ID: 1192493649

View in Genome Browser
Species Human (GRCh38)
Location X:71598410-71598432
Sequence AGGAAGAGGAAAGGAGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2118
Summary {0: 1, 1: 2, 2: 18, 3: 258, 4: 1839}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493645_1192493649 0 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493638_1192493649 17 Left 1192493638 X:71598370-71598392 CCCTCTTCCTCTCTTCCCCGCTC 0: 1
1: 1
2: 21
3: 250
4: 2061
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493643_1192493649 2 Left 1192493643 X:71598385-71598407 CCCCGCTCTATGTGTGGGAATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493639_1192493649 16 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493640_1192493649 10 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839
1192493644_1192493649 1 Left 1192493644 X:71598386-71598408 CCCGCTCTATGTGTGGGAATGAC 0: 1
1: 0
2: 0
3: 8
4: 1578
Right 1192493649 X:71598410-71598432 AGGAAGAGGAAAGGAGTAAGAGG 0: 1
1: 2
2: 18
3: 258
4: 1839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493649 Original CRISPR AGGAAGAGGAAAGGAGTAAG AGG Intronic
Too many off-targets to display for this crispr