 14:99860814-99860836 GGGAAGAGGAGGAAGAGGAGAGG - Intronic
1122262891 14:100533218-100533240 GGAGAGACGAGGCAAAGGAAAGG + Intergenic
1122378479 14:101285320-101285342 GTGATGCCGAGGAAGAGGGAGGG - Intergenic
1122439280 14:101718958-101718980 GGAAGGAGAAGGAAGGGGAAGGG + Intergenic
1124122879 15:26906567-26906589 GGAAAGAAGAGGCTGAGGAAAGG - Intronic
1124416339 15:29475653-29475675 GAAATGAGGAGGAGGAGGAAGGG + Intronic
1124506425 15:30279771-30279793 GAGCTGAGGAGGAAGAGGAAGGG + Intergenic
1124737132 15:32258865-32258887 GAGCTGAGGAGGAAGAGGAAGGG - Intergenic
1125036764 15:35134316-35134338 GGAAGGAAGAGAAAGAGGAAGGG - Intergenic
1125143537 15:36439081-36439103 GGAGGGATGGGGAAGAGGAAGGG - Intergenic
1125200118 15:37095697-37095719 GCAATGGCGGAGAAGAGGAAAGG + Intronic
1125350145 15:38758147-38758169 AGAATGTGGAGGAGGAGGAAAGG + Intergenic
1126407433 15:48335569-48335591 GGAAGGGAAAGGAAGAGGAAGGG - Intronic
1126881503 15:53103630-53103652 TGAATGAGGAGGATGATGAAGGG + Intergenic
1127364172 15:58271901-58271923 GGAAAGACCAGCAGGAGGAAGGG + Intronic
1127446383 15:59067312-59067334 GGAATGAAGGGGAAGAGGAAAGG - Intronic
1127547429 15:60004199-60004221 GGGAGGAGGAGGAAGAGGAGGGG - Intergenic
1127589250 15:60407001-60407023 GGAAGGAGAAGGAGGAGGAAAGG + Intergenic
1127703417 15:61524419-61524441 GTAGAGAGGAGGAAGAGGAAGGG - Intergenic
1127749183 15:62016161-62016183 GGAAAGAAGAGGAAGAAGAATGG - Intronic
1128095717 15:64953418-64953440 GGAAGGAGGAGGAAGAAGAAGGG - Intronic
1128118871 15:65131403-65131425 GAAATAATGAGGAAGAGGAAAGG + Intronic
1128304172 15:66587075-66587097 GGGAGAAGGAGGAAGAGGAAGGG - Intronic
1128617497 15:69121619-69121641 GGGAAGAGGAGAAAGAGGAAAGG - Intergenic
1128756007 15:70184516-70184538 GGAACAAAGAGGTAGAGGAAAGG - Intergenic
1129666703 15:77583236-77583258 GGAAGGCCAAGGAAGAGGAGAGG - Intergenic
1130079405 15:80719185-80719207 GGAGTCAAGAGGAAGAGGGATGG - Intronic
1130213933 15:81951196-81951218 GCCAGGACCAGGAAGAGGAAAGG - Intergenic
1130285483 15:82550959-82550981 GCACTGAGGAGGAAGGGGAAGGG + Intronic
1130456012 15:84109046-84109068 GGAATGGGGAGGAAGTTGAATGG + Intergenic
1130703003 15:86204505-86204527 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1130744360 15:86635261-86635283 GGAAGGAGGAGGAGGAGGAGGGG - Intronic
1130812957 15:87401516-87401538 GGAAGGAAAAGGAAGGGGAAGGG + Intergenic
1131801474 15:96073958-96073980 CGAATGGCAAGGAAGTGGAAAGG + Intergenic
1131837161 15:96402304-96402326 GAAAGGAAGAGGAGGAGGAAGGG + Intergenic
1133312395 16:4858012-4858034 TCAATGACGAAGAAAAGGAAAGG + Exonic
1133333139 16:4988578-4988600 GGAAAGAGGAGGGAGAGGATAGG - Intronic
1133365916 16:5210084-5210106 GGAATGAAAATAAAGAGGAAAGG - Intergenic
1133520127 16:6549128-6549150 GGAAGGAGGAGGAGGAGGGAAGG + Intronic
1133898469 16:9951067-9951089 AGAATGACCAGGTAAAGGAAAGG - Intronic
1134040380 16:11063912-11063934 GGAAGGAAGAGAGAGAGGAAGGG + Intronic
1134748051 16:16602966-16602988 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1135292318 16:21250558-21250580 GGGATGACGATGAAGTGGAGTGG + Exonic
1135960927 16:26993948-26993970 GGAAGGAAAAGTAAGAGGAAGGG + Intergenic
1136456310 16:30381743-30381765 TGACTGGTGAGGAAGAGGAAAGG - Exonic
1137895871 16:52211608-52211630 GGAAGGAAGAGGACGAAGAAGGG + Intergenic
1138146759 16:54619527-54619549 GGAATGAATAGAAAGAGGAAAGG + Intergenic
1138217234 16:55214812-55214834 GGAAGGAAGAGGAAGAGGAGGGG + Intergenic
1138248951 16:55487861-55487883 AGAATGAAGAGGAGGAGGGAGGG - Intronic
1138293861 16:55870324-55870346 AGAAGAAAGAGGAAGAGGAAGGG + Intronic
1138293873 16:55870397-55870419 AGAAGGAAGAGAAAGAGGAAGGG + Intronic
1139195892 16:64918185-64918207 AGAATGAGGAGGTACAGGAAAGG - Intergenic
1140068442 16:71628558-71628580 AGACTGAGGAGGAAGAGGAAAGG + Intronic
1140338099 16:74130689-74130711 GGGAGGAAGGGGAAGAGGAAAGG + Intergenic
1141046942 16:80723861-80723883 AGAAAGAGGAGGAAGAGGAAGGG + Intronic
1141455017 16:84135635-84135657 TGAACTATGAGGAAGAGGAAAGG - Intronic
1141775559 16:86120869-86120891 GGGAGGAGGAGGAGGAGGAAAGG - Intergenic
1141945221 16:87305029-87305051 GCAATGAGGAGGAGGAGGAGAGG + Intronic
1142832166 17:2557387-2557409 AGAAGGAAGATGAAGAGGAAGGG + Intergenic
1142900724 17:3009807-3009829 GGGATGCAGAAGAAGAGGAACGG + Intronic
1142928341 17:3260405-3260427 GGAAGGAGGAGGAAGAGAGAAGG - Intergenic
1142972385 17:3621578-3621600 GGAATGGAGAGAAGGAGGAAAGG - Intronic
1143091259 17:4450239-4450261 GGAAGGAGGAGGAGGAGGGAAGG - Intronic
1143197303 17:5085848-5085870 GGCATGAGGATGAAAAGGAAAGG + Intronic
1143910034 17:10240556-10240578 GGAATGAGAAGGAATGGGAATGG - Intergenic
1144233620 17:13234573-13234595 GGAAAGAGGAGAAAGAGGAGAGG - Intergenic
1144279152 17:13707126-13707148 AGAAGGAGGAGGAAGAGGAGGGG + Intergenic
1144851229 17:18245095-18245117 GGCTTGGTGAGGAAGAGGAAGGG - Exonic
1144853443 17:18255525-18255547 GGAATTAAGAAGAAGAGAAATGG - Intronic
1144938210 17:18917221-18917243 AGACAGATGAGGAAGAGGAAAGG + Intronic
1145191308 17:20843427-20843449 GGGGTGACCAGGAGGAGGAAAGG + Intronic
1146952768 17:36918384-36918406 GGGAGGAGCAGGAAGAGGAAAGG - Intergenic
1147181796 17:38691180-38691202 GGCAGGACCTGGAAGAGGAAGGG + Intergenic
1147530165 17:41268904-41268926 AGAAGGAAGAGGAGGAGGAAAGG + Intergenic
1147970756 17:44218451-44218473 GGGGTCACGAGGAAGAGGAGGGG - Intronic
1148222113 17:45870273-45870295 GAAAAGAGGAGGAAGGGGAAAGG + Intergenic
1148381897 17:47205850-47205872 GGAATGAGGAAGAGGTGGAAAGG - Intronic
1148439643 17:47705126-47705148 GGAAAGACGAAGAGGAGGAGGGG - Intronic
1148482604 17:47970016-47970038 GATATGAGGAGGAAGGGGAAGGG - Intronic
1148848866 17:50544664-50544686 CGGCTGAGGAGGAAGAGGAAAGG - Intronic
1149447394 17:56724274-56724296 GGAAGGAGGAGGAGGTGGAAGGG - Intergenic
1149502572 17:57165365-57165387 TGAGTGAGGAGGAAGAAGAATGG + Intergenic
1150216323 17:63472506-63472528 GGAAGGCTGAGGCAGAGGAATGG + Intergenic
1150330925 17:64293680-64293702 AGAAGAACGAGGAGGAGGAAAGG + Intergenic
1150475835 17:65474000-65474022 AAAAAGAGGAGGAAGAGGAAGGG - Intergenic
1150890544 17:69144247-69144269 GGAAGGAGGAGGAGGAGGAGGGG - Intergenic
1150918470 17:69459829-69459851 GGAAGGAAGAAAAAGAGGAAGGG - Intronic
1151156689 17:72129099-72129121 GGAATGAGCAGGAAGAGGAAAGG - Intergenic
1151189409 17:72387194-72387216 GGAAAGAGGAGGCAGAGGGATGG + Intergenic
1151289712 17:73140952-73140974 GTAATGACTAGGGAGAGTAATGG - Intergenic
1151383921 17:73743776-73743798 AGAAGGAGGAGGAAGAGGAGCGG - Intergenic
1151479612 17:74362296-74362318 GGAAGGGCCTGGAAGAGGAAAGG + Intergenic
1151654047 17:75487278-75487300 AGAATGAGGAGGAAGAGAAGAGG - Intronic
1151815877 17:76471168-76471190 GGTAGGAGGAGAAAGAGGAAGGG + Exonic
1152345044 17:79746436-79746458 AGAATGAGGAGGAGGAGGAGAGG - Intergenic
1152400837 17:80065234-80065256 GGAATGAGGAGGAGGAGGGAAGG - Intronic
1152508981 17:80772456-80772478 GGCATGTGGAGGGAGAGGAAGGG - Intronic
1152508991 17:80772485-80772507 GGCATGTGGAGGGAGAGGAAGGG - Intronic
1152949656 17:83221545-83221567 GGAAAGAGGAGGAGGAGGACGGG + Intergenic
1152952038 17:83243206-83243228 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1153053112 18:919020-919042 GTAATGGGGAGGAAAAGGAAGGG - Intergenic
1153435744 18:5066372-5066394 GGAAAGTGGAGGAAGAGGAAAGG - Intergenic
1153572872 18:6491101-6491123 AGAAGGAGGAGGAACAGGAAGGG - Intergenic
1153708475 18:7772432-7772454 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1154031440 18:10757071-10757093 TGAAAGATGAGGAGGAGGAATGG + Intronic
1154050391 18:10950708-10950730 GGGAAGAGGAGGAAGGGGAAGGG - Intronic
1155238359 18:23843570-23843592 GGAAGGAGGTGGAACAGGAAGGG - Intronic
1155382649 18:25241087-25241109 GGTATGAAGGAGAAGAGGAATGG - Intronic
1155449292 18:25946735-25946757 GGAAAGGAAAGGAAGAGGAAGGG + Intergenic
1155935838 18:31752794-31752816 AGAAGGAGGAGGAAGAGGAGGGG + Intergenic
1155992455 18:32293024-32293046 GGAATGAAGAAGACCAGGAAAGG + Intronic
1156949570 18:42878448-42878470 AGAAGGAGGAGGAAGAGGAGAGG + Intronic
1157097819 18:44702238-44702260 AGGATGAGGAAGAAGAGGAAGGG + Intronic
1157398776 18:47368231-47368253 AGGAGGAAGAGGAAGAGGAAGGG + Intergenic
1157488676 18:48107412-48107434 GGGAAGAAGAGGAAGAGGAGAGG + Intronic
1157505773 18:48225360-48225382 GAAAGGGAGAGGAAGAGGAAAGG + Intronic
1157731767 18:50010298-50010320 GGAATAGCCAGCAAGAGGAAGGG - Intronic
1157775822 18:50395304-50395326 GGAAGAAGGAGGAAGAGGAGAGG - Intergenic
1158423137 18:57313546-57313568 AGAAGGAAGAGGAGGAGGAAGGG + Intergenic
1158944776 18:62438585-62438607 GGCGTGCCGAGGAAGAGGCAGGG + Intergenic
1159267915 18:66108377-66108399 GGAAAAGGGAGGAAGAGGAATGG - Intergenic
1159546999 18:69852083-69852105 GATATGAGGAGGGAGAGGAAGGG - Intronic
1159672216 18:71235756-71235778 AAAATGAAGAGGAAGAGGGAAGG + Intergenic
1160345964 18:78131923-78131945 TCAATTAAGAGGAAGAGGAAGGG - Intergenic
1160499083 18:79393764-79393786 GGAGGCAGGAGGAAGAGGAAAGG + Intergenic
1160529411 18:79554880-79554902 GGAGGGAGGAGGAAGAGGATGGG - Intergenic
1160618304 18:80150889-80150911 GGAAGGAAGAGGATGAGGAGAGG - Intronic
1160965744 19:1746222-1746244 GGAGTGGGGAGGAAGAGGGAGGG + Intergenic
1161415678 19:4145284-4145306 GAAAGGAGGAGGGAGAGGAATGG + Intergenic
1161737509 19:6000663-6000685 GGAAGGCCAAGGAAGAGCAAAGG - Intronic
1161788855 19:6346463-6346485 AGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1162067167 19:8132906-8132928 GGGACGGCGAGGAAGAGGAGAGG - Intronic
1162143277 19:8597194-8597216 GGTATGAAGGGGAAGGGGAAGGG + Intronic
1162428990 19:10615611-10615633 AGGAGGAAGAGGAAGAGGAAGGG + Intronic
1163206041 19:15803448-15803470 GGAAAGAGGAGGGAAAGGAAAGG + Intergenic
1163779575 19:19239451-19239473 GGAAGGAGGAGGGAGAGGAGGGG - Intronic
1163779715 19:19239934-19239956 GGAAGGAGGAGGCAGAGGAATGG - Intronic
1163792288 19:19314626-19314648 GGAGGGACCAGGAAGAGGTAGGG + Intronic
1164292489 19:23880566-23880588 GAAAGGAGGAGGAAGAGGAGTGG + Intergenic
1164591834 19:29511750-29511772 GGAATGAGGAGGAAGGAGAGTGG + Intergenic
1164591845 19:29511794-29511816 GGAATGAGGAGGAAGGAGAGTGG + Intergenic
1164591859 19:29511838-29511860 GGGATGAGGAGGAAGAAGAGGGG + Intergenic
1164592039 19:29512548-29512570 GGAATGAGGAGGAAGAAGAGGGG + Intergenic
1164592078 19:29512692-29512714 GGAATGAGGAGGAAGAAGAGGGG + Intergenic
1164592286 19:29513465-29513487 GGGATGAGGAGGAAGAAGAGGGG + Intergenic
1164878177 19:31707761-31707783 GCAATGTCAAGGGAGAGGAAGGG + Intergenic
1165157110 19:33795674-33795696 GGAAACAGGAGGAAGAGGAAGGG + Intergenic
1165762483 19:38329794-38329816 GGAATGAAGAGGGAGACGATGGG + Intergenic
1165811314 19:38613770-38613792 GAAAGGACGAGGCAGGGGAACGG + Intronic
1165832753 19:38737312-38737334 AGGATGACGAGGATGAGGAAGGG - Exonic
1165942626 19:39422835-39422857 AGGAGGAGGAGGAAGAGGAAGGG + Exonic
1165992835 19:39825999-39826021 GCAGTGACGAGGCAGAGGCAGGG + Exonic
1166085635 19:40472813-40472835 GGGATGAGGAGGAGGGGGAAGGG + Intronic
1166336946 19:42114066-42114088 GGAAGGAGGAGTGAGAGGAAAGG + Intronic
1166343086 19:42150343-42150365 TGGATGAGGAGGAAGAGGAGGGG + Intronic
1166746800 19:45145597-45145619 AGGAAGAGGAGGAAGAGGAAGGG + Exonic
1166837264 19:45675062-45675084 GAAATAATGAGGGAGAGGAACGG - Intronic
1166954539 19:46454595-46454617 GGAAAGAAGGGGAAGGGGAAGGG - Intergenic
1167130526 19:47582288-47582310 GGAAGGAAGAGGAGGAGGAGGGG - Intergenic
1167194116 19:48015241-48015263 AGGAGGAGGAGGAAGAGGAAGGG + Intronic
1167231945 19:48290538-48290560 GGAATGAAGAGGAGGAGGGGAGG + Intergenic
1167273855 19:48522930-48522952 GGAAGGAGAAGGAAGAGGAGAGG + Intergenic
1167608150 19:50492743-50492765 GGAAGGGGGAGGAGGAGGAAAGG + Intergenic
1168224312 19:54983251-54983273 AGAAGGAGGAGGAAGAGGATAGG + Exonic
1168433186 19:56297401-56297423 GGGAGGAAGAGGAAGAGGAAAGG - Intronic
1168510130 19:56967269-56967291 AGAAAGAGGAGGAAGAGGAGGGG - Intergenic
1168698842 19:58422972-58422994 GGAAGGCCGAGGCAGAAGAATGG - Intergenic
1168728025 19:58601424-58601446 AGAATAACAAGGAAGAGGAAAGG + Intergenic
925065265 2:924900-924922 GGAGCCACGAGGCAGAGGAAAGG + Intergenic
925077198 2:1026818-1026840 GCAAAGAGCAGGAAGAGGAAGGG - Intronic
925702125 2:6649223-6649245 AGAATGAGGAGGAAGAAGGAAGG - Intergenic
925840259 2:7985376-7985398 GGAATGAAGAGAAAGAGAAAGGG - Intergenic
926361077 2:12087978-12088000 AGAATGAAAAGGAGGAGGAAAGG - Intergenic
926378621 2:12261414-12261436 AGAAGGAGGAGAAAGAGGAACGG - Intergenic
926744821 2:16142600-16142622 GGAGTGACAAGAAAGGGGAATGG - Intergenic
927088068 2:19690213-19690235 GAGAGGAGGAGGAAGAGGAAAGG + Intergenic
927143479 2:20145352-20145374 GGAAAGAAAAGGAAAAGGAAGGG + Intergenic
927361750 2:22243423-22243445 GTAATCTCAAGGAAGAGGAATGG - Intergenic
927433033 2:23042933-23042955 GGAAGGAGGATGAAGAGGGAAGG - Intergenic
927935269 2:27072389-27072411 GGAATGGAGAAGAGGAGGAAGGG + Intergenic
928077477 2:28278363-28278385 GGAATAGGGAGGAAGAGGAAAGG + Intronic
928105815 2:28470026-28470048 GGGATGAAGAGGAGGGGGAAGGG + Intronic
929215651 2:39409081-39409103 AGGCTGAGGAGGAAGAGGAAGGG - Intronic
929788007 2:45005828-45005850 GGAAGGGAAAGGAAGAGGAAAGG + Exonic
929829833 2:45338150-45338172 GGGATGAGGAGGAAGAAGGAAGG - Intergenic
929832381 2:45357649-45357671 AGAATGAGGCGGAGGAGGAAAGG - Intergenic
930197941 2:48528268-48528290 GGAAGCAGGAGGAGGAGGAACGG - Intergenic
930517352 2:52424605-52424627 GAGATGAGGAGGAAGAGGAGGGG + Intergenic
930715278 2:54588189-54588211 AAAAGGAGGAGGAAGAGGAAGGG - Intronic
931586126 2:63831081-63831103 GGAATGAAAAGGAAGAGTCAAGG - Intergenic
932396490 2:71452506-71452528 GAGAGGAAGAGGAAGAGGAAGGG - Intergenic
932456987 2:71856231-71856253 TGACTGACTAGGAAGAGAAAGGG - Intergenic
932483064 2:72061207-72061229 GGAAGGGGGAGGAGGAGGAATGG - Intergenic
933117737 2:78496073-78496095 GGAATGAGGAGTAACAGCAATGG + Intergenic
933154082 2:78951802-78951824 GGTATGAGGAGTAAGAGAAAGGG + Intergenic
933245477 2:79970216-79970238 GTAATGGAGAGCAAGAGGAAAGG + Intronic
933978601 2:87531849-87531871 GAAAGGAAGAGGAGGAGGAAAGG - Intergenic
935063280 2:99626506-99626528 GGAAGGAAGAGGAAGGGGAAAGG - Intronic
935206001 2:100896836-100896858 GGAATGAAGAAGAAAAGGAAGGG - Intronic
935438835 2:103067886-103067908 GGATTGATGATGAAGAGGAGGGG + Intergenic
935803467 2:106723347-106723369 GGACTCAGGAGGAGGAGGAAAGG + Intergenic
935889197 2:107657585-107657607 GGAAGGAAGGGAAAGAGGAAAGG + Intergenic
936095798 2:109529314-109529336 GGAGTGCAGAGGAGGAGGAAGGG + Intergenic
936315230 2:111418953-111418975 GAAAGGAAGAGGAGGAGGAAAGG + Intergenic
936506599 2:113112640-113112662 GGAAGATGGAGGAAGAGGAACGG - Intronic
936542987 2:113367115-113367137 GGAATGAGGAGGAGAAGGAGAGG - Intergenic
936570526 2:113609581-113609603 AGAATAACAAGGAAGAGGAAAGG - Intergenic
937110332 2:119362067-119362089 AGGCTGAGGAGGAAGAGGAAGGG - Intronic
937117631 2:119419962-119419984 GGAAGGAAGAGTAAGAGGAGAGG + Intergenic
937814063 2:126231669-126231691 GGAAAGAGAAGGAAGAGGGAGGG - Intergenic
937818148 2:126276243-126276265 GGAATAAAAAGGAAGAGGAGAGG + Intergenic
938957675 2:136314504-136314526 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
939075411 2:137596717-137596739 AGAAAGAAGAGGAAGAGGAGGGG - Intronic
939076340 2:137606797-137606819 GGAAGGAGGAGGAGAAGGAAAGG + Intronic
939153327 2:138497437-138497459 GGAAGGAAAAGGAAAAGGAAAGG + Intergenic
939329193 2:140736129-140736151 GGAATAAAGAGGATGAGGGAAGG + Intronic
939468417 2:142587844-142587866 GCAATGATGAGGAAAAGGACTGG - Intergenic
939766126 2:146252154-146252176 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
940032095 2:149274390-149274412 GGGATGAGGAGGAGAAGGAAGGG - Intergenic
940194776 2:151081498-151081520 GGAATGAAGAGCACGAGAAAAGG + Intergenic
940775028 2:157876123-157876145 GGGGTGAAGAGGAGGAGGAAGGG + Intergenic
941026385 2:160460770-160460792 TGAATGGCGAGGTAGAAGAAAGG + Intronic
941191907 2:162394921-162394943 TGGAGGAGGAGGAAGAGGAATGG - Intronic
941301092 2:163802235-163802257 AGCAAGAGGAGGAAGAGGAAAGG + Intergenic
941414839 2:165206915-165206937 GGAATGTGAAGGAAGAGCAAAGG - Intergenic
941893454 2:170606005-170606027 GCAGTGAAGAGGAAGAGAAATGG - Intronic
942516329 2:176757383-176757405 AGGAAGAGGAGGAAGAGGAATGG + Intergenic
942535023 2:176954299-176954321 GAAATGAAGAGAAGGAGGAAGGG + Intergenic
942611609 2:177747626-177747648 GGATGGAAGTGGAAGAGGAAAGG - Intronic
942632944 2:177971653-177971675 GGAAGGAAGAGGAAGAGAGAGGG + Intronic
943188152 2:184640263-184640285 GAAAGGAGGAGGAGGAGGAATGG + Intronic
943296018 2:186140301-186140323 AGAAGGAGGAAGAAGAGGAACGG + Intergenic
943486520 2:188491447-188491469 GAAATGAGAATGAAGAGGAAAGG + Intronic
944200475 2:197101971-197101993 TGTATGAGGATGAAGAGGAAGGG - Intronic
944658885 2:201903760-201903782 GGGCTGAGAAGGAAGAGGAAGGG + Intergenic
945691650 2:213044185-213044207 GGAATTAAGAGAAATAGGAAAGG - Intronic
946371214 2:219282605-219282627 GGAAGGAGGGGGAAGAGGGATGG - Intronic
946553090 2:220823854-220823876 GGAGGGAGGAAGAAGAGGAAGGG - Intergenic
946563419 2:220938341-220938363 GGAGTGAGGAGGAAGAGAATGGG - Intergenic
946770888 2:223087119-223087141 GGAAGGAAGAGCAGGAGGAATGG - Intronic
946821770 2:223637010-223637032 GAAAGAAAGAGGAAGAGGAAGGG + Intergenic
946833334 2:223747023-223747045 GGAAGGAAAAGGAAAAGGAAGGG + Intergenic
947807062 2:232976355-232976377 GGACTGTGGAGGAAGAGGAGTGG - Intronic
947901096 2:233722942-233722964 GGGCTGAGGAGGAGGAGGAAGGG + Intronic
948190074 2:236051611-236051633 TGAATGAGGAGGAGCAGGAATGG + Intronic
948361863 2:237427490-237427512 GGAAGGAAGAGAAAGAGGGAGGG + Intergenic
948428346 2:237902381-237902403 GGGATCAGGAGGAAGAGGAGGGG + Intronic
948458014 2:238116270-238116292 GGAATGGGGAGGAAGAGGGGAGG - Intronic
948518639 2:238522095-238522117 GGAATGACCAGGCAGAGGGCAGG - Intergenic
948579498 2:238974752-238974774 GGAATGAATAGGATGAGTAATGG - Intergenic
948852941 2:240717301-240717323 GGACAGACGAGGATGAGGGAGGG + Exonic
949088289 2:242177069-242177091 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1169214412 20:3785176-3785198 GGGAGGAGGAGGAGGAGGAAGGG - Exonic
1169855889 20:10102311-10102333 AGGATGAGGAGGAAGAGGAGGGG - Intergenic
1170103428 20:12727253-12727275 GTAAGGAGGAGGAGGAGGAAAGG + Intergenic
1170121395 20:12916516-12916538 GGAAACACCAGGAAGAGGAGTGG + Intergenic
1170389741 20:15859207-15859229 GGGCTGAGGAGGAAGAGGAAGGG + Intronic
1170602437 20:17851131-17851153 GGGCTGAGGAGGAGGAGGAAGGG + Intergenic
1171044210 20:21795457-21795479 GGAATGAGGAGGAAATGGAAAGG - Intergenic
1171177540 20:23064116-23064138 GAAATGACCTGGAAGATGAAAGG - Intergenic
1171896141 20:30812352-30812374 GGAAGGGAGAGAAAGAGGAAGGG + Intergenic
1172043034 20:32059459-32059481 AGAAGGAGGAGGAGGAGGAAGGG - Intronic
1172224410 20:33295824-33295846 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1172784794 20:37460695-37460717 GTAAGAAGGAGGAAGAGGAAGGG + Intergenic
1172878821 20:38183957-38183979 GGAAGGAGAAGGAAGGGGAATGG + Intergenic
1173063254 20:39682031-39682053 GGAATAAAGAGGAAGGGAAATGG - Intergenic
1173144218 20:40510871-40510893 GGAAGGAAGGGAAAGAGGAAGGG + Intergenic
1173509250 20:43613300-43613322 GGAGGGAGGAGGAAGAGGATGGG - Intronic
1173701820 20:45078627-45078649 TGTTTGACGGGGAAGAGGAAGGG + Exonic
1173815588 20:45985718-45985740 GGAAGGAGGAGGTAGGGGAATGG + Intergenic
1174048121 20:47748189-47748211 GGAATGAAGGGGAGGAGGATGGG - Intronic
1174397740 20:50258429-50258451 AGAATGATGGGGCAGAGGAAAGG - Intergenic
1175100801 20:56577420-56577442 GGAAGAACGTGGAGGAGGAAGGG + Intergenic
1175732282 20:61362154-61362176 GCAATGATGAGGAAGAAGAAAGG + Intronic
1175964232 20:62652433-62652455 GGACTGACGAGGAGGCGCAAGGG - Intronic
1176244178 20:64089571-64089593 GGGATGGGGAGGAGGAGGAAAGG - Intronic
1176415341 21:6471481-6471503 AGGAGGAGGAGGAAGAGGAAGGG + Intergenic
1176415347 21:6471502-6471524 GGAAGGAGGAGGAAGAGGAAGGG + Intergenic
1176415353 21:6471523-6471545 GGAAGGAGGAGGAAGAGGAAGGG + Intergenic
1176905302 21:14493214-14493236 CAAATGAGGAGGAAGGGGAAAGG - Intronic
1178255549 21:31049027-31049049 AGAATGAAGAGGCAGAGGAAGGG - Intergenic
1178261341 21:31102604-31102626 AGAAGGAGGAGGAAGAGGAGGGG + Intergenic
1178936060 21:36862790-36862812 GGAAGGGGAAGGAAGAGGAAAGG + Intronic
1179628868 21:42664649-42664671 GGAAAGAGGAGGGAAAGGAAGGG + Intronic
1179652115 21:42818329-42818351 GGAAGGAGAAGGAAGAGGAATGG - Intergenic
1179690841 21:43079814-43079836 AGGAGGAGGAGGAAGAGGAAGGG + Intergenic
1179690847 21:43079835-43079857 GGAAGGAGGAGGAAGAGGAAGGG + Intergenic
1179690853 21:43079856-43079878 GGAAGGAGGAGGAAGAGGAAGGG + Intergenic
1180263451 21:46693030-46693052 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1180571916 22:16732037-16732059 GGAATGAGGAGAAAGAGCACTGG + Intergenic
1181491402 22:23262778-23262800 CGAAGGAAGGGGAAGAGGAAGGG + Intronic
1182031339 22:27161647-27161669 AGAAAGAAGAGGAAGAGGAGAGG + Intergenic
1182395883 22:30035684-30035706 AGAAGCAGGAGGAAGAGGAAGGG - Intergenic
1182660013 22:31918542-31918564 GGAAGGCCAAGGGAGAGGAAGGG + Intergenic
1182666466 22:31963960-31963982 GAAAAAACCAGGAAGAGGAAGGG - Intergenic
1182799894 22:33023400-33023422 GGAAGGTCAAGGAAGAGCAAAGG - Intronic
1182912311 22:33995122-33995144 GGAAGGTGGAGGAGGAGGAAAGG - Intergenic
1183949005 22:41342373-41342395 GGAGGGTGGAGGAAGAGGAAGGG + Intronic
1184794528 22:46724107-46724129 GGGCTGAGGAGGAAGAGGAGAGG - Intronic
1185089437 22:48757434-48757456 GGAAGGAGGAGGAGGAGGAGGGG + Intronic
1185396516 22:50593843-50593865 GGAAGGACGAGGCAGGAGAATGG + Intronic
1185429681 22:50801391-50801413 AGAATAACAAGGAAGAGGAAAGG + Intergenic
949863133 3:8524409-8524431 GAAATTTAGAGGAAGAGGAAGGG + Intronic
949879177 3:8648494-8648516 GGATTGGCTAGGAAAAGGAAAGG - Intronic
949889990 3:8726524-8726546 GGATTGACGGGGAACAGAAAAGG + Intronic
950128006 3:10522457-10522479 GGAATGACCAGGAGGTAGAAGGG - Intronic
950747591 3:15102658-15102680 GAAAGGAAGAGGAAGAGGGAGGG + Intergenic
951072909 3:18353045-18353067 GGAGTGAAGGGGAAGAGTAAGGG + Intronic
951114613 3:18845456-18845478 GGAAGGAAGGGGAAGAAGAAAGG - Intergenic
951664150 3:25103374-25103396 TGAAAGAGGAGGAAGGGGAATGG - Intergenic
951702423 3:25509819-25509841 GGGAGGACGGGGAAGGGGAAGGG - Intronic
951795915 3:26538204-26538226 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
951930116 3:27955879-27955901 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
952069641 3:29618545-29618567 GAAATGACAAGGAGGAGAAATGG - Intronic
953285438 3:41602239-41602261 GGAAGGAAGAGAAAAAGGAAAGG + Intronic
953411856 3:42695087-42695109 GAAATGAGGAGGTCGAGGAATGG - Intronic
953419161 3:42741356-42741378 GGAATGGGTTGGAAGAGGAATGG - Intronic
953509755 3:43524110-43524132 TGAATGAAGAAGAAGAGGATTGG + Intronic
953517253 3:43606572-43606594 ACAATGACAATGAAGAGGAAAGG + Intronic
954000102 3:47549891-47549913 GGGAGGAGGAGGAAGGGGAAGGG - Intergenic
954094096 3:48309422-48309444 GAAATGACAGGGAAGAGCAAGGG + Intronic
954135361 3:48579823-48579845 GGAATGACCAGTGAGAAGAATGG + Intronic
954239843 3:49284949-49284971 GGAATGGCAAGCAACAGGAAAGG + Intronic
954468084 3:50668947-50668969 GGAAAGAAGAGAAAGAGAAAGGG - Intergenic
955381490 3:58441962-58441984 GGAAAGACCTGGAAAAGGAAGGG + Intergenic
955675984 3:61449452-61449474 GCAATGTGGAGGAAGAGGAAAGG + Intergenic
955844394 3:63146438-63146460 CGAATGAAAAGGCAGAGGAAAGG + Intergenic
955846183 3:63165177-63165199 AGGAGGAGGAGGAAGAGGAAGGG - Intergenic
955850997 3:63219786-63219808 AGACTGAGGAGGAGGAGGAAGGG + Intergenic
955940986 3:64146957-64146979 AGGAGGAAGAGGAAGAGGAAGGG - Exonic
956212624 3:66817302-66817324 AGAAGGAGGAGGAGGAGGAAGGG + Intergenic
956606738 3:71080728-71080750 CAAATGAAGAGAAAGAGGAAGGG - Intronic
957074301 3:75589451-75589473 TGCATGTCCAGGAAGAGGAATGG - Intergenic
957106274 3:75892368-75892390 GGAATGAGGAGAAAGAGCACTGG - Intergenic
957158440 3:76576973-76576995 GGAATAGGGAAGAAGAGGAAAGG + Intronic
957540123 3:81557461-81557483 AGAAGGAAGAGGAAGAGGGAAGG + Intronic
957803092 3:85110805-85110827 GGAAGGCCGAGGAAGAAGGAAGG + Intronic
958584086 3:96062808-96062830 GGAAGTAGGAGGAGGAGGAAGGG - Intergenic
958661175 3:97069347-97069369 AGAAGGAAGAAGAAGAGGAAGGG + Intronic
959267022 3:104155403-104155425 AGGATGAGGAGGAAGAGGAGAGG + Intergenic
959474303 3:106790592-106790614 GGAGAGAAGAGGAAGAGTAAAGG + Intergenic
959569462 3:107867580-107867602 GGATTCATGTGGAAGAGGAATGG + Intergenic
960865458 3:122194947-122194969 GAAAGGAGGAGGAAGAGGAAGGG - Intronic
961279798 3:125757291-125757313 TGCATGCCCAGGAAGAGGAATGG + Intergenic
961348390 3:126279939-126279961 AGGAGGAGGAGGAAGAGGAAGGG - Intergenic
961874600 3:130012293-130012315 TGCATGTCCAGGAAGAGGAATGG - Intergenic
962018807 3:131474407-131474429 GGAATGAGGAGGATGGGGAGAGG + Intronic
962156343 3:132952600-132952622 TGAGAGATGAGGAAGAGGAAGGG - Intergenic
963496397 3:146068088-146068110 AGAAGGAAGGGGAAGAGGAAGGG - Intergenic
963623599 3:147643153-147643175 GCAATGATGAGTTAGAGGAAAGG - Intergenic
963652942 3:148006988-148007010 GAAAGAAGGAGGAAGAGGAAGGG - Intergenic
964271363 3:154959738-154959760 GGAAAGAGAAGAAAGAGGAAAGG + Intergenic
964406407 3:156353277-156353299 GGAAGGACGAGGAGGAGAAAAGG - Intronic
964625288 3:158752927-158752949 GGAAAGAGGAGGAGGAGGAGCGG - Intronic
965924057 3:173956389-173956411 GGAAGAAGGAGGAAGAGGAAGGG - Intronic
965977669 3:174644444-174644466 AGGAGGAAGAGGAAGAGGAATGG + Intronic
966443665 3:179976152-179976174 TAAATGATGAGGAAGAGGAGTGG + Intronic
966559212 3:181300142-181300164 GGAAGGAGGAGGAGGAGGAGGGG + Intergenic
966699756 3:182835079-182835101 AGACTGAGGAGGAAGAGGAGAGG + Intronic
967188543 3:186965772-186965794 GGAAGGACGAGGAAGAGAAGAGG - Intronic
967336471 3:188349926-188349948 GGAAAGGAGAGGAAGAGCAAAGG - Intronic
967521201 3:190435083-190435105 GGAGTGAGGAGGAAGAAGAGGGG - Intronic
968074988 3:195811493-195811515 GGAAAGAAGAGGAAGAGAAGAGG - Intronic
968527372 4:1068648-1068670 GGAATGAAGAGCATGGGGAATGG - Intronic
968692856 4:2004312-2004334 GGAGTGGGGAGGAAGAGGACTGG + Intronic
969332090 4:6480074-6480096 GGAAAGATGAGGACTAGGAAGGG - Intronic
969946368 4:10787611-10787633 GGAAAGAAGAGAAAAAGGAAAGG - Intergenic
970011599 4:11465336-11465358 GGAGTGAAGAGGAAAAGAAAGGG - Intergenic
970268951 4:14322077-14322099 TGCATGAAGAGGAAGAGCAAAGG - Intergenic
970818751 4:20188853-20188875 GGATGGAAGAGGAAGAGGAGGGG + Intergenic
970818819 4:20189746-20189768 GGAAGGTGGAGGAAGAGCAAAGG - Intergenic
970919791 4:21380423-21380445 GGGATGATGAGGGAGAGGGAGGG + Intronic
970926581 4:21459392-21459414 GGGTTGAGGAGGAAGAGCAAGGG - Intronic
970990251 4:22204742-22204764 GGATTGAGGAAGAGGAGGAAAGG + Intergenic
971048318 4:22831153-22831175 GGAATGAAGTGGGAGAGGCATGG - Intergenic
971099679 4:23451007-23451029 GGAATGAAGAGGATCAGAAATGG - Intergenic
971163829 4:24161575-24161597 GGAATTACTAGAAAGGGGAATGG + Intergenic
971436593 4:26632531-26632553 AGGAGGAGGAGGAAGAGGAAGGG + Intronic
971479096 4:27098687-27098709 AGAATGACAAGGATGAGGATGGG - Intergenic
972267133 4:37472233-37472255 AGAATGAAGAGAATGAGGAAAGG - Intronic
973616724 4:52686216-52686238 AGAAAGAGGAGGAAGAGGAAGGG - Intergenic
973973813 4:56242538-56242560 GGAATGGCGAGAAAGTGGTAAGG + Intronic
974161361 4:58144967-58144989 AGAAGGATGAGGATGAGGAATGG + Intergenic
974169160 4:58244086-58244108 GGAATAAAGATGAAGAGGGAAGG + Intergenic
974229272 4:59088938-59088960 GGGAGGAGGAGGAAGAGGAGGGG - Intergenic
974279590 4:59775242-59775264 GAAAAGAAGAGGAAGATGAAAGG - Intergenic
974283125 4:59825206-59825228 TAAACGACGAGAAAGAGGAAGGG + Intergenic
974450975 4:62058800-62058822 GGAAGGAAGAGGAAGAGACAGGG + Intronic
974831475 4:67194719-67194741 GGAAGGAAGAGAAGGAGGAAGGG + Intergenic
975388525 4:73788135-73788157 AGAAGGAGGAGGAGGAGGAAGGG + Intergenic
975997116 4:80328536-80328558 GGAATGAGGAGTAAGAGAGAAGG + Intronic
976819217 4:89186093-89186115 GGAAGGTGGAGGAAGAGGAAGGG - Intergenic
976909262 4:90280342-90280364 TGAATGAAGAGAGAGAGGAAGGG - Intronic
976921287 4:90446815-90446837 AGAAGGAAGAGGAAGAGGAGAGG - Intronic
977232068 4:94463547-94463569 AGAAAGAGGAGGAAGAGGAAGGG + Intronic
977439282 4:97041897-97041919 GAAATGACCAGGCAGAGCAAAGG + Intergenic
977517971 4:98045945-98045967 GGAGAGAAGAGAAAGAGGAAGGG - Intronic
977665416 4:99642136-99642158 GGAATGACCTGCAAGATGAAAGG + Intronic
978070338 4:104459756-104459778 GGAAAGAGAAGGAAGAGGGAAGG - Intergenic
978264741 4:106810283-106810305 GGAAGGAAGAGGAGGAAGAAGGG - Intergenic
978830707 4:113080871-113080893 AGAATGGAGAGGAAGAGGATGGG + Intronic
979318509 4:119296660-119296682 GGAATAAAAAGGCAGAGGAAGGG - Intergenic
979548977 4:121969122-121969144 GGAAGGAAGAGAGAGAGGAAAGG - Intergenic
979574728 4:122275793-122275815 GCAATGAAGAGGAAATGGAATGG + Intronic
980211496 4:129794184-129794206 AGAAGGACGAGAAAGAGGAGGGG - Intergenic
980233875 4:130078638-130078660 GGAAAGAAGAGGCAGAGGAGAGG - Intergenic
980844914 4:138312816-138312838 GGAAGGAGGAGGAGGAGAAAGGG - Intergenic
981092121 4:140742769-140742791 GGAATCACCAGGGAGAGGACTGG - Intronic
981111477 4:140939440-140939462 GGAAAGAAGAGAAAGAGGAAGGG + Intronic
981295601 4:143127380-143127402 AGAAGGAAGAGGAGGAGGAAGGG + Intergenic
981392152 4:144203627-144203649 GGAATGGCAAGGATGAGGCAAGG + Intergenic
981615129 4:146637946-146637968 GGGAGGAGGAGGAAGAGAAAAGG + Intergenic
981843849 4:149144183-149144205 AGGAGGAGGAGGAAGAGGAAAGG - Intergenic
981843864 4:149144286-149144308 AGGAGGAGGAGGAAGAGGAAAGG - Intergenic
982125179 4:152178044-152178066 GTAATAAGGAGGAGGAGGAAGGG + Intergenic
982223216 4:153142181-153142203 GAAATGAAGAGGAGGTGGAAGGG + Intergenic
982493960 4:156066540-156066562 TGATTGACCAGGAAGAGAAAAGG + Intergenic
982582794 4:157200670-157200692 AAAATGAGGAGGAAGAAGAAAGG - Intergenic
982981767 4:162146709-162146731 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
983027815 4:162758887-162758909 GAAAAGAGGAGGAAAAGGAAGGG + Intergenic
983048011 4:163010375-163010397 GGAAGGCAGAGGAAGAAGAAAGG + Intergenic
983364997 4:166775131-166775153 AGAAGGAAGAGGAAGAGTAACGG + Intronic
983455792 4:167962828-167962850 GGAAAAAGGTGGAAGAGGAAAGG - Intergenic
983700865 4:170591880-170591902 GGCATGTCTGGGAAGAGGAAAGG + Intergenic
983750720 4:171266071-171266093 GAAAAGAAGAGGAGGAGGAAGGG - Intergenic
984154070 4:176172803-176172825 GGGATGAAGAGAGAGAGGAAGGG + Intronic
984251376 4:177339556-177339578 AGATTGAGGAGGAAGAGGAGGGG + Intronic
984616634 4:181905874-181905896 GTAATTATGAAGAAGAGGAAAGG - Intergenic
985193211 4:187400250-187400272 GGAATGAGGAGGAAGGGGAGGGG - Intergenic
985305400 4:188533847-188533869 AGAATTAGGAGGAATAGGAACGG + Intergenic
985318939 4:188687576-188687598 GGAGGGTAGAGGAAGAGGAAAGG - Intergenic
985466115 4:190198272-190198294 AGAATAACAAGGAAGAGGAAAGG + Intergenic
985519900 5:369279-369301 AGAATGCCCAGGAAGAGGGAGGG - Intronic
985620839 5:954300-954322 GGAGTGACGTGGTAGAGGGAGGG + Intergenic
986067066 5:4245153-4245175 AGAATGAGGAGGAAGAGAAAGGG - Intergenic
986221755 5:5774840-5774862 AGAAGGAAGAGGAGGAGGAAAGG - Intergenic
986447268 5:7832295-7832317 GAAATGACCAGGAAGAGCACAGG - Intronic
986976087 5:13395974-13395996 GGGATGAGAAGAAAGAGGAAAGG + Intergenic
987095453 5:14545613-14545635 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
987162730 5:15160944-15160966 GGAAAGACGTGGATCAGGAAGGG + Intergenic
987255763 5:16149282-16149304 TAAATGAAGAGGAAGGGGAATGG + Intronic
987366682 5:17154830-17154852 GGATTGACGTGGAAGAGTAATGG - Intronic
987428618 5:17803547-17803569 AGAAGGAGGAGGAAGAGGAGGGG + Intergenic
987595651 5:19995065-19995087 AGAATAAAAAGGAAGAGGAAAGG - Intronic
987683693 5:21169255-21169277 GGGAAGACCAAGAAGAGGAATGG + Intergenic
987839463 5:23204339-23204361 AGGAAGAGGAGGAAGAGGAAGGG - Intergenic
987924674 5:24325171-24325193 GGAATGAAGAGGAACAGGAAAGG + Intergenic
988246448 5:28688740-28688762 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
988828053 5:34960104-34960126 TGAATGAAGGGGAAGATGAAGGG + Intergenic
988908137 5:35810905-35810927 GGAGTGACCAGGAAGAGGTGTGG - Intronic
988914645 5:35880367-35880389 GGAAAGAGGAGGAAGAAGAGAGG - Intergenic
989405506 5:41056711-41056733 GAGATGACCAGGAAGAGAAAAGG + Intronic
990327612 5:54693968-54693990 GGAAAGAAGAGCAAGGGGAAGGG - Intergenic
990616161 5:57510714-57510736 GGGAGGAAGAGGAGGAGGAAAGG - Intergenic
990737212 5:58877383-58877405 GGAGGGAGGAAGAAGAGGAAAGG - Intergenic
991297872 5:65100981-65101003 GGAGTGATGAGGATGGGGAAGGG - Intergenic
991457411 5:66819206-66819228 GGAATGACGAGCAAGATTCATGG + Intronic
991625553 5:68597077-68597099 GGAATGAAGAGGAATGGGTAAGG - Intergenic
993482512 5:88441490-88441512 GGAATTACTAAGATGAGGAAGGG - Intergenic
993788929 5:92182427-92182449 GGAATGAACAGGAAGAGTTAGGG - Intergenic
993831911 5:92770729-92770751 GGAAGGAAGGGGAAGAGAAAGGG + Intergenic
994129954 5:96215688-96215710 AGAAGAAGGAGGAAGAGGAACGG - Intergenic
994168300 5:96630862-96630884 GGAAGGAAGAAGAAAAGGAAAGG + Intronic
994442512 5:99827976-99827998 AGAAGGAGGAGGAAGAGGAGAGG - Intergenic
995001819 5:107141403-107141425 AGAATGACAAGAAAGATGAAAGG - Intergenic
995264767 5:110145804-110145826 AGAAGGAGGAGGAGGAGGAAAGG - Intergenic
995611771 5:113918050-113918072 AGAATGGCGAGGAAGGGCAATGG + Intergenic
995940808 5:117581533-117581555 GAAAAGAAGAGGAGGAGGAAAGG + Intergenic
996037191 5:118771554-118771576 CAAGTGAAGAGGAAGAGGAAGGG + Intergenic
996555628 5:124776347-124776369 GCAGTGAAGAGGGAGAGGAATGG + Intergenic
996770540 5:127081029-127081051 GGAGTAACCAGGAAGAGGCAAGG - Intergenic
996844721 5:127886482-127886504 AGGAGGACGAGGAAGAGGAGGGG - Intergenic
997273462 5:132562119-132562141 GGAATGACAAGGAAGAACAAGGG + Intronic
997665623 5:135627626-135627648 GGAGAGATGAGGAAGAGGGAAGG - Intergenic
997853378 5:137352627-137352649 GAAAAGACGAGGAAGAAGGAGGG + Intronic
997889021 5:137658698-137658720 GGAGTGAGGGGAAAGAGGAAAGG + Intronic
998158912 5:139802109-139802131 GGGAAGAGGAGGGAGAGGAAGGG + Intronic
998219637 5:140266128-140266150 GGAAGGAAGAGGAAGAAGACAGG + Intronic
998375420 5:141687321-141687343 GGAATGAGGATGCAGGGGAAGGG - Intergenic
998813675 5:145991415-145991437 TGAATGACTCTGAAGAGGAAAGG - Intronic
999069158 5:148725354-148725376 GGAATGAAGAGAGAGAAGAAAGG - Intergenic
999132551 5:149295601-149295623 AGAATGGAGAGAAAGAGGAAGGG + Intronic
999244295 5:150145107-150145129 GGAAGGAGGAGGAAGAGGAAGGG - Intronic
999271192 5:150297322-150297344 AGGAAGAGGAGGAAGAGGAAGGG - Exonic
999501295 5:152149110-152149132 GGGAAGAAGGGGAAGAGGAATGG - Intergenic
999848543 5:155512399-155512421 GCAAGGAGGAGGAAGAGGATAGG - Intergenic
1000321677 5:160139332-160139354 GGAAAGAGGAGGAAGTGGAGTGG - Intergenic
1000628725 5:163567773-163567795 GGAAGGAAGAGAATGAGGAAGGG - Intergenic
1002102390 5:176863863-176863885 TGAGTGAGGAGGAGGAGGAAAGG - Intronic
1002315976 5:178343532-178343554 GGAATGAAGAGGAAGGGGTGTGG + Intronic
1002352582 5:178593266-178593288 CTAATGAGGAGGAAGAGGTAGGG + Intergenic
1002720813 5:181260625-181260647 AGAACGAGGAGGAAGATGAATGG - Exonic
1002743888 5:181455357-181455379 GGAAAGAGGAGGAGGAGGACGGG + Intergenic
1002746068 5:181474607-181474629 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1002913760 6:1511555-1511577 AGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1003010990 6:2427445-2427467 GGGAAATCGAGGAAGAGGAATGG + Intergenic
1003545233 6:7052591-7052613 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1004359428 6:14957874-14957896 GGCATACCGAGGAGGAGGAAAGG + Intergenic
1004566717 6:16804800-16804822 GAAATGAAGGGGAGGAGGAAGGG + Intergenic
1004670778 6:17794427-17794449 GGAATGATAATGAAAAGGAACGG + Intronic
1004746076 6:18510446-18510468 GGACTGAAGAAGAAGAGCAAAGG + Intergenic
1005108363 6:22250524-22250546 GGGATGAGGGGGAAGAGGGAGGG - Intergenic
1005223870 6:23619835-23619857 GGAAGGAAGAGGAAGGAGAAGGG + Intergenic
1005600988 6:27425785-27425807 GGAAACACTAGGAAGAGGATGGG - Intergenic
1005777624 6:29153400-29153422 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1005801402 6:29428650-29428672 GGGATGCCGAGGCAGAAGAATGG + Intronic
1006220910 6:32490518-32490540 GGGTTCAGGAGGAAGAGGAATGG - Intergenic
1006341981 6:33452203-33452225 GGAACGATGAGGCAGAGGATGGG - Exonic
1006509780 6:34515625-34515647 GGGAGAACGAGGAAGGGGAAGGG - Intronic
1006805964 6:36789296-36789318 GGAAGAAGGAGGAAGAGGAAGGG + Intronic
1007247910 6:40475599-40475621 GGGATGATGAGGCTGAGGAAGGG + Intronic
1007557094 6:42775407-42775429 GGAGTGGAGAGGAAGTGGAATGG - Intronic
1007640594 6:43336207-43336229 GAAAGGAGGAGGTAGAGGAAAGG + Exonic
1007761484 6:44135964-44135986 GCAATGAGGAGGTGGAGGAAAGG - Intronic
1007874405 6:45079426-45079448 GGGAAGAGGAGGAAGAAGAAGGG + Intronic
1007874411 6:45079448-45079470 GGGAAGAGGAGGAAGAAGAAGGG + Intronic
1007935801 6:45730770-45730792 AGAGTGAAGAGGAAGAAGAAAGG - Intergenic
1007939451 6:45765452-45765474 GGAGGGAAGGGGAAGAGGAAGGG - Intergenic
1008099681 6:47377510-47377532 GGAATGACGGGGCAGAGAAAGGG - Intergenic
1009425079 6:63505134-63505156 GGAATGAGGAAGCAGAGGGAAGG - Intergenic
1009515270 6:64608333-64608355 GGAATAGAGAAGAAGAGGAAGGG + Intronic
1009722572 6:67491748-67491770 GGTAGGAGGAGGAAGAGGATAGG + Intergenic
1009890759 6:69678325-69678347 GGAAGGATGGGGAAGAGGAGGGG + Intronic
1010311403 6:74390029-74390051 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1010328594 6:74594471-74594493 GGAATGAATAGGAAGAGTACAGG - Intergenic
1011398644 6:86937058-86937080 GGGTTGAGGAGGGAGAGGAACGG - Intergenic
1011414511 6:87103539-87103561 GGAAAGAGGGGAAAGAGGAAGGG + Intergenic
1011553308 6:88549276-88549298 AGAAAGAGGAGGAGGAGGAAGGG - Intergenic
1012216334 6:96589926-96589948 GGAATAACGAAGAATAGGAATGG - Intronic
1012442038 6:99270013-99270035 GAAATGTGGAGGAAGGGGAATGG - Intergenic
1012668474 6:102010346-102010368 GGGAGGAGGAGGAGGAGGAAAGG - Intronic
1012917019 6:105181075-105181097 GCAATGAAGAGAAAGAGCAAAGG - Intergenic
1012982621 6:105846252-105846274 AGGAGGAGGAGGAAGAGGAAGGG + Intergenic
1013140530 6:107329407-107329429 GGAATGAAGATGAGGTGGAAAGG - Intronic
1013145446 6:107386040-107386062 AGAATAAAGAGGATGAGGAAAGG - Intronic
1013269635 6:108534005-108534027 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013269647 6:108534061-108534083 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013447932 6:110250093-110250115 GGAAAGGGGAGGAAGAGGCATGG + Intronic
1013753665 6:113436372-113436394 CGAAAGAACAGGAAGAGGAAAGG - Intergenic
1014187627 6:118453937-118453959 GGCATGAGGACAAAGAGGAAAGG - Intergenic
1014561911 6:122901173-122901195 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1014885356 6:126773730-126773752 GGAATGAAGAAGAAGAGGGAAGG + Intergenic
1015719550 6:136227284-136227306 GGAATTTCCAGGAAGAGGAAAGG + Intergenic
1015820213 6:137252830-137252852 GGAATGAAGGGAGAGAGGAATGG - Intergenic
1017834779 6:158167831-158167853 GAGATGAGGAGGAGGAGGAAAGG - Intronic
1018208394 6:161456787-161456809 GGGTGGAAGAGGAAGAGGAAGGG - Intronic
1018798841 6:167207462-167207484 GGGAGGAAGAGGAAGGGGAAGGG + Intergenic
1018813861 6:167316684-167316706 GGGAGGGGGAGGAAGAGGAAGGG - Intergenic
1018844658 6:167547335-167547357 GGAGGGAGGAGGAAGAGGGATGG - Intergenic
1018852996 6:167654632-167654654 TGAATGACTAGGAGGAGGTAGGG - Intergenic
1018879177 6:167858971-167858993 GGAATGAGGAGTGGGAGGAAAGG + Intronic
1019088494 6:169503127-169503149 AGAGTGACGAGAAAGAGGCAGGG + Intronic
1019234387 6:170597504-170597526 GGAAGGAAAAGGAAAAGGAAAGG + Intergenic
1019234960 6:170603907-170603929 AGAACAACAAGGAAGAGGAAAGG + Intergenic
1019248747 6:170728586-170728608 GGAAAGAGGAGGAGGAGGACGGG + Intergenic
1019419304 7:943250-943272 GGAAGGGAGAGGAGGAGGAAGGG + Intronic
1019419347 7:943417-943439 GGAATGAGGAGGAGGAAGAGAGG + Intronic
1019419412 7:943661-943683 GGAATGAGGAGGAGGAAGAGAGG + Intronic
1019696428 7:2448775-2448797 GGAAGGACAAGGAAAGGGAAGGG - Intergenic
1020004326 7:4774321-4774343 GGAAGGAGGAGGAGGAGGGAGGG - Intronic
1020080181 7:5282685-5282707 GGAATGGGGAGGAGGAAGAAGGG + Intronic
1020577402 7:9950018-9950040 AGAAGGAGGAGGAGGAGGAAGGG + Intergenic
1021044989 7:15911889-15911911 GGAATGAGGAGAAAGAGGAGAGG + Intergenic
1021602987 7:22382864-22382886 AGAATGATGAGGGAGAGGAAGGG - Intergenic
1022149488 7:27586611-27586633 GAAATGAAGGGGAAGGGGAAGGG + Intronic
1022495417 7:30850199-30850221 TGAAGGAGGAGGCAGAGGAAAGG - Intronic
1023149146 7:37183408-37183430 ACAATGAGGAGGAAGAGGCAGGG + Intronic
1023224631 7:37956290-37956312 AGAAAGAGAAGGAAGAGGAATGG + Intronic
1023314297 7:38919464-38919486 GAAAAGAGGAAGAAGAGGAAGGG + Intronic
1023935104 7:44734211-44734233 GGAAGGGGAAGGAAGAGGAAAGG - Intergenic
1023998522 7:45176654-45176676 GGCATGAGGAGGAAGGGGAGGGG + Intronic
1024098311 7:46004114-46004136 GGAATGAAGAGGAAGACCAGCGG + Intergenic
1025117014 7:56267050-56267072 AGAAAGAGGAGGAGGAGGAAAGG - Intergenic
1025257775 7:57397245-57397267 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1025944974 7:66098735-66098757 GGGAGGAGGAGGAGGAGGAACGG + Intronic
1026107181 7:67430491-67430513 AGGAAGAGGAGGAAGAGGAAGGG - Intergenic
1026349674 7:69504680-69504702 TGAATGAAGAAGAAGAAGAAAGG + Intergenic
1026374249 7:69734482-69734504 GGATTGAGGGGGATGAGGAAGGG + Intronic
1026658704 7:72279687-72279709 GCAACGACAAGAAAGAGGAAAGG + Intronic
1026828141 7:73596572-73596594 GGGAAGAGGAGGAAGAAGAAGGG - Intronic
1027141665 7:75661971-75661993 GGAGTGAAGAGGAAGCGCAATGG + Intronic
1028092937 7:86725862-86725884 GGAAGGAGGAAGAAGAGGAAGGG + Intronic
1028692627 7:93671029-93671051 GGAAACATAAGGAAGAGGAAAGG - Intronic
1029076355 7:97937556-97937578 TGCATGTCCAGGAAGAGGAATGG - Intergenic
1029367286 7:100124809-100124831 AGGAAGAGGAGGAAGAGGAAGGG + Exonic
1029622357 7:101698116-101698138 GGAAGGACGAGGAAAAGCAGCGG - Intergenic
1029811617 7:103054808-103054830 AGAAGGAGGAGAAAGAGGAAAGG + Intronic
1029956687 7:104647773-104647795 GGAAGAAGGAGAAAGAGGAAGGG + Intronic
1029966396 7:104745244-104745266 GGAAGAAGGAGAAAGAGGAAGGG - Intronic
1030273314 7:107693135-107693157 GGAAGGACAAGGGAGAGGAAGGG + Intronic
1030785476 7:113655393-113655415 GGAATGAAGAGTAATGGGAAGGG + Intergenic
1030856404 7:114562995-114563017 GGAAGGAAGAGGAGGAGTAAAGG + Intronic
1031214861 7:118877254-118877276 GGAAAGAAGAGGAAGGGGACGGG + Intergenic
1031377899 7:121050153-121050175 TAAATGACAAGGAAGAGGAAGGG - Intronic
1031715608 7:125105360-125105382 TGAATGAGGAGAAAGAGGAAAGG - Intergenic
1031789443 7:126082532-126082554 AGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1032114574 7:129105880-129105902 GAAATCAAGAGGAACAGGAAGGG - Intergenic
1032433679 7:131883018-131883040 GGAAAGGCGAGGGAGAGGGAAGG - Intergenic
1032553069 7:132803893-132803915 GGAATGACGAGGGAGAGAAATGG + Intronic
1032765074 7:134984002-134984024 AGGAAGAAGAGGAAGAGGAAGGG - Intergenic
1032851198 7:135797131-135797153 GGAATGAAAAGGAAGAGAATGGG - Intergenic
1033148715 7:138894239-138894261 TGAAAGATGAGGAAGAGGGAGGG - Intronic
1033234245 7:139625621-139625643 TGAAGGATGAGGAAGAGGATGGG - Intronic
1033420278 7:141199414-141199436 GCAATGATAAGGCAGAGGAATGG + Intronic
1033666940 7:143450165-143450187 GGAAAGACGAAGGAAAGGAAGGG - Intergenic
1033804404 7:144937635-144937657 GGAAGGAAGGGGAAGGGGAAAGG - Intergenic
1034242211 7:149619293-149619315 AGACTGAGGAGGAAGAGGAGGGG - Intergenic
1034359701 7:150483474-150483496 GGACTGAGGAGGTAGAGAAAAGG - Intergenic
1034524282 7:151646928-151646950 GGAAGGTAGAGGAAGAGGAATGG - Intronic
1034625171 7:152487183-152487205 GGAAAGGAAAGGAAGAGGAAAGG - Intergenic
1034696335 7:153057288-153057310 AGAATGAGGAGGAGGAGGAATGG + Intergenic
1034698949 7:153080286-153080308 GGAACAAGGAGGGAGAGGAATGG - Intergenic
1034859338 7:154582535-154582557 GGAAACAGGAGGAGGAGGAAGGG - Intronic
1034945446 7:155259050-155259072 GGAAGGAGGAGGAGGAGGAGGGG - Intergenic
1034945453 7:155259067-155259089 GGAAGGAGGAGGAGGAGGGAAGG - Intergenic
1034945459 7:155259084-155259106 GGAAGGAGGAGGAGGAGGGAAGG - Intergenic
1034945465 7:155259101-155259123 GGAAGGAGGAGGAGGAGGGAAGG - Intergenic
1035041796 7:155934351-155934373 GTGATGACGAGGAGGAGGAGAGG - Intergenic
1035041835 7:155934642-155934664 GTGATGACGAGGAGGAGGAGAGG - Intergenic
1035280798 7:157776765-157776787 GGGAGGAAGAGGAGGAGGAAAGG - Intronic
1035499298 8:78749-78771 GGAAAGAGGAGGAGGAGGACGGG - Intronic
1035513623 8:212073-212095 AGAATAACAAGGAAGAGGAAAGG - Intergenic
1036184680 8:6613242-6613264 GGAATGGCCAGGCAGAGGAGGGG + Intronic
1036241395 8:7084204-7084226 TGCATGTCCAGGAAGAGGAATGG + Intergenic
1036260679 8:7237350-7237372 TGCATGTCCAGGAAGAGGAATGG - Intergenic
1036305931 8:7602172-7602194 TGCATGTCCAGGAAGAGGAATGG + Intergenic
1036312717 8:7695906-7695928 TGCATGTCCAGGAAGAGGAATGG - Intergenic
1036356779 8:8050157-8050179 TGCATGTCCAGGAAGAGGAATGG + Intergenic
1036505035 8:9347450-9347472 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1036607252 8:10318385-10318407 GGAATAACCAGGACGAGGGAGGG - Intronic
1036619053 8:10410986-10411008 GGAAAGACGAGAAGGAGGGAGGG - Intronic
1036831564 8:12024299-12024321 TGCATGTAGAGGAAGAGGAATGG - Intergenic
1036901788 8:12675105-12675127 TGCATGTAGAGGAAGAGGAATGG - Intergenic
1037046580 8:14312705-14312727 AGGAGGAGGAGGAAGAGGAAGGG + Intronic
1037397205 8:18455790-18455812 GGCATGAGGAGGAAGGGAAATGG + Intergenic
1037529355 8:19757940-19757962 GGAGAGAAGAGGGAGAGGAAAGG + Intronic
1037691213 8:21183205-21183227 GGGAGGAGGAGGAAGAGGAGGGG - Intergenic
1037907343 8:22723364-22723386 GGACAGACAAGGGAGAGGAAGGG - Intronic
1038247542 8:25873025-25873047 GGAAGGACGAGGGAGAGAGAAGG - Intronic
1038330495 8:26604467-26604489 GGAAAGAGGAGGTAAAGGAATGG + Intronic
1038483603 8:27918600-27918622 AGAAGGAGGAGGAAGAGGAGGGG + Intronic
1038483666 8:27918891-27918913 GGAAGAAAGAGGAGGAGGAAGGG + Intronic
1038557199 8:28531126-28531148 GGAGGGAGGAAGAAGAGGAATGG - Intronic
1038642360 8:29338458-29338480 GCACTGCCGAGGTAGAGGAAGGG + Exonic
1039096425 8:33891574-33891596 AGGAGGAGGAGGAAGAGGAAGGG + Intergenic
1039589169 8:38732176-38732198 GGAAGGAAGAGGGAAAGGAAAGG + Intronic
1039640548 8:39216466-39216488 GGAAAGAGGAGAAAGGGGAAAGG - Intronic
1039725872 8:40216026-40216048 GGAATTTAGAGGAAGAGAAAAGG + Intergenic
1039752131 8:40488315-40488337 GCAGTGATGAGGGAGAGGAAAGG - Intergenic
1040062689 8:43117438-43117460 GGGCTGAGGAGGAGGAGGAAAGG + Intronic
1040549856 8:48429519-48429541 GGAAAGACAAGGGAGAGGAGAGG + Intergenic
1040582634 8:48709577-48709599 CGAAAGAGGAGGAAGAGGAGGGG - Intergenic
1040664316 8:49614159-49614181 GGAATAATGAGGAATAGAAATGG + Intergenic
1041090025 8:54293344-54293366 GGAATGGTGAGGAAAAGGACTGG - Intergenic
1041095247 8:54343147-54343169 AGAAGGGAGAGGAAGAGGAAGGG - Intergenic
1041217414 8:55614726-55614748 GGAAGGAAGAGGAAGAGGAGGGG + Intergenic
1041321248 8:56615150-56615172 GGAAAAAAGAGAAAGAGGAAGGG - Intergenic
1041330502 8:56719245-56719267 AGAAGGAGGGGGAAGAGGAAGGG - Intergenic
1041610182 8:59836937-59836959 GAAAAGACTAGGAAGAGGAGGGG + Intergenic
1042225504 8:66511769-66511791 AGAATGAAGAGGAAGAGGCCAGG + Intronic
1042279175 8:67036793-67036815 GAAAAGAAGAGGAAGAGGAGGGG - Intronic
1042388281 8:68202960-68202982 GGAACAAAAAGGAAGAGGAAGGG - Intronic
1042476158 8:69250329-69250351 GTAATTACCAGGAAGAGAAAGGG + Intergenic
1042816474 8:72882981-72883003 GGAATGGAGGGGAAGTGGAAAGG - Intronic
1043115601 8:76250044-76250066 AGAAGAAGGAGGAAGAGGAAGGG - Intergenic
1043602068 8:81952608-81952630 AGAATGAGGAGAAAGAGGAGAGG - Intergenic
1043751967 8:83948910-83948932 GGAAGGAAGGGGAAGAGGGAAGG + Intergenic
1043912810 8:85883171-85883193 GGAATGATGAAGAAAAGGTAAGG - Intergenic
1043998414 8:86847655-86847677 GGAAGAAAAAGGAAGAGGAAAGG + Intergenic
1044142043 8:88668613-88668635 GGAATTAAAAGGAAGAGGAAAGG - Intergenic
1044283435 8:90383368-90383390 GGATGGAGGAGAAAGAGGAATGG - Intergenic
1044428997 8:92086821-92086843 GGGATGAGAAGGAAGAGGCAGGG - Intronic
1044642702 8:94401332-94401354 AGGAAGAGGAGGAAGAGGAAGGG - Intronic
1044701028 8:94965341-94965363 GGAATGAGGAAGAAGAGGCTGGG + Intronic
1044783092 8:95763524-95763546 AGAATGACCAGGATGAAGAAAGG - Intergenic
1045015043 8:97994170-97994192 GGAAAGAAGAGGAGGAGGGAGGG + Intronic
1045247197 8:100453397-100453419 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045247236 8:100453594-100453616 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045358606 8:101411787-101411809 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1045393262 8:101735989-101736011 GGCACAAGGAGGAAGAGGAACGG - Intronic
1045942493 8:107755323-107755345 GGAATGACGCAGAAGCCGAAGGG + Intergenic
1046132299 8:109981070-109981092 GTAAAGACAAGCAAGAGGAAAGG + Intergenic
1046450611 8:114385525-114385547 GGAATGAAGAAGACGATGAATGG + Intergenic
1046716871 8:117577623-117577645 GGGATGAGGAGCAAGAGAAAAGG - Intergenic
1046913361 8:119653182-119653204 GGCATGACCAGGATGAGGAGAGG + Intronic
1047410354 8:124619551-124619573 TGAATGACGTTAAAGAGGAAAGG + Intronic
1047637165 8:126776929-126776951 GGAAAGAAGAGGGAGGGGAAGGG + Intergenic
1047993224 8:130308744-130308766 AGAATGATGATGAAGAGGCAAGG + Intronic
1048021512 8:130543628-130543650 GGAACAAAGAGGCAGAGGAAAGG - Intergenic
1048056367 8:130869991-130870013 AGAAAGAAGAGGAAGAGGAGAGG - Intronic
1048389122 8:133944379-133944401 GGAAGGAAGAGGAAGAAGGAAGG - Intergenic
1048865667 8:138759846-138759868 GAAAAGAAGAGGAAGAGAAAAGG + Intronic
1048960562 8:139573444-139573466 GGGATGAGGAGGATAAGGAAGGG - Intergenic
1049119899 8:140726205-140726227 GGGGAGAGGAGGAAGAGGAAGGG + Intronic
1049356685 8:142192665-142192687 GGAAGGAGGAGGGAGAGGGAGGG + Intergenic
1049792457 8:144478256-144478278 GGAAGGATGAGGCAGAGGAGAGG + Intronic
1050098348 9:2091730-2091752 AGAATGTGGAGGAAGTGGAATGG - Intronic
1050190598 9:3021387-3021409 AGAAGGAGAAGGAAGAGGAAAGG - Intergenic
1050794762 9:9524265-9524287 GGAAGGAAGGGAAAGAGGAAAGG - Intronic
1050803690 9:9647176-9647198 GGAATGACTAGAAAGAGGGGGGG - Intronic
1051357865 9:16255846-16255868 AGAATGAAAAGGAAGAGGAGAGG - Intronic
1051865859 9:21681564-21681586 GGAAGGAAGAGGGAGAGGAAGGG + Intergenic
1052142189 9:25000967-25000989 AGAATGAGGAGGAACAGGAGGGG + Intergenic
1052305681 9:27006664-27006686 GGAAGGAGGAGGAGGAGGAAGGG + Intronic
1053161016 9:35813494-35813516 GGAATGACCAGGAAGTGCACAGG + Exonic
1053566372 9:39256866-39256888 GGAAGGAGGAGGAGAAGGAAGGG + Intronic
1053785753 9:41651879-41651901 AGAAGGAGGAGGAGGAGGAACGG - Intergenic
1053832153 9:42094726-42094748 GGAAGGAGAAGGAGGAGGAAGGG + Intronic
1054130775 9:61362146-61362168 GGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1054598392 9:67092698-67092720 GGAAGGAGAAGGAGGAGGAAGGG - Intergenic
1055056329 9:72027662-72027684 GGAAGGAAGAGGAAGTGCAAAGG + Intergenic
1055266070 9:74497564-74497586 GGACTGAGGAGGAGGAGGAAGGG - Exonic
1055413759 9:76060458-76060480 AGGCTGAGGAGGAAGAGGAAGGG + Intronic
1055747233 9:79462345-79462367 GGAATGAGGAGACAGGGGAATGG + Intergenic
1055979754 9:81990441-81990463 AGAGAGAAGAGGAAGAGGAAAGG + Exonic
1056241611 9:84653485-84653507 AAAAGGAGGAGGAAGAGGAAAGG + Intergenic
1056282391 9:85054286-85054308 GGAAGGACCATGTAGAGGAACGG + Intergenic
1056523337 9:87420299-87420321 AGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1056659416 9:88534013-88534035 GGGACGACGAGGAAGGGGAAGGG - Intergenic
1056777723 9:89526011-89526033 CGAATCATGAGGAAGAGGAGAGG + Intergenic
1057114109 9:92504304-92504326 GGAAATAGGAAGAAGAGGAAGGG + Intronic
1057147597 9:92768631-92768653 GGAAGGAAGAGGTTGAGGAAGGG - Intergenic
1057292818 9:93818219-93818241 GGAAGGAAGAGAAAGAGGGAGGG + Intergenic
1057292899 9:93818539-93818561 GGAATGAAGGGAAAGAGGGAAGG + Intergenic
1058226981 9:102377038-102377060 GGAAGGCAGAGGAAGACGAATGG + Intergenic
1058245495 9:102619261-102619283 GGAATGAGAAGAAAGTGGAAAGG - Intergenic
1058392664 9:104513508-104513530 AGGAAGAGGAGGAAGAGGAAAGG - Intergenic
1058437254 9:104974448-104974470 GGAAAGAGGAAAAAGAGGAAGGG - Intergenic
1058561417 9:106233061-106233083 GAAAGGAGGAGGAGGAGGAACGG - Intergenic
1058628897 9:106965479-106965501 GGACTGAGGAGGAAAATGAATGG + Intronic
1058774766 9:108272585-108272607 GGAAAGAGGAGAAAGAGAAAAGG + Intergenic
1058919259 9:109597739-109597761 GGCATGACAAGGGAGATGAAAGG - Intergenic
1058981352 9:110173586-110173608 GGAAGTACCAGGAAGAGGAGGGG - Intergenic
1059266300 9:113034600-113034622 GGAATGGAGAGAAAGAGGATTGG - Intergenic
1059374304 9:113870319-113870341 GGGATGGGGAGGTAGAGGAATGG + Intergenic
1059385654 9:113962299-113962321 GGACTGAAGAGGGTGAGGAAAGG - Intronic
1059441627 9:114310730-114310752 GGAGGGAAGAGGAAGAGGCAAGG + Exonic
1059578589 9:115519182-115519204 AGAAGGAGGAGGAAGAGGAGGGG - Intergenic
1059592776 9:115679955-115679977 AGAAGGAGGAGGAGGAGGAAGGG - Intergenic
1059646732 9:116275623-116275645 GGAAAAAGGGGGAAGAGGAAGGG - Intronic
1059989881 9:119854939-119854961 GGAATGCAGAGGAGGAGAAAAGG + Intergenic
1060186898 9:121568988-121569010 GGATTCAAGAGGAAGAGGAAAGG + Intronic
1060199468 9:121644201-121644223 AGGAAGAAGAGGAAGAGGAAGGG + Intronic
1060712005 9:125876407-125876429 GGGAGGAGGAGGAAGAGGAAAGG - Intronic
1061331885 9:129899794-129899816 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1061497267 9:130982096-130982118 GGAGTGACGAGGAGATGGAATGG + Intergenic
1061541569 9:131280304-131280326 AAAATGACGAGCAGGAGGAAGGG - Intergenic
1061664807 9:132154300-132154322 GGCAGGACGAGGAAGAGAGAGGG + Intergenic
1061900404 9:133669319-133669341 GGGAGGACGAGGGAGAGGGAGGG - Intronic
1062008517 9:134254407-134254429 GGGAGGAGGAGGAGGAGGAAAGG + Intergenic
1062542122 9:137046120-137046142 AGGAGGAGGAGGAAGAGGAAAGG + Exonic
1062627717 9:137450737-137450759 GGAATTAAGAGGAAGAGGCGAGG - Intronic
1203580537 Un_KI270745v1:40661-40683 AGAATAACAAGGAAGAGGAAAGG + Intergenic
1203609705 Un_KI270748v1:85850-85872 GGAAAGAGGAGGAGGAGGACGGG + Intergenic
1185540496 X:899411-899433 AGAAGGAGGAGGAAGGGGAAGGG - Intergenic
1185661925 X:1735191-1735213 GGAAGGAGGAGGAGGAGGGAAGG - Intergenic
1185688336 X:1948468-1948490 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1185688614 X:2133990-2134012 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1186058899 X:5681954-5681976 GAAAGGAGGAGGAAGAGGAGTGG + Intergenic
1186218710 X:7326764-7326786 GTAATGAGAAGGAAGAGGAAAGG + Intronic
1186368771 X:8925373-8925395 AGGCTGAAGAGGAAGAGGAAGGG + Intergenic
1187149464 X:16668690-16668712 GGAAGGAGAAGGAAAAGGAAGGG + Intronic
1187285998 X:17904508-17904530 GGAACCACCAGGAAGAGGTAAGG - Intergenic
1187452670 X:19412582-19412604 GGGCTGAAGAGAAAGAGGAAGGG + Intronic
1187471546 X:19574178-19574200 GGAAACACGAGGAAGAGAGATGG - Intronic
1187576242 X:20559232-20559254 GGAAGAAAGGGGAAGAGGAAAGG - Intergenic
1187576256 X:20559290-20559312 GGAAGAAAGGGGAAGAGGAAGGG - Intergenic
1188209314 X:27401432-27401454 GGAAGGAGAAGGAAGAGAAAAGG + Intergenic
1189102793 X:38208596-38208618 GGAATCAAGAGGAAAATGAAGGG + Intronic
1189259106 X:39665108-39665130 GGAATAAAAAGGCAGAGGAAAGG - Intergenic
1189958914 X:46306593-46306615 GGTCTGACGAGCAAAAGGAAGGG + Intergenic
1190259819 X:48790826-48790848 AGAACGAGGAGGAAGATGAAAGG + Intronic
1190373121 X:49762267-49762289 AGAAAGAAGAGAAAGAGGAATGG - Intergenic
1191796381 X:65026059-65026081 GGACAGAGGAGGAATAGGAATGG + Intronic
1192106014 X:68317665-68317687 GGAAGGAGGAGGAGGAGGAAGGG + Intronic
1192143771 X:68666761-68666783 GGAATGATGATGACGGGGAAAGG - Intronic
1192286704 X:69746057-69746079 GGAAGGAAGAGGGAGAGGAGGGG - Intronic
1192493648 X:71598401-71598423 GGAATGACGAGGAAGAGGAAAGG + Intronic
1192709285 X:73563185-73563207 GAAATGAAGAGAAAGAGGAGGGG - Intronic
1193319807 X:80107975-80107997 AGGAGGAGGAGGAAGAGGAAAGG + Intergenic
1193667838 X:84345295-84345317 GGGAAGGAGAGGAAGAGGAATGG - Intronic
1194488105 X:94511686-94511708 GGGATGACTAGGGAGAGGACAGG + Intergenic
1194649984 X:96503097-96503119 GGACTGAAGTGGAAGAAGAAGGG + Intergenic
1194939020 X:99987102-99987124 AGAATGACCTTGAAGAGGAATGG + Intergenic
1194992953 X:100564210-100564232 AGAATGAAGAGGAAGAGAAGAGG + Intergenic
1195349760 X:103985149-103985171 GGGAGGAAGAGGAAGAGGCAGGG - Intergenic
1195357683 X:104053690-104053712 GGGAGGAAGAGGAAGAGGCAGGG + Intergenic
1195859220 X:109363438-109363460 AGGAGGAGGAGGAAGAGGAAAGG + Intergenic
1197355154 X:125430413-125430435 AGGAGGAGGAGGAAGAGGAAAGG - Intergenic
1197664840 X:129212411-129212433 AGAATTATGAGGAAGAGGAAGGG + Intergenic
1199498917 X:148487642-148487664 AGGATGAAGAGGAAGAGGAGGGG - Intergenic
1199778196 X:151034060-151034082 AGAAGGAGGAAGAAGAGGAAGGG + Intergenic
1199850453 X:151722110-151722132 GGGATGAGGAGGAAGAGGAAGGG - Intronic
1199860752 X:151798744-151798766 GGAATTAGGAGGGAGAGAAAGGG + Intergenic
1200246968 X:154531629-154531651 GGAGGGACGAGGGGGAGGAAAGG - Exonic
1200621938 Y:5460332-5460354 GGAAGAAAGAGGAAAAGGAAAGG + Intronic
1201146184 Y:11066754-11066776 GGAGGGAGGAGGGAGAGGAAGGG + Intergenic
1201146584 Y:11068022-11068044 GGAAGGGAGAGGGAGAGGAAGGG + Intergenic
1201274218 Y:12283558-12283580 AGAATGACTAGGAAGGGAAAAGG + Intergenic
1201791885 Y:17850033-17850055 GGAATCACAGGGAAGATGAAAGG + Intergenic
1201799795 Y:17942608-17942630 GTAATCACGGGGAAGATGAAAGG + Intergenic
1201801758 Y:17963348-17963370 GTAATCACGGGGAAGATGAAAGG - Intergenic
1201809669 Y:18055956-18055978 GGAATCACAGGGAAGATGAAAGG - Intergenic
1201928414 Y:19315108-19315130 AGAATGATGATGAGGAGGAAAGG - Intergenic
1202353490 Y:24019683-24019705 GGAATCACAGGGAAGATGAAAGG + Intergenic
1202361742 Y:24117988-24118010 GGAATCACAGGGAAGATGAAAGG - Intergenic
1202363330 Y:24135108-24135130 GGAATCACAGGGAAGATGAAAGG + Intergenic
1202507450 Y:25535009-25535031 GGAATCACAGGGAAGATGAAAGG - Intergenic
1202509035 Y:25552125-25552147 GGAATCACAGGGAAGATGAAAGG + Intergenic
1202517289 Y:25650432-25650454 GGAATCACAGGGAAGATGAAAGG - Intergenic