ID: 1192493650

View in Genome Browser
Species Human (GRCh38)
Location X:71598415-71598437
Sequence GAGGAAAGGAGTAAGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 790}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192493644_1192493650 6 Left 1192493644 X:71598386-71598408 CCCGCTCTATGTGTGGGAATGAC 0: 1
1: 0
2: 0
3: 8
4: 1578
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493645_1192493650 5 Left 1192493645 X:71598387-71598409 CCGCTCTATGTGTGGGAATGACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493643_1192493650 7 Left 1192493643 X:71598385-71598407 CCCCGCTCTATGTGTGGGAATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493640_1192493650 15 Left 1192493640 X:71598377-71598399 CCTCTCTTCCCCGCTCTATGTGT 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493638_1192493650 22 Left 1192493638 X:71598370-71598392 CCCTCTTCCTCTCTTCCCCGCTC 0: 1
1: 1
2: 21
3: 250
4: 2061
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790
1192493639_1192493650 21 Left 1192493639 X:71598371-71598393 CCTCTTCCTCTCTTCCCCGCTCT 0: 1
1: 0
2: 19
3: 192
4: 1926
Right 1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192493650 Original CRISPR GAGGAAAGGAGTAAGAGGCC TGG Intronic
900372972 1:2340420-2340442 GAGGGGAGGAGTCAGTGGCCAGG - Intronic
900417821 1:2543148-2543170 AGGGAAGGGAGGAAGAGGCCTGG + Intergenic
900549894 1:3249211-3249233 GAGGAAGGGAGTAGGGGGCAGGG + Intronic
900662468 1:3791749-3791771 AAAGAAAGGAGAGAGAGGCCGGG - Intronic
901173359 1:7280201-7280223 AAGGAAATGAGTGTGAGGCCAGG - Intronic
901411496 1:9087497-9087519 AAAGAAAGAAGAAAGAGGCCAGG - Intronic
901588645 1:10319988-10320010 GAGGGAAGAAATAAGAGGGCAGG - Intronic
901654773 1:10763003-10763025 GGGAAAAGGAGGAGGAGGCCTGG - Intronic
901709945 1:11105938-11105960 CAGGAAAGCAGTACGGGGCCGGG - Intergenic
902098524 1:13966183-13966205 GAGGGAAGGAGTAGGAGGGAGGG - Intergenic
902178114 1:14666717-14666739 GAGGAGAGGACTCAGAGGCACGG - Intronic
902249696 1:15146217-15146239 GAGAGGAGGAGAAAGAGGCCAGG - Intergenic
902402389 1:16165387-16165409 GAGGAAAGGAGGAAGGGGTCAGG + Intergenic
902478064 1:16698451-16698473 GAGGGAAGGAGAAGGAGGCTCGG + Intergenic
902768044 1:18630076-18630098 CTGGAAAGGAGTTATAGGCCCGG + Intergenic
902917506 1:19647553-19647575 GAGGAAAGGTGGGAGAGGCAGGG + Intronic
902954053 1:19912444-19912466 GAGGAAAGAAGAAAAGGGCCAGG + Exonic
902988208 1:20168667-20168689 GAGGGAGGCAGTCAGAGGCCGGG + Intronic
903169048 1:21540875-21540897 GAAGAAAGGAGTAACCTGCCAGG - Intronic
903453452 1:23470647-23470669 AAGGAAAACAGCAAGAGGCCAGG - Intronic
903524646 1:23983902-23983924 AAGAAAAGAAGAAAGAGGCCGGG - Intergenic
903701008 1:25247966-25247988 TAGGACAGGAGGAAGAGGCCAGG - Intronic
903734454 1:25521480-25521502 GAGCAGAGGAGAAAGAGGCTGGG - Intergenic
903820729 1:26100518-26100540 GAGGCCAGGAGTTCGAGGCCAGG + Intergenic
905132780 1:35773660-35773682 GATGAAAGGAGTTCTAGGCCAGG - Intergenic
905135031 1:35792502-35792524 AAGGAAAAGAAAAAGAGGCCAGG - Intergenic
905304323 1:37007043-37007065 GAGGCAGGGAGTCAGAGGACAGG + Intronic
905424629 1:37873210-37873232 GAGGAAAGGGGAAAGAAGGCAGG + Intronic
905988822 1:42314160-42314182 GAGGAATGGGCTAAGAGGCCAGG - Intronic
906078317 1:43068141-43068163 GGGGAAGGGAGCAGGAGGCCAGG + Intergenic
906398889 1:45490659-45490681 AAGGAAAGGGGAAAGCGGCCAGG + Intronic
906447708 1:45917618-45917640 GAGAAATGGAGTAAGAGTCTTGG + Intronic
906514082 1:46428690-46428712 TCGGAAAGCAGTAAAAGGCCGGG - Intergenic
906552798 1:46679818-46679840 GAGGCTAGGAGTTAGAGACCTGG - Intronic
906832123 1:49044200-49044222 GAGGGAAGTAGGAAGAGGCAGGG + Intronic
907156031 1:52334924-52334946 GAAGAAAGGAGTAAGTGGTAGGG + Intronic
908220758 1:62003746-62003768 GAGGAAAGGAGTACCAGGCTAGG - Intronic
909111236 1:71480396-71480418 GAGAAAAGGAGAAAGAGGAAAGG - Intronic
910438852 1:87231841-87231863 GAGGAAATGAGAAAGGGGCAAGG - Intergenic
910494427 1:87810533-87810555 CAGCCAAGGAGTAAGAGGCAAGG - Intergenic
910707577 1:90146355-90146377 TAGAAAAGGAAAAAGAGGCCGGG + Intergenic
910984848 1:92995514-92995536 GAGGAAAGGCATAAGAGGCGAGG + Intergenic
911055645 1:93706091-93706113 GGAGAAAGGAGGAAGAGGCAAGG - Exonic
911474379 1:98357894-98357916 GAAGAAAAAAGAAAGAGGCCAGG - Intergenic
911658628 1:100475001-100475023 AAGGAAAGGAAAAAGAGGACAGG - Intronic
911887038 1:103315810-103315832 GATGAAAGGAGAAAGAGGGATGG + Intergenic
912498354 1:110105900-110105922 CAGCAAAGGAGTGAGAGGCGAGG - Intergenic
912769599 1:112451556-112451578 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
913497779 1:119444229-119444251 TAGAAAAGGAGTTTGAGGCCGGG - Intergenic
913679432 1:121174660-121174682 AAAAAAAGGAATAAGAGGCCGGG - Intronic
914031262 1:143962307-143962329 AAAAAAAGGAATAAGAGGCCGGG - Intronic
914057889 1:144182260-144182282 AAGGAAAGGAGAAAGAGGGAAGG - Intergenic
914121257 1:144784105-144784127 AAGGAAAGGAGAAAGAGGGAAGG + Intergenic
914158185 1:145105655-145105677 AAAAAAAGGAATAAGAGGCCGGG + Intronic
914214829 1:145615913-145615935 TAGAAAAGGAGTCAGTGGCCAGG - Intronic
914466771 1:147936305-147936327 TAGAAAAGGAGTCAGTGGCCAGG - Intronic
914743144 1:150481818-150481840 AAAGAAAGGATTATGAGGCCGGG - Intergenic
914760700 1:150595804-150595826 GGGGAGAGGGGGAAGAGGCCAGG + Intergenic
914898042 1:151694449-151694471 CATGAAAGGAGTAAGAGGATGGG - Exonic
914935204 1:151973065-151973087 GAGGGAGGGAGTAAGAAGCAGGG - Intergenic
915174937 1:154006788-154006810 TAAGAAAGCAGAAAGAGGCCAGG - Intronic
915452594 1:156016838-156016860 GAGGAAGAGAGTAAGAGGGGAGG - Intronic
915879852 1:159657935-159657957 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
916060761 1:161097187-161097209 GAAGAAAGGAGACAGTGGCCAGG - Intergenic
916119110 1:161512215-161512237 GGGGAAAGGAGGAGGAGGCCTGG + Intronic
916119169 1:161512505-161512527 GAGGAAATGAGTGGGTGGCCAGG + Intronic
916128869 1:161593874-161593896 GGGGAAAGGAGGAGGAGGCCTGG + Intronic
916128928 1:161594164-161594186 GAGGAAATGAGTGGGTGGCCAGG + Intronic
916138785 1:161675705-161675727 GGGGAAAGGAGGAGGAGGCCTGG + Intronic
916138840 1:161675995-161676017 GAGGAAATGAGTGGGTGGCCAGG + Intronic
916558130 1:165910540-165910562 GTGTGAAGGAGTGAGAGGCCAGG - Intronic
916822156 1:168410123-168410145 GAGGAAATGGGGAAGAGGCTGGG + Intergenic
917807677 1:178628442-178628464 GAGGTCAGGAGTTAGAGACCAGG - Intergenic
918281225 1:183008168-183008190 GAGGTCAGGAGTTTGAGGCCAGG - Intergenic
918522942 1:185434737-185434759 GAGAAAAAGAATAACAGGCCAGG - Intergenic
918600309 1:186350643-186350665 GAGGAAATGAGGCAGAGCCCAGG + Intronic
919125861 1:193392869-193392891 GAAGGGAGCAGTAAGAGGCCAGG + Intergenic
919257517 1:195142760-195142782 GAGGACAGGAGTTCGAGACCAGG + Intergenic
919367664 1:196684838-196684860 GAAGAAGGGATTAAGAGCCCAGG + Intronic
919377120 1:196808787-196808809 GAGGTGTGGAGTGAGAGGCCCGG + Intergenic
919386826 1:196933687-196933709 GAGGTATGGAGTGAGAGCCCCGG + Intronic
919796856 1:201326069-201326091 AAGGAAATGTGTGAGAGGCCTGG + Intronic
919921213 1:202167678-202167700 GATTAAAGAAGGAAGAGGCCGGG - Intergenic
919921379 1:202168436-202168458 GATTAAAGAAGGAAGAGGCCGGG - Intergenic
920043606 1:203119461-203119483 GAGGTCAGGAGTTTGAGGCCAGG + Intronic
920382059 1:205540736-205540758 GAGGCAAGGAGTTCGAGACCAGG + Intergenic
920466733 1:206193206-206193228 AAAAAAAGGAATAAGAGGCCGGG - Intronic
921143261 1:212326378-212326400 GAGGTCAGGAGTTTGAGGCCAGG + Intronic
921561035 1:216658524-216658546 GAGGAGAAAAGAAAGAGGCCAGG + Intronic
922451708 1:225742856-225742878 GAGGTCAGGAGTTTGAGGCCAGG + Intergenic
922477941 1:225919748-225919770 GATGAGAGGAATAAGGGGCCAGG - Intronic
923232394 1:231999489-231999511 GGGGAAGGGAGTTGGAGGCCAGG - Intronic
923300433 1:232635405-232635427 GAGGAAAGGAGGAAGAGATGGGG + Intergenic
923386034 1:233466021-233466043 GAGGTATGGAGGGAGAGGCCCGG + Intergenic
923983670 1:239355105-239355127 GAAGAAAATAGTAAAAGGCCAGG - Intergenic
1062861997 10:817316-817338 GAGACAAGGAGCAAGAAGCCTGG - Intronic
1063064205 10:2591922-2591944 GAGGAAAGGAGAATGTGGCCTGG + Intergenic
1063529764 10:6819700-6819722 GAGGAGAGGAGAAGGAGGGCAGG + Intergenic
1064295901 10:14079001-14079023 GAGGAAAGGACTGAGTGTCCAGG + Intronic
1064331341 10:14397027-14397049 CTGGAAAGGAGTTAAAGGCCTGG + Intronic
1064402183 10:15030660-15030682 GAAGACAGGAGTTTGAGGCCAGG + Intergenic
1064559495 10:16582214-16582236 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
1064738559 10:18409082-18409104 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
1064783978 10:18874053-18874075 GAGGTCAGGAGTTTGAGGCCAGG + Intergenic
1064820423 10:19323904-19323926 TATAAAAGGAATAAGAGGCCGGG - Intronic
1064979461 10:21151650-21151672 GTGGAAAGGAGGAAGGGGCCTGG - Intronic
1065857750 10:29843944-29843966 GAGGAAGGGAGTGAGGGGGCAGG + Intergenic
1067055982 10:43050552-43050574 GAGCAAAGGAGAAAGAGGATTGG + Intergenic
1067063882 10:43092926-43092948 GGGGAAGGGAGTAAGAGGACGGG - Intronic
1067278396 10:44853732-44853754 GAGGAGAGGAGTCAGAGAGCAGG - Intergenic
1067290503 10:44936059-44936081 GAGGATAGGAGGAAGTGGGCAGG + Exonic
1067683676 10:48455148-48455170 GAGGACAGGTGTGTGAGGCCTGG + Intronic
1067901457 10:50245823-50245845 GAGGAAAGGAGTGAGGAGTCTGG - Intronic
1068913716 10:62406155-62406177 CTGGAAAGGAGCAAGAGGTCTGG - Intronic
1069005394 10:63312319-63312341 GAGGTCAGGAGTTAGAGACCAGG - Intronic
1069192975 10:65513023-65513045 GAGGTAAGGAGTTTGAGACCAGG - Intergenic
1069638013 10:69937400-69937422 GAGAAAAGGACTAGGTGGCCTGG - Intronic
1069642337 10:69963987-69964009 GAGGAAAGGAGCTTGAGCCCAGG - Intronic
1069756576 10:70777401-70777423 GAGGAGAGGAGCAGGAGGCCGGG + Intronic
1069959122 10:72069230-72069252 GAGAGAATGAGCAAGAGGCCAGG - Intronic
1070157646 10:73845683-73845705 GAGCAAAGAAGAGAGAGGCCAGG - Intronic
1070307058 10:75245946-75245968 GAGGAAAGGGGCAAGTGGCTGGG - Intergenic
1070525773 10:77294703-77294725 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
1070666191 10:78345836-78345858 CAGGAATGAAGTCAGAGGCCAGG - Intergenic
1071371586 10:84957100-84957122 GAGAAAAGGAGGAAGAGGAAAGG - Intergenic
1071492668 10:86146639-86146661 GAGGAAGGAAGGAAGAGGGCGGG - Intronic
1071876080 10:89844753-89844775 GAGGAAAGAGGAGAGAGGCCGGG + Intergenic
1072232071 10:93422446-93422468 GAGGAAAGGAGAAGGAGCCTTGG + Intronic
1072621287 10:97081194-97081216 GAGGAGAGGAGTGACAGGGCTGG + Intronic
1073429938 10:103479361-103479383 GAGGAATGGAGTGACAGGGCGGG - Intergenic
1073773389 10:106760147-106760169 GATAAGAGGAGGAAGAGGCCGGG + Intronic
1073806253 10:107101573-107101595 GAGGACAGGAGTTTGAGACCAGG - Intronic
1074398554 10:113121260-113121282 GAGGAAGGAAGGAAGAGGGCGGG - Intronic
1075003408 10:118814050-118814072 GAGGAAAGGAGGAGGAGATCTGG - Intergenic
1075065605 10:119287183-119287205 GAGGAAAGGAGGGAGAGAACAGG + Intronic
1075734590 10:124656140-124656162 AAGGAAATGAGGAGGAGGCCTGG + Intronic
1077577382 11:3394761-3394783 GAGGAATGTAGTAGGAGGGCAGG + Intergenic
1077965684 11:7130359-7130381 GAAGAAAGGAGAAAGAGGGAGGG - Intergenic
1078364837 11:10697905-10697927 GAGGAATGGAGGGAGAGGGCAGG + Intergenic
1078500126 11:11865246-11865268 AAGAAAAGGAGAAAGAGGGCAGG - Intronic
1079786379 11:24678062-24678084 GAGGAAAGGAGAAAGGGGGGGGG + Intronic
1079794333 11:24780487-24780509 AAGTAAATGAGTAAGATGCCTGG - Intronic
1080046569 11:27814753-27814775 GATGAAAAGAGAAAGAGTCCTGG + Intergenic
1080172608 11:29323713-29323735 GAGGACAGGAGTTCGAGACCAGG + Intergenic
1080388003 11:31820817-31820839 GAGGAAAAGCGACAGAGGCCGGG - Intronic
1080662636 11:34310143-34310165 GAGGAAAGCACTGAGAGCCCAGG + Intronic
1080664042 11:34319961-34319983 GAGGTCAGGAGTTCGAGGCCAGG - Intronic
1081791361 11:45788758-45788780 GAGGCCAGGAGTTCGAGGCCAGG - Intergenic
1081936696 11:46909309-46909331 GAGAAAAGGAGGAATCGGCCGGG + Intronic
1082839994 11:57681306-57681328 AAGGAAAGGAAGAAGAGGACAGG - Intronic
1083394658 11:62381991-62382013 GAGAAAAGAAATAAGAGGCTGGG + Intronic
1083479377 11:62933882-62933904 AAGGAGAGGAGGAAGAGGGCTGG - Intergenic
1083729083 11:64643337-64643359 GGGGAAAGGAGGGAGCGGCCGGG + Intronic
1084109555 11:67004870-67004892 GAGGCAAAGAGAAAAAGGCCAGG + Intergenic
1084366479 11:68704307-68704329 GAGGCTAGGAGTTTGAGGCCTGG + Intergenic
1084618104 11:70250023-70250045 GAAGAAAGGACGCAGAGGCCAGG - Intergenic
1084684032 11:70683260-70683282 AAAGAAAGGAGGAAGTGGCCAGG - Intronic
1084826737 11:71737520-71737542 GAGGAGAAGAGAAAGAGGCAAGG - Intergenic
1085652721 11:78282910-78282932 GAGGAATGGAGAAAGAAGCAAGG - Intronic
1086744741 11:90410886-90410908 GGGAAAAGGAGTAAGAGGCTGGG + Intergenic
1086921150 11:92588619-92588641 GATGAAAAGAGTAAGAGACTTGG + Intronic
1087066412 11:94031889-94031911 GAGGAGAGGAGAAAGTGGTCTGG + Intronic
1088298037 11:108322365-108322387 GAGGTCAGGAGTTCGAGGCCAGG - Intronic
1089634391 11:119803199-119803221 GAGCAAAGGAGCAAGAGACGCGG + Intergenic
1090133590 11:124171055-124171077 GAGGCATGGAGGAAGAGGCGTGG - Intergenic
1090365012 11:126198349-126198371 GAGGACAGGAGCAACAGGCCCGG + Intergenic
1090436363 11:126689974-126689996 GAGGAAGGCAGTGTGAGGCCGGG - Intronic
1090484314 11:127098902-127098924 GAGGAAGGGAGTGGAAGGCCAGG - Intergenic
1090615870 11:128514360-128514382 AAGGAAGGAAGTAGGAGGCCAGG - Intronic
1090842578 11:130505474-130505496 AAGGAGAGGAGAAAGAGGACAGG - Intergenic
1090973913 11:131666212-131666234 GAGCAAAGGAGTGATAGGCAGGG - Intronic
1091220671 11:133928299-133928321 GAGGAACAGAGTAAGGGGACGGG + Intronic
1091977759 12:4839272-4839294 GAGGAGAGGAGGAAGAGGAAGGG - Intronic
1092002965 12:5046104-5046126 GAGGAAAGGAGTGAAAGGAGAGG - Exonic
1092350338 12:7751120-7751142 AAAGAAACCAGTAAGAGGCCAGG + Intronic
1092393319 12:8101390-8101412 AAAGAAAGAAGTAACAGGCCAGG + Intergenic
1092470077 12:8770174-8770196 GAGGTCAGGAGTTAGAGACCAGG - Intronic
1092910060 12:13138784-13138806 GAAGAGAGGACCAAGAGGCCAGG - Intronic
1094190603 12:27694225-27694247 GAGGACAGGAGTTTGAGACCAGG - Exonic
1094278424 12:28706782-28706804 GAGGCCAGGAGTTTGAGGCCAGG + Intergenic
1094331468 12:29298916-29298938 GAGAAAAGAAGTAAGAGGCCAGG + Intronic
1095395888 12:41761908-41761930 CAGGAAAGCATAAAGAGGCCGGG - Intergenic
1095593326 12:43930873-43930895 GAGGAAATCAGGCAGAGGCCAGG + Intronic
1095942984 12:47738427-47738449 GAGGACAGAAGGCAGAGGCCAGG + Intronic
1096271406 12:50168444-50168466 GAGGTAAGGAGTTCGAGACCAGG + Intergenic
1096324745 12:50649638-50649660 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
1096816371 12:54204283-54204305 GAAGAAGGGAGCAGGAGGCCAGG + Intergenic
1097938374 12:65278461-65278483 GAGGAGAGGAGCAGGAGGGCAGG + Intergenic
1098924686 12:76336616-76336638 GAGGCCAGGAGTTTGAGGCCAGG + Intergenic
1099027750 12:77486946-77486968 TAGGAAAGGTTTAATAGGCCAGG + Intergenic
1100953215 12:99876425-99876447 CAAGAAAGAAGAAAGAGGCCAGG + Intronic
1101010100 12:100440707-100440729 GAGGAAAGGAGGAAGAAGGAAGG - Intergenic
1101131473 12:101695610-101695632 GCAGGAAGGAGTAAGAGGACAGG - Intergenic
1101436116 12:104666111-104666133 GATTAAAAGAGAAAGAGGCCGGG - Intronic
1101473480 12:105021300-105021322 TAGGAAAGAGGTAACAGGCCAGG + Exonic
1101581113 12:106041567-106041589 TAGAAAAGGAATAAGAGGTCAGG + Intergenic
1101803117 12:108039937-108039959 GAGGAAAGGAGAGAGAGGGAGGG - Intergenic
1102232563 12:111273698-111273720 GAAGAAAGGAGCAAGACTCCAGG + Intronic
1102728104 12:115083571-115083593 GAGGAAAGAAGAAATAGGACTGG + Intergenic
1103223265 12:119264454-119264476 GAAGAAAGGAGTAATGGGGCAGG + Intergenic
1103287417 12:119814068-119814090 GATGAAAGGAGTATGAGGATAGG - Intronic
1103351200 12:120284910-120284932 GAGGACAGGAGTTCGAGACCAGG + Intergenic
1103798503 12:123521982-123522004 GAGGTCAGGAGTTTGAGGCCTGG - Intronic
1104837898 12:131803613-131803635 GAGGCCAGGAGTTCGAGGCCAGG + Intergenic
1104981343 12:132574287-132574309 CAGGAAAGGAGTGTGAGGTCCGG - Intronic
1106548139 13:30748130-30748152 GAGGTAAGGAGTTTGAGACCAGG - Intronic
1106977535 13:35238586-35238608 GAGGAACAAAGTAATAGGCCTGG - Intronic
1107056934 13:36116161-36116183 GAGGGCAGGAGTTTGAGGCCAGG - Intronic
1107172425 13:37358657-37358679 AAGGAAAGGAGTAAGAATACGGG + Intergenic
1107320197 13:39178160-39178182 GAAGTCAGGAGTACGAGGCCAGG - Intergenic
1108116633 13:47135959-47135981 GAGGAAAAGACTCAGAGGGCTGG - Intergenic
1108206488 13:48095170-48095192 CAGGAGAGGAAAAAGAGGCCTGG + Intergenic
1108297987 13:49044374-49044396 GATGAAAGAAGTCTGAGGCCGGG + Intronic
1108368198 13:49739559-49739581 CACGAAAGGAGTCAGAGGCCAGG + Intronic
1108597790 13:51964373-51964395 TGGGAAGGGAGTAAGAGGCAGGG + Intronic
1108669373 13:52668273-52668295 AAAAAAAGGAGTAATAGGCCAGG - Intronic
1109360117 13:61284311-61284333 GAGGGAAGGAGAACGAGACCTGG - Intergenic
1111968921 13:94890375-94890397 GAGGCAAGAAATATGAGGCCGGG - Intergenic
1112693263 13:101918312-101918334 GAGGAGAAAAGTAAGAAGCCCGG - Intronic
1112762076 13:102702802-102702824 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
1113222392 13:108120163-108120185 GAGGAAAGAATTAGGAGCCCAGG - Intergenic
1113539820 13:111097655-111097677 GAGGACAGGAGCAAGAGTTCTGG + Intergenic
1113801301 13:113087819-113087841 GTGGCAATGTGTAAGAGGCCAGG - Intronic
1114290839 14:21287100-21287122 GAAAAAAAGAGAAAGAGGCCAGG + Intergenic
1114396918 14:22372217-22372239 GAAGTAAGGAGTATGAGGACTGG - Intergenic
1114467831 14:22936960-22936982 AAAGAGAGGAGAAAGAGGCCAGG + Intergenic
1115274646 14:31593763-31593785 AAGGAAGTGAGTAAGAGACCAGG + Intronic
1115295819 14:31825632-31825654 AAGGAAAGGAGAAAGAGGGGAGG - Intronic
1115348055 14:32364187-32364209 GAAGAAAGGAGAAAGAAGGCAGG + Intronic
1115437549 14:33392806-33392828 GAGGAAAAGAGGGAGAGGACAGG - Intronic
1115498178 14:34027214-34027236 GAGGAGAGGAGGAAGAGGAGGGG + Intronic
1115808280 14:37076695-37076717 GAGGTCAGGAGTTCGAGGCCTGG - Intronic
1115814319 14:37146458-37146480 GAGGTCAGGAGTTAGAGACCAGG - Intronic
1116134736 14:40907954-40907976 GAGGTCAGGAGTTAGAGACCAGG - Intergenic
1116697689 14:48198996-48199018 AAGGAGAGGAGAAAGAGGTCAGG - Intergenic
1116828372 14:49693510-49693532 GCGGAGAGTGGTAAGAGGCCCGG - Intronic
1116875113 14:50103506-50103528 GAGGAATTGAGTAAGGGTCCAGG + Intergenic
1117231811 14:53727233-53727255 AAGGAAAGGAGAAAGAGAACAGG + Intergenic
1118656432 14:67954941-67954963 GATCAGAGGAGTAAGAGGACAGG + Intronic
1118979100 14:70701696-70701718 GGGGAAAGGAGGAAGAGGAGGGG + Intergenic
1119164047 14:72477579-72477601 GAGGTAAGGAGTTTGAGACCAGG + Intronic
1119388875 14:74276670-74276692 GAGCAGTGGAGTCAGAGGCCTGG - Intergenic
1119683560 14:76611807-76611829 GAGGAAAGAAGCAAGGGGCACGG + Intergenic
1119707485 14:76793350-76793372 GAGGAGAGGAGAAAGAGGAGAGG + Intronic
1120646527 14:87081168-87081190 GAGGAAAGGAGCAGGATGCTCGG - Intergenic
1121037884 14:90721692-90721714 GAAGACAGGAGCAAGAGGACAGG + Intronic
1121573733 14:94966742-94966764 GTGGAAAGGTGTGAGAGGACTGG + Intergenic
1121648387 14:95536261-95536283 TAGGGGAGGAGGAAGAGGCCAGG + Intronic
1121791293 14:96701625-96701647 GGGGCAAGCAGGAAGAGGCCAGG - Intergenic
1121853442 14:97245070-97245092 GAGAGAAGGAGGAAGAGGCACGG - Intergenic
1121854467 14:97254189-97254211 GAGGAAGGGAGGCAGATGCCTGG - Intergenic
1122982601 14:105198407-105198429 GAGGAAAGGCGTGACAGGCAGGG + Intergenic
1123705368 15:22947366-22947388 GCGGGAAGGGGTTAGAGGCCTGG - Intronic
1124359550 15:29025736-29025758 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
1124718038 15:32085040-32085062 GAGGTCAGGAGTTCGAGGCCTGG - Intronic
1124724816 15:32147250-32147272 GGGGAAAGGAGAAGGGGGCCAGG + Intronic
1124924357 15:34056801-34056823 GAGGCCAGGAGTTCGAGGCCAGG + Intronic
1125410174 15:39397896-39397918 CAGAAAAGGTGTAAGATGCCTGG - Intergenic
1125686102 15:41564288-41564310 GAGGAAGGGTGGATGAGGCCAGG + Intronic
1126428074 15:48550783-48550805 GAGGGAAGGAGTAAGTCGTCAGG - Intronic
1126802996 15:52317750-52317772 GATGAAAGGAGAGAGAGGCAAGG + Intronic
1127494566 15:59497640-59497662 GAGGCCAGGAGTTTGAGGCCAGG + Intronic
1127494569 15:59497654-59497676 GAGGCCAGGAGTTTGAGGCCAGG + Intronic
1127499826 15:59545340-59545362 GAGGTAAGGAGTTCGAGACCAGG + Intergenic
1127588350 15:60398245-60398267 GAGGAAAGGAGGAAGAAACGGGG - Intronic
1127857680 15:62966208-62966230 GGGGAAAGGAGAAAGTGCCCAGG - Intergenic
1127904755 15:63368376-63368398 AAGGAAGAGAGTAACAGGCCAGG + Intronic
1127986264 15:64073814-64073836 GAGGGAAGGAGTTTGAGGCCAGG - Intronic
1128579545 15:68799314-68799336 GAAGAAAGGAGTTGGAGGCTTGG + Intronic
1128780692 15:70357003-70357025 TAGGAGATGAGTCAGAGGCCAGG - Intergenic
1129140690 15:73595292-73595314 AAGGAAAGGAGCAAGGGGGCAGG + Intronic
1129164860 15:73771167-73771189 GAGGCCAGTTGTAAGAGGCCTGG - Intergenic
1129248086 15:74292189-74292211 GAGGAAAGGAGAGCGAGGCAAGG + Intronic
1130317412 15:82808731-82808753 GAGGAAAGGAGGGAGATGCCAGG - Intergenic
1130420225 15:83738596-83738618 GAAGAATGAAATAAGAGGCCAGG + Intronic
1132090374 15:98943366-98943388 GAGGAAAAGAGAAAGAAGGCAGG - Intronic
1132169856 15:99639244-99639266 AAGGAAAGTAGGAAGAGACCAGG - Intronic
1132427364 15:101729931-101729953 GAGGAAAGGTATTAGAGGTCGGG - Intergenic
1132836274 16:1954827-1954849 GAGGAAAGGAGTGCCAGCCCTGG - Intronic
1133014737 16:2934115-2934137 GGGCCAAGGAGTAGGAGGCCAGG - Intronic
1133075345 16:3276072-3276094 GAGGTCAGGAGTTCGAGGCCTGG + Intronic
1134122764 16:11596600-11596622 GAGGAAAGGAGGAAGGGGAGAGG + Intronic
1134242727 16:12517778-12517800 GAAGAAAGGAGAATGAGGACTGG + Intronic
1134287169 16:12872001-12872023 GAGGAAAGGAGGAAGAAGGGAGG - Intergenic
1134332349 16:13262706-13262728 AAGGAAAGAAGGAAGAGGCAGGG + Intergenic
1134872484 16:17664502-17664524 GAGGAAGAGAGGAAGAGGCTTGG - Intergenic
1135147623 16:19976486-19976508 GAGGACAGGAGTTTGAGACCAGG - Intergenic
1135267281 16:21038285-21038307 GAGGCCAGGAGTCCGAGGCCAGG + Intronic
1135684179 16:24484901-24484923 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
1135907605 16:26527448-26527470 CAGGAAAGGACTAAGATACCAGG + Intergenic
1136340303 16:29638679-29638701 GAGAAAAAAAGAAAGAGGCCAGG + Intergenic
1137801043 16:51262213-51262235 GAGGAAAGCAGGAAGAAGACAGG - Intergenic
1138088075 16:54152153-54152175 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1139303113 16:65961993-65962015 GAGGAAGGGAGAAAGAGGGAGGG + Intergenic
1139307619 16:66000854-66000876 GAGGAAAGGGGTGAGAAGACAGG - Intergenic
1139685063 16:68597029-68597051 AAGGAAAGGAGGAAAAGGACTGG + Intergenic
1139725553 16:68894672-68894694 GAGGTAAGTATTGAGAGGCCAGG + Intronic
1139753390 16:69123052-69123074 GAAGAAAAAAGTAAGAGGCCGGG - Intronic
1139833740 16:69821622-69821644 TAGAAAAGGAGTAAGAGGAAAGG - Intronic
1140519294 16:75567529-75567551 GGGGAAAGGAGTAGGAGGGACGG + Intronic
1142765444 17:2061655-2061677 GAGGACAGGAGGCAGAGGGCTGG + Intronic
1143368422 17:6423227-6423249 GAAAAAAGGAAGAAGAGGCCGGG + Intronic
1144565762 17:16357867-16357889 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1144588034 17:16500495-16500517 CAGAAAAGGAGGAGGAGGCCGGG + Intergenic
1144864623 17:18327232-18327254 GTGGAAAGGAGGAGGAGGCAGGG + Intergenic
1145884515 17:28372742-28372764 GAGGAATGGAGTTACAGGACAGG + Intronic
1146097890 17:29950143-29950165 GAGGAGAGGAGGAAGAGGAAGGG - Intronic
1146156641 17:30529977-30529999 ATGTAAAGGAGAAAGAGGCCTGG + Intergenic
1146488414 17:33262341-33262363 GAGAAAAGGAGGAAGAGGGAGGG + Intronic
1146526318 17:33569977-33569999 GAGGAAAGGAGAAAGAGGGCGGG - Intronic
1146570925 17:33951887-33951909 TAAGAAAGGAGGAAGAGACCAGG - Intronic
1146948445 17:36889960-36889982 GAGGGAGGGAAGAAGAGGCCTGG - Intergenic
1147242384 17:39099033-39099055 GAGGGAAGGAGGACGAGGCTGGG + Intronic
1148070093 17:44903710-44903732 GAGGAAAGGATTATGCAGCCAGG - Exonic
1148131027 17:45262669-45262691 GCGGAAAGGGTTAAGAGTCCAGG + Intergenic
1148193586 17:45697604-45697626 GAGGAAATGAGTTGGAGGTCTGG + Intergenic
1148862889 17:50613800-50613822 AAGGAAGGAAGGAAGAGGCCCGG + Intronic
1149181141 17:53938338-53938360 GAGGACAAGAGTTAGAGACCTGG + Intergenic
1149274714 17:55020602-55020624 GAGGAAAGGAGTTCGAGACTAGG + Intronic
1149319068 17:55466534-55466556 GAGGAAAGGAATATGATGTCTGG - Intergenic
1149480112 17:56996498-56996520 AAAGAAAGGAAAAAGAGGCCAGG - Intronic
1149749360 17:59130021-59130043 GAGGAAGAGAGAAAGAGGCGGGG + Intronic
1150917302 17:69449906-69449928 GAGAAAGAGAGAAAGAGGCCGGG - Intronic
1151272490 17:73007679-73007701 GAGGGAAGGAGGGAGGGGCCAGG + Intronic
1151362964 17:73599611-73599633 GAGGAAAGGGGGAAGAGGAAAGG + Intronic
1151705435 17:75764770-75764792 GAGGAAGCGAGGAAGTGGCCGGG - Intronic
1151851105 17:76690412-76690434 GAAAAAAAAAGTAAGAGGCCAGG + Intronic
1152191870 17:78893012-78893034 AAGGAAAGGAGGAAGAGACGGGG + Intronic
1152336624 17:79702829-79702851 GAGGGAAGGAGGAGGAGGCCAGG - Intergenic
1152390637 17:80001849-80001871 GAGGAAGGGAGCAGGAGGCGGGG - Intronic
1152742475 17:82024388-82024410 GAGGAGAGGTGGAAGATGCCAGG + Intronic
1152845637 17:82597968-82597990 GAGAACAGTAGTGAGAGGCCTGG - Intronic
1153155854 18:2148022-2148044 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1154290373 18:13101613-13101635 GAGGCAAGGAGCTAGAGGGCAGG - Intronic
1156426978 18:37024294-37024316 AAAGAAAGGAATAACAGGCCAGG - Intronic
1156544513 18:37950362-37950384 GAGGAAAGGAAGAAAAGGTCTGG + Intergenic
1157107974 18:44792636-44792658 GAGGAGAGGTGGAAGTGGCCGGG - Intronic
1157471874 18:47995088-47995110 GAGGTCAGGAGTTAGAGGTCAGG + Intergenic
1157765941 18:50297829-50297851 GAGGAAGGGAGTTAGTGACCTGG - Intergenic
1158423160 18:57313636-57313658 GAGGAAAGGAGGAAGAAGAGAGG + Intergenic
1158820227 18:61150724-61150746 GCAGAAAGGAGTGAGAGGGCTGG + Intergenic
1160287839 18:77562147-77562169 AAGGAAAGGAGCTAAAGGCCAGG + Intergenic
1160406148 18:78647471-78647493 GAGGGAAGGACAAAGAGGCCTGG + Intergenic
1160559415 18:79746841-79746863 GAGGCCAGGAGTTTGAGGCCAGG - Intronic
1160702890 19:517193-517215 GAGGAAAGGAGTTAGGGGTCAGG + Intronic
1161033735 19:2072517-2072539 TAGGAAATGAGTCAGAAGCCGGG + Exonic
1161450815 19:4344307-4344329 GAGGAAGGGAGACTGAGGCCTGG + Intronic
1161470981 19:4456698-4456720 GGGGAAAGGAGATAGATGCCGGG - Intronic
1161700711 19:5793481-5793503 GAGGACAGAAGGAGGAGGCCAGG + Intergenic
1162020161 19:7864666-7864688 GGGGAAGGGAGGAAGGGGCCTGG - Intronic
1162296021 19:9814210-9814232 GAGAAAATGAGAAAGAAGCCCGG + Intronic
1162717058 19:12640787-12640809 GAGAAAAGGAAAAAGAGGCCGGG + Intergenic
1163061259 19:14763875-14763897 GAGGACAAGAGGAAGAGGACGGG - Intronic
1163090576 19:15016991-15017013 GAGGCCAGGAGTTTGAGGCCAGG + Intronic
1163390464 19:17027151-17027173 GAGGGAGGGAGGGAGAGGCCAGG - Intergenic
1163871140 19:19822176-19822198 GAGGACAGGAGTTTGAGACCAGG - Intergenic
1164249711 19:23466199-23466221 GAGGAGAGGAGGAATAGGACAGG - Intergenic
1164290720 19:23866624-23866646 CAGGAAATGAGAAGGAGGCCTGG + Intergenic
1164324437 19:24179572-24179594 GAGGAAAGAAGAAAGAGGAGAGG + Intergenic
1164324440 19:24179594-24179616 GAGGAAAGAAGAAAGAGGAGAGG + Intergenic
1164412249 19:28015680-28015702 GAGGAAAGGATGGGGAGGCCAGG - Intergenic
1165049205 19:33130997-33131019 GCAGAAAGAAGGAAGAGGCCGGG + Intergenic
1165078975 19:33297013-33297035 AAAGAAAGGAAAAAGAGGCCTGG + Intergenic
1165229204 19:34376208-34376230 GAGGCCAGGAGTTAGAGACCAGG + Intronic
1166034980 19:40161490-40161512 AAGGAAAGGAGTAATAGGTTCGG + Intergenic
1166318022 19:41999371-41999393 GAGGAAAGGAGGAGGAGGAGTGG - Intronic
1166955836 19:46464252-46464274 GAGGTGAGGAGCAAGAGGGCAGG - Intergenic
1166996467 19:46721929-46721951 GAGAAGGGGAGGAAGAGGCCTGG - Intronic
1167055252 19:47106680-47106702 GAGGAAGGGAATACGAAGCCTGG + Intronic
1167154157 19:47728192-47728214 GAGGAAAGGAGTGAGAGAAGGGG - Intronic
1167189471 19:47974481-47974503 GAGGTAAGGAGTTTGAGACCAGG - Intronic
1167273284 19:48518844-48518866 GAGGTCAGGAGTTTGAGGCCAGG - Intergenic
1167328248 19:48837806-48837828 GAGGAGGGGAGGAAGAGGTCAGG - Intronic
1167433056 19:49464278-49464300 GAGGAGAGGAGTGAGCGCCCGGG - Intronic
1167687566 19:50966193-50966215 GAGGGAAAGAGAAACAGGCCGGG - Intronic
1167789364 19:51663511-51663533 GAGAAAAGAAGAATGAGGCCGGG - Intergenic
1168015265 19:53567953-53567975 AAGGAAAGAAGTACGTGGCCAGG + Intronic
1168125947 19:54282939-54282961 GAGGCATGGGGGAAGAGGCCCGG - Intergenic
1168347931 19:55659967-55659989 GAGGAAAGGAGAAAGGGGCCAGG - Intronic
1202697372 1_KI270712v1_random:134928-134950 AAGGAAAGGAGAAAGAGGGAAGG - Intergenic
1202712084 1_KI270714v1_random:24278-24300 GAGGGAAGGAGAAGGAGGCTCGG + Intergenic
925576288 2:5363744-5363766 GAGGTAAGGAGTTTGAGACCAGG - Intergenic
926425798 2:12737422-12737444 GAGGAAAGGAGGAGGAAGGCGGG - Intronic
926599522 2:14826848-14826870 GAGAAAAGTAGTCAGAGGCAGGG - Intergenic
926689658 2:15724616-15724638 GAGGAGAGGAGGAAGAGACTGGG + Intronic
927706513 2:25299541-25299563 GAGGCCAGGAGTCAGGGGCCTGG + Intronic
927859920 2:26554238-26554260 GATGGAAGGAGTAAGAGCCAAGG + Intronic
927947810 2:27147886-27147908 GAGAAAGGGAAAAAGAGGCCGGG - Intergenic
927981780 2:27378916-27378938 GAGGCCAGGGGTGAGAGGCCAGG - Exonic
928946964 2:36780207-36780229 TAGGACAGGAGCAAGAGGCTTGG + Intronic
929099994 2:38302296-38302318 GAGTAAAGGAGACAAAGGCCAGG + Intronic
929199065 2:39216343-39216365 GGGGAAAGCAGTATGAGGCCAGG + Intronic
929406627 2:41649939-41649961 GAGGAAAGGAGCAAGAGAAAAGG + Intergenic
929599549 2:43196594-43196616 GTTGAAAGGAGAAAGGGGCCAGG - Intergenic
930096576 2:47570688-47570710 CTGGAGAGGAGTATGAGGCCCGG - Exonic
930133285 2:47874746-47874768 GAGGCCAGGAGTTAGAGACCAGG - Intronic
930798857 2:55421515-55421537 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
931376840 2:61715561-61715583 GAGGCCAGGAGTTCGAGGCCAGG - Intergenic
931520879 2:63096189-63096211 GAAGAAAGAAGAGAGAGGCCGGG + Intergenic
931559674 2:63546334-63546356 GAGGAAAGAAGACAGAGTCCAGG + Intronic
932127384 2:69156379-69156401 AAGGAAAGGAGGAAGATGCTGGG - Intronic
932164070 2:69489942-69489964 TTGGAAATGAGGAAGAGGCCAGG + Intronic
932165081 2:69498496-69498518 GAGGTGGGGAGAAAGAGGCCCGG - Intronic
932181699 2:69652217-69652239 GAGGTGAGGAGTTCGAGGCCAGG - Intronic
932292246 2:70591730-70591752 GAGGCCAGGAGTTCGAGGCCAGG - Intergenic
932420670 2:71599576-71599598 GGAGAAGGGAGTATGAGGCCAGG + Intronic
934278540 2:91591953-91591975 AAGGAAAGGAGAAAGAGGGAAGG - Intergenic
934868791 2:97840427-97840449 GTCTAACGGAGTAAGAGGCCAGG + Intronic
935152292 2:100449096-100449118 GAGGCAGGGAGGAAGAAGCCAGG - Intergenic
935504540 2:103883719-103883741 AAGGAAGTGAGCAAGAGGCCAGG + Intergenic
935594904 2:104870754-104870776 TGGGATAGGAGGAAGAGGCCTGG - Intergenic
936145775 2:109979963-109979985 GAGGAAAGGAGAAAGAGAGGAGG - Intergenic
936198914 2:110391515-110391537 GAGGAAAGGAGAAAGAGAGGAGG + Intergenic
936770946 2:115912579-115912601 GAGGTCAGGAGTACGAGACCAGG + Intergenic
937182810 2:120011717-120011739 GAGGAAAGGGGTAAGATGTAGGG - Intergenic
937228247 2:120382098-120382120 GAGGAAGGATGAAAGAGGCCTGG + Intergenic
937257185 2:120563964-120563986 GAGGAAAGGAGGTGGAGACCTGG + Intergenic
937462920 2:122104780-122104802 GAGAAAAGGAGCAAGAGACAGGG + Intergenic
937690110 2:124745879-124745901 GAGGTAAGTAGGAAGAGACCAGG - Intronic
937790680 2:125957808-125957830 CAGGAAAGGTGGAGGAGGCCTGG - Intergenic
938593585 2:132764072-132764094 GAGGAAAGGAGTCATAGACTAGG + Intronic
939322526 2:140642544-140642566 TAGGAAGGGACTAAGAGGCCGGG + Intronic
940168589 2:150802272-150802294 GAGAAAAAGAGTCAGAGACCGGG - Intergenic
940434622 2:153636690-153636712 TAGGAAAGCAGTAAGAGCCCTGG - Intergenic
940856297 2:158730905-158730927 GGGGTGAGGAGTGAGAGGCCAGG - Intergenic
941023545 2:160436245-160436267 GAGGAGAGGAATAAGCTGCCAGG - Intronic
941414340 2:165200734-165200756 AAGGGAAGGATTAGGAGGCCTGG + Intronic
941657909 2:168164226-168164248 AAAGAAAGGAGTATGAGGCCAGG + Intronic
941787594 2:169515326-169515348 AAGGAAAAGAGGAAGAGACCGGG - Intronic
942006804 2:171710676-171710698 GAAAAAAGGAACAAGAGGCCTGG - Intronic
942033308 2:171985908-171985930 CAGGGAAAAAGTAAGAGGCCGGG - Intronic
942290792 2:174468098-174468120 GAGGAAAGAAGGAAGTCGCCAGG - Intronic
942897027 2:181069595-181069617 TAGGAGAGGAATAGGAGGCCAGG + Intronic
943166113 2:184328024-184328046 GAGGTATGGAGGAAGAGGCGCGG - Intergenic
944382971 2:199132866-199132888 GTAAAAAGGAGTAAGAGGCCGGG - Intergenic
944729996 2:202506369-202506391 GAGGTAAGGAGTTTGAGACCAGG - Intronic
944758954 2:202793357-202793379 TAAGAAATGAATAAGAGGCCGGG + Intronic
945121860 2:206465251-206465273 AAGGCAAGGAGTTTGAGGCCAGG - Intronic
945162447 2:206906424-206906446 GAGAAAAGGAGTCACAGGGCAGG + Intergenic
946053110 2:216880443-216880465 GAGGAAAGGGGCAGGAGGCCTGG + Intergenic
946163046 2:217847681-217847703 CAGGCAAGGAGGAAGAGGCTGGG + Exonic
946224871 2:218259088-218259110 GAGGAAAGGAGAATGGGGTCCGG + Intergenic
946290530 2:218741174-218741196 GAGGCCAGGAGTTAGAGACCAGG + Intronic
947401793 2:229737920-229737942 GAGGAAAGGAGAAAGAGAAGGGG + Intergenic
947799748 2:232921344-232921366 GAGGAAAGGGGTCAGACCCCAGG + Intronic
948856292 2:240732067-240732089 GAGGGAAGGAGGAAGAGGGGAGG + Intronic
1169011410 20:2254030-2254052 GAGGCCAGGAGTTCGAGGCCAGG - Intergenic
1169049011 20:2560540-2560562 CACTAAAGGAGTCAGAGGCCGGG + Intronic
1169532097 20:6496297-6496319 AAGGAAATGGGTAGGAGGCCAGG - Intergenic
1170556744 20:17520860-17520882 GTGGAAAGCAGCAAGAGGCCAGG - Intronic
1170735383 20:19009683-19009705 GAGGAAGGGAGAAAGAGGGGAGG - Intergenic
1170881198 20:20297722-20297744 AAAGAAAGAAGTAAAAGGCCAGG - Intronic
1172027407 20:31958249-31958271 GAGGTAAGGAATTAGAGACCAGG + Intergenic
1172161744 20:32873495-32873517 GAAGAAAGGAGGAACAGGCAAGG - Intronic
1172609144 20:36236517-36236539 CAGGAAAGGAAAAAGAGGCCAGG - Exonic
1172644870 20:36462728-36462750 GGGGAAAGGAGGGAGGGGCCAGG + Intronic
1172750712 20:37249076-37249098 GAGGTCAGGAGTACGAGACCAGG + Intergenic
1172863989 20:38080736-38080758 GAGGTAAGGAGTTCGAGACCAGG - Intronic
1172899200 20:38321435-38321457 AAGGAAAGGAGTACCAGGCAGGG - Intronic
1173610205 20:44361580-44361602 GAGGTCAGGAGTTAGAGACCAGG + Intronic
1173656055 20:44701042-44701064 AAAGAAAGGAGTGAGAGGCTGGG - Intergenic
1173657120 20:44707120-44707142 GATGAAAGAAGTATGAGGCAAGG + Intergenic
1173703585 20:45094172-45094194 GAGGGAAGGAGGATGAGTCCTGG - Exonic
1173965413 20:47108897-47108919 GAGGAGAGTAGAAAGTGGCCAGG + Intronic
1174301563 20:49585953-49585975 GGAGAAAGTAGTCAGAGGCCAGG + Intergenic
1174369556 20:50077472-50077494 GAGGGGAGGTGCAAGAGGCCAGG + Intergenic
1174451244 20:50621919-50621941 GATTATAGGAGTACGAGGCCAGG + Intronic
1175095593 20:56539046-56539068 GAGGTCAGGAGTCAGAGACCAGG - Intergenic
1175821869 20:61914358-61914380 GAGGAAAGGAGAAAAAAGCGGGG - Intronic
1177836875 21:26194344-26194366 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1177883226 21:26718791-26718813 GGGGAAGGGACTAGGAGGCCTGG - Intergenic
1178006375 21:28225238-28225260 GAGGAAGGGAGAAAGAGGGAGGG + Intergenic
1178302334 21:31463520-31463542 TAAAAAAGAAGTAAGAGGCCGGG + Intronic
1178904386 21:36624453-36624475 GAGAAAAAGAGCAAGAGGGCTGG + Intergenic
1179151247 21:38810159-38810181 GAGGAAAGAAAAAAAAGGCCTGG + Intronic
1179270249 21:39845202-39845224 GAGGACAGGAGGACCAGGCCTGG + Intergenic
1179270283 21:39845364-39845386 GAGGACAGGAGGACCAGGCCAGG + Intergenic
1179440572 21:41390708-41390730 GAGGAAAGAACCAAGTGGCCGGG + Intronic
1179882525 21:44299591-44299613 GAGGAAAGGAGGGAGAGGGAGGG + Intergenic
1180179938 21:46113636-46113658 GAGGCCAGGAGTTAGAGACCAGG - Intronic
1180209263 21:46284701-46284723 GAGGAAAAGAGAAAGGGGCCAGG + Exonic
1180789987 22:18570562-18570584 CAGGCAAGGAGAATGAGGCCTGG + Intergenic
1181078165 22:20395046-20395068 GAAGAAAGAAGCAGGAGGCCAGG - Intronic
1181130440 22:20728462-20728484 AGGAAAAGGAGTAAGAGGCAGGG - Intronic
1181231752 22:21424753-21424775 CAGGCAAGGAGAATGAGGCCTGG - Intronic
1181246899 22:21510115-21510137 CAGGCAAGGAGAATGAGGCCTGG + Intergenic
1181637111 22:24179667-24179689 GAGGAAAGGCGTAAAGGGCTGGG + Intergenic
1182456590 22:30455659-30455681 TGGGGAAGGAGTAAGAGGCAGGG + Intronic
1182476458 22:30579173-30579195 CAGAAAAGGAGGAAGAGGCCCGG - Exonic
1182482177 22:30616186-30616208 TAAGAATGGAGAAAGAGGCCAGG + Intronic
1182601531 22:31468606-31468628 GAGGTTAGGAGTTAGAGACCTGG - Intronic
1183100950 22:35583673-35583695 GAGGAAGGGAGGAAGAAGGCTGG + Intergenic
1183162819 22:36126435-36126457 GAGGAAAGGAGGGAGAGGAAGGG - Intergenic
1183464407 22:37972500-37972522 GAGGCAAGGGGTAAGAGGCAAGG + Exonic
1183520970 22:38295830-38295852 GAGGTCAGGAGTTAGAGCCCCGG - Intronic
1183571481 22:38656588-38656610 GAGGAAAGGGGTAACCGGCGCGG - Intronic
1183594683 22:38803555-38803577 GAGAGAAAGAGAAAGAGGCCGGG - Intergenic
1183782398 22:40007264-40007286 GAGGAAAGGAGGAAGAGAGGAGG - Intronic
1183791761 22:40077078-40077100 GAGGAGAGGAGAAAGAGGGAGGG + Intronic
1183836735 22:40460542-40460564 GATTAAAGAAGTAAGAGGCATGG - Intronic
1184365325 22:44047445-44047467 GAGGTCAGGAGTTGGAGGCCAGG + Intronic
1184686502 22:46098762-46098784 GGGGCAAGGAGCAGGAGGCCGGG - Intronic
949121175 3:386073-386095 GCGGAAAGGAGTTAGACTCCAGG + Intronic
949966636 3:9362375-9362397 GAGGTCAGGAGTTTGAGGCCAGG - Intronic
950445647 3:13035996-13036018 GAGGAAGGGAGTGAGTGGCTGGG + Intronic
950512987 3:13444306-13444328 GAGCTCAGGAGTTAGAGGCCAGG - Intergenic
950593406 3:13956046-13956068 GAGGAAGGGAGGGAGAGGCTGGG - Intronic
950753007 3:15145730-15145752 AAGGAACGTAGTAAGAGGGCAGG + Intergenic
950761739 3:15235939-15235961 GAGGCCAGGAGTTCGAGGCCAGG + Intronic
952125970 3:30301125-30301147 GAGGAAAGGAGTTGGTGGGCAGG + Intergenic
952367678 3:32689137-32689159 GAGGACAGGAGTTTGAGACCAGG + Intronic
952715753 3:36478848-36478870 GAGGCCAGGAGTTTGAGGCCAGG - Intronic
952742783 3:36750293-36750315 GAGGACAGGAGTTTGAGACCAGG - Intergenic
952859463 3:37800935-37800957 GAGGCCAGGAGTTCGAGGCCAGG + Intronic
952881976 3:37991102-37991124 GGGGAAAGGAGGATGGGGCCAGG - Intronic
953044319 3:39281386-39281408 GAGGAGGGGAGTCAGAGGCAAGG - Intronic
953243804 3:41172766-41172788 GAGAAAAGGAGGAAGAAGGCAGG - Intergenic
953244934 3:41182531-41182553 GGTGAAAAGAGTAAGAGGCCAGG + Intergenic
953349257 3:42202440-42202462 GATGAGCGGAGTAAGAAGCCGGG + Exonic
953360357 3:42290437-42290459 GAGGAAAGGAGAAAGAGGGATGG - Intergenic
953928369 3:46993778-46993800 GGGGCAAGGAGTAGAAGGCCTGG + Intronic
954088257 3:48264237-48264259 GAATAAAGAAGGAAGAGGCCGGG + Intronic
954714485 3:52520313-52520335 GATGAAGGGAGTAGGAGGCAGGG + Intronic
954834916 3:53457807-53457829 GAGGTCAGGAGTTTGAGGCCAGG - Intergenic
954878580 3:53819233-53819255 GAGCCATGGAGTATGAGGCCAGG - Intronic
955875209 3:63482024-63482046 GAGGAAAAGACTGAGAGTCCTGG - Intronic
956442541 3:69294606-69294628 TGGGAAAGGAGCAAGAGGGCAGG - Intronic
956484232 3:69704457-69704479 GAGGCCAGGAGTTAGAGGCCAGG + Intergenic
956796481 3:72722879-72722901 AAGGAAAGGAGTAAGAGGTGTGG + Intergenic
958427656 3:93997771-93997793 GAGGACAGGAGTTCGAGACCAGG + Intronic
958653740 3:96974891-96974913 GAGGAAATGAGAACAAGGCCCGG + Intronic
959249921 3:103928605-103928627 GAGGAAAAGAGCAAGAGAGCTGG + Intergenic
959406425 3:105966747-105966769 GAGGAAAGGCCTCAGAGGCAGGG - Intergenic
959637501 3:108591700-108591722 AAGAAAAGGAGCAGGAGGCCAGG + Intronic
959720299 3:109479458-109479480 GAGGTAGGCAGTTAGAGGCCTGG + Intergenic
960977329 3:123187927-123187949 GGGGTGAGGAGTCAGAGGCCAGG - Intronic
961624892 3:128255048-128255070 GAGGCCAGGAATTAGAGGCCAGG + Intronic
962357615 3:134708390-134708412 GAGGAAATGAGCAAGAAGTCTGG + Intronic
963268456 3:143262072-143262094 GGGGAAAGGAGGAAGAGGCATGG - Intergenic
963272848 3:143302625-143302647 GAGGAAAGCAGTAAAGAGCCAGG + Intronic
963338497 3:144004639-144004661 GAGGCCAGGAGTTCGAGGCCAGG - Intronic
963859798 3:150297450-150297472 GAGGATAAGAGGGAGAGGCCAGG - Intergenic
963988601 3:151627230-151627252 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
964752565 3:160065799-160065821 GAGGCCAGGAGTTCGAGGCCAGG + Intergenic
966274827 3:178152817-178152839 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
966605195 3:181814483-181814505 GTTAAAAGGAGTAAGAAGCCAGG - Intergenic
966663540 3:182444378-182444400 GAGGACAGGAGTTCGAGACCAGG - Intergenic
966827708 3:183979045-183979067 AAGGGAGGGACTAAGAGGCCAGG + Intronic
967058055 3:185847532-185847554 GGGTAAAGAAGTGAGAGGCCGGG - Intergenic
967828753 3:193900767-193900789 GAGCAAAGAGGTCAGAGGCCTGG + Intergenic
968186374 3:196635709-196635731 AAAGAAAGGAGGAGGAGGCCGGG - Intergenic
968234614 3:197024250-197024272 AAGGAAAGGAGGGGGAGGCCTGG + Intronic
968932263 4:3587364-3587386 GAGGACAGGAGTGCCAGGCCTGG - Intronic
969319520 4:6403347-6403369 GAAGCGAGGAGGAAGAGGCCAGG - Intronic
970300853 4:14680063-14680085 AAGGAAAGGAGTCAGAGGAAAGG + Intergenic
971444863 4:26732361-26732383 GAGGGAAGGAGGACAAGGCCAGG - Intronic
971762290 4:30781829-30781851 AAGAAAAGGAGATAGAGGCCAGG - Intronic
972335287 4:38102469-38102491 GAAGAAGGGAGGAAGGGGCCAGG + Intronic
973760103 4:54107835-54107857 GAGGAAAGGAGGAAGGTGGCTGG - Intronic
974068495 4:57102552-57102574 GAGGACAGCATTAAAAGGCCTGG - Intronic
974411046 4:61541010-61541032 GAGGTAAGGAGCCAGAGGCTTGG + Intronic
974442575 4:61939390-61939412 GAGGAGAGGAATAAGAAGACTGG - Intronic
976199597 4:82564985-82565007 ATAAAAAGGAGTAAGAGGCCGGG - Intergenic
976208021 4:82640307-82640329 GGGGTAAGGAGGAAAAGGCCCGG + Intronic
976277768 4:83294839-83294861 GAGGACAGGAGTTCGAGGACAGG + Exonic
976322958 4:83736310-83736332 GAAGAAAGGAGGGAGAGGCCAGG - Intergenic
977175232 4:93811812-93811834 GAGGAAAGGAATAAGCTACCAGG + Intergenic
977253322 4:94712785-94712807 GAGGCCAGGAGTTTGAGGCCAGG + Intergenic
978406676 4:108386453-108386475 CAGGAGAGGAGAAAGAGGACAGG + Intergenic
978648328 4:110969426-110969448 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
980033210 4:127854405-127854427 GAGGAAAGAAGTAAAAGGTGAGG - Intergenic
980264628 4:130499377-130499399 GAGGAAAGGAGAAAGCAGGCAGG - Intergenic
980999654 4:139816541-139816563 GAGGAAAGGAGGAACAGACGGGG + Intronic
981193511 4:141891378-141891400 GAGGAAAAGAGAAAGTGGGCAGG + Intergenic
982421466 4:155204002-155204024 GAGGAAGGGAGGAAGAGCACAGG - Intergenic
982481330 4:155914986-155915008 GAGGAAGAGAGAAAGAGGGCAGG - Intronic
983525676 4:168758372-168758394 GAAGACAGGAGAAAGAGGACAGG - Intronic
984329285 4:178294763-178294785 GAGGTAAGGAGTTCGAGACCAGG - Intergenic
984481055 4:180302458-180302480 GAGGTCAGGAGTTAGAGACCAGG + Intergenic
985728407 5:1527737-1527759 GAGTAAAGGAGTACGCGGACCGG - Intergenic
985814782 5:2118647-2118669 GAGGAAAGGAGCGAGAGGGGAGG - Intergenic
985871941 5:2564121-2564143 AAGGAGAGGAGAAGGAGGCCCGG - Intergenic
985916455 5:2922368-2922390 GAAGAAAGGAGAAACTGGCCAGG - Intergenic
985936649 5:3102641-3102663 GATCAAAGGCCTAAGAGGCCGGG - Intergenic
986221749 5:5774826-5774848 GAGGAAAGGAGGAGGAGGGGAGG - Intergenic
986504422 5:8433881-8433903 GAGGACTGCAGTCAGAGGCCAGG - Intergenic
987001708 5:13666674-13666696 CAGGCAAGGAGTAAGATACCAGG + Intergenic
987360590 5:17103013-17103035 TAAAAAAGGAGAAAGAGGCCGGG - Intronic
987631517 5:20478522-20478544 GAGGAAAGGAGAGAGAAGACTGG + Intronic
987688938 5:21242700-21242722 GTAGAAAGAAATAAGAGGCCAGG + Intergenic
987745275 5:21962999-21963021 TAGGAAAGGAAAAAGAGGCATGG - Intronic
988063046 5:26198202-26198224 AAGGAATGTAGTAAGAGGGCAGG - Intergenic
988752451 5:34203470-34203492 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
990881016 5:60539546-60539568 GACAAAAGGAGGAAGAGGACAGG - Intergenic
991740218 5:69664282-69664304 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
991757280 5:69888888-69888910 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
991765477 5:69973118-69973140 TAGGAAAGGAAAAAGAGGCATGG - Intergenic
991781845 5:70145039-70145061 TAGGAAAGGAAAAAGAGGCATGG + Intergenic
991791793 5:70244023-70244045 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
991819681 5:70540399-70540421 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
991836683 5:70764770-70764792 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
991844713 5:70848190-70848212 TAGGAAAGGAAAAAGAGGCATGG - Intergenic
991874288 5:71145350-71145372 TAGGAAAGGAAAAAGAGGCATGG + Intergenic
991884242 5:71244361-71244383 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
991902014 5:71470140-71470162 GAGGACAAGAGTTAGAGACCAGG - Intronic
991902796 5:71477140-71477162 AAGGAAAGGAAAAAGAGGCTGGG - Intronic
992030976 5:72721327-72721349 GAGGAAAGGGTTAAGAGGGAGGG - Intergenic
993279509 5:85907734-85907756 GAGGTAAGGTGGAAGAGGCTTGG + Intergenic
994628529 5:102252005-102252027 GAGAAAAGGAGAAAGAGGGAGGG + Intronic
995327776 5:110911084-110911106 GAGGAAAGAAGAAAGAGGAGGGG + Intergenic
996082218 5:119268753-119268775 GAGAAAAGGAGGCAGAGGCCAGG - Intronic
996164733 5:120210834-120210856 GAAGAAAGGAGTTACAGGCCGGG - Intergenic
997280597 5:132641784-132641806 GAGAAAAGTAGTAACAGGTCAGG + Intronic
997404385 5:133633233-133633255 AAGGAAGGGAGAAAGAGGGCAGG - Intergenic
997831372 5:137153556-137153578 GAGGGGAAGAGAAAGAGGCCAGG + Intronic
998333214 5:141347448-141347470 GATGAAAAGAATAACAGGCCAGG - Intronic
998505159 5:142666640-142666662 AAGAAATGGAGCAAGAGGCCTGG + Intronic
999300414 5:150486728-150486750 GAGGGAGGGGGTTAGAGGCCGGG + Intronic
1000553920 5:162700414-162700436 GAATAAAGAAGAAAGAGGCCGGG + Intergenic
1000614666 5:163413889-163413911 GAGGAAAGGAGAAAGGGGGAAGG + Intergenic
1001029105 5:168248638-168248660 GAGGAAAGCAGTAAGAAGCGGGG + Intronic
1001220351 5:169895255-169895277 GAGGAAAGGAGAAAGAAGGAAGG - Intronic
1001826058 5:174746016-174746038 GAAGAAAGGGGACAGAGGCCAGG - Intergenic
1001975914 5:175998169-175998191 GAGGAAACGAGGAGGAGGGCAGG + Intronic
1002241512 5:177845603-177845625 GAGGAAACGAGGAGGAGGGCAGG - Intergenic
1002565067 5:180108095-180108117 GAGGAGAGGAAAAAGAGGGCAGG - Intronic
1003023986 6:2537128-2537150 GTGGGAAGGTGTAAGAGGCTTGG + Intergenic
1003114772 6:3276553-3276575 GAGGACAGGAGGAAGAGGTGGGG - Intronic
1003547739 6:7074764-7074786 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
1004206012 6:13592357-13592379 GAGCTGAGGAATAAGAGGCCTGG + Intronic
1004485164 6:16059737-16059759 GAGGGAAGGGGGAAGAGGCTTGG + Intergenic
1004910441 6:20277837-20277859 GAGCAAAGGAGAAAGAGGTTGGG + Intergenic
1005078714 6:21934995-21935017 GTTTAAAGAAGTAAGAGGCCGGG - Intergenic
1005081905 6:21965216-21965238 GAGGAAATGAGAAGGAGGCAGGG + Intergenic
1005227199 6:23656553-23656575 GAGGCAAGGAGAAAGGGGGCGGG + Intergenic
1005288221 6:24351568-24351590 GAGGAAAGGAGTAAGTGGGAGGG + Intronic
1005700120 6:28392469-28392491 AAGAAAAGGAGTAACAGGCTGGG - Intronic
1005847226 6:29791772-29791794 CAGGTAAGGAGTAGGAGGCAGGG + Intergenic
1005999619 6:30955161-30955183 GAGAAAAGGAGGAAGATGCCTGG + Intergenic
1006053001 6:31357594-31357616 GAGGTAAGGAGTGGGAGGCAGGG - Intergenic
1007198638 6:40085948-40085970 GAGGAAAGGACATATAGGCCTGG - Intergenic
1007305762 6:40902996-40903018 GAAGAAAGAAGGGAGAGGCCAGG + Intergenic
1007610766 6:43147391-43147413 GAGGGAAGGAAGAAGGGGCCGGG - Intronic
1007806967 6:44457726-44457748 AAGAAAAGGAGAAAGAGGCCTGG + Intergenic
1007935461 6:45728355-45728377 GAGGAAAGGAGGCCAAGGCCTGG + Intergenic
1008279046 6:49573634-49573656 GAGGAAGGGAGGAAGAGGGGAGG + Intergenic
1008452941 6:51673940-51673962 GAGGAACGGAGTAAAAGGTTGGG + Intronic
1008463665 6:51805598-51805620 GAGGAGAGAGGTAAGAGGCAGGG + Intronic
1008693457 6:54006910-54006932 GAGGAAGGGAGGAGGAGACCGGG - Intronic
1009489973 6:64277532-64277554 GAAGAAAGAAGTAAAAGGACTGG + Intronic
1009576227 6:65465248-65465270 GAGGCCAGGAGTTTGAGGCCAGG + Intronic
1009753180 6:67899162-67899184 GAGCACAGGAGAAAGAGGCAAGG + Intergenic
1009898509 6:69782518-69782540 GAGGTCAGGAGTTTGAGGCCAGG + Intronic
1010229453 6:73521648-73521670 GTGGCAAGGAGTACCAGGCCCGG + Intronic
1011201790 6:84845004-84845026 GGAGAAAGCAGTAGGAGGCCAGG + Intergenic
1011639696 6:89407340-89407362 GAAGAAAGAAGGAAGAGGCCGGG + Intronic
1011640743 6:89413810-89413832 GAGGAAGGGAGCTAGAGTCCTGG + Intergenic
1011996120 6:93590272-93590294 GAGGAAAAGAGTAGTAGGCTGGG - Intergenic
1012463535 6:99491235-99491257 AAGAAAAGGGGGAAGAGGCCAGG + Intronic
1012541087 6:100362711-100362733 GAGGAAAGGAGAGAGAGGGAGGG - Intergenic
1012880179 6:104778052-104778074 AAAGTTAGGAGTAAGAGGCCGGG - Intronic
1013040000 6:106423998-106424020 AAGGAAAGGAGGGAGAGGCTGGG - Intergenic
1013191463 6:107807326-107807348 AAGGAGAGGAGGAAGATGCCTGG - Intronic
1013330841 6:109098439-109098461 CAGGAAAAAAGAAAGAGGCCGGG - Intronic
1013489965 6:110636639-110636661 GAGGGATGGAATTAGAGGCCAGG + Intronic
1013494514 6:110684923-110684945 GAGGTCAGGAGTTAGAGACCAGG + Intronic
1014179962 6:118373848-118373870 GAGTGAAGGAGTGAGAGGGCTGG + Intergenic
1014349692 6:120324769-120324791 GAGTAGAGTAGTTAGAGGCCAGG + Intergenic
1014720860 6:124916747-124916769 GTGAAAAGGAGCAAGAGCCCTGG + Intergenic
1015479523 6:133692411-133692433 GAGGACAGGAGTTTGAGACCAGG + Intergenic
1016546406 6:145229181-145229203 GAGGAAAGGAGAAAGAGGAAAGG - Intergenic
1017006125 6:150029082-150029104 GAGGAGAGCAGTGAGAGGGCTGG + Intergenic
1017024156 6:150166933-150166955 AAGGAAAGCAGAAAGAGGCCAGG + Intronic
1017545472 6:155446809-155446831 GAGGAGAGGAGTAAGGGTCAAGG - Intronic
1018286438 6:162244255-162244277 GAGGTGATGAGTAAGAAGCCAGG + Intronic
1018337599 6:162810838-162810860 AAGGAAAGGAAAAAGAAGCCAGG + Intronic
1018948007 6:168359048-168359070 GAGACAAGGAGCAAGAGGACTGG - Intergenic
1019457141 7:1134920-1134942 AAGGAAAGGAGTCAGAGACAGGG - Intronic
1019732081 7:2634012-2634034 GAGGAAAGGGGGCAGAAGCCAGG - Intronic
1020391873 7:7667020-7667042 GAGGTTAGGAGTTAGAGACCTGG - Intronic
1020483890 7:8696928-8696950 GAGGCCAGGAGTTTGAGGCCAGG + Intronic
1020790798 7:12626216-12626238 AAGGAAAGGAGTAACTAGCCAGG - Intronic
1020969671 7:14919842-14919864 GAGGAAAGGAGCAAGAGAGAGGG - Intronic
1021054845 7:16035027-16035049 GAGGAAGAAAGGAAGAGGCCTGG - Intergenic
1021131068 7:16913520-16913542 GAGGAAAGGAGAAGGAAGGCTGG - Intergenic
1021442715 7:20696404-20696426 GAGGAAGGAAGGAAGAGGACTGG + Intronic
1021469439 7:20984865-20984887 CAAGAAAGGGGAAAGAGGCCGGG + Intergenic
1021533370 7:21674570-21674592 GAGGCTAGGAGTTACAGGCCTGG - Intronic
1022208213 7:28182653-28182675 GATGAAGGAAGTAAGGGGCCTGG + Intergenic
1022243873 7:28538347-28538369 TTGAAATGGAGTAAGAGGCCAGG - Intronic
1023088477 7:36595972-36595994 GAGGAAAAAAGCAGGAGGCCAGG - Intronic
1023325750 7:39053887-39053909 GAGGTCAGGAGTTAGAGACCAGG + Intronic
1023961077 7:44926835-44926857 GAGAAAAGGAGTTGGAGGCTAGG + Intergenic
1024025936 7:45410010-45410032 TAAGAAAGGGGGAAGAGGCCAGG + Intergenic
1024056544 7:45663163-45663185 GAAGAAAGTGGTAACAGGCCTGG - Intronic
1025241912 7:57283810-57283832 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1026110457 7:67455169-67455191 GGGGAAGGGAATAAGATGCCAGG - Intergenic
1026462849 7:70630105-70630127 GAGGAAAGGGGTAGGGGGCTCGG + Intronic
1026680802 7:72465138-72465160 GAGGAAAGAATTCAGAGGTCAGG + Intergenic
1026865104 7:73818849-73818871 GAAGAAAGAAAGAAGAGGCCGGG - Intronic
1027933013 7:84564165-84564187 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1028528190 7:91808800-91808822 GAGGAAGGGGGTAGGATGCCAGG - Intronic
1028565680 7:92228066-92228088 GAGCCCAGGAGTTAGAGGCCAGG - Intronic
1028871550 7:95776030-95776052 GAGGCCAGGAGTTAGAGACCAGG + Intronic
1028941152 7:96523366-96523388 GGGAAGAGGAGTAAGAGGCGGGG + Intronic
1029368261 7:100130355-100130377 GTGAAAAGGAATAATAGGCCAGG - Intergenic
1029440591 7:100584850-100584872 GATGAGAGGAGGAAGAGGCCTGG + Intronic
1029498829 7:100914972-100914994 GAGGTCAGGAGTTCGAGGCCTGG - Intergenic
1029989200 7:104947536-104947558 GAGGCCAGGAGTTTGAGGCCAGG + Intergenic
1030068495 7:105678815-105678837 GAGGTCAGGAGTAGGAGGCTGGG - Intronic
1030072365 7:105709117-105709139 GAGGTCAGGAGTTAGAGACCAGG + Intronic
1030120704 7:106107979-106108001 GAGGTCAGGAGTTAGAGTCCAGG + Intronic
1030125656 7:106150544-106150566 GAGGGCAGGAGTCAGAGGCACGG + Intergenic
1030894331 7:115038708-115038730 GAGGAAAGAAGTAAGTGCCCAGG + Intergenic
1031020179 7:116619532-116619554 GAATAAAGGAGTAAGAGGATTGG - Intergenic
1031071370 7:117165751-117165773 GAGGTCAGGAGTCAGGGGCCAGG + Intronic
1031094829 7:117405129-117405151 GTGGGAAGGAGGAAGAGGACTGG - Intronic
1031628554 7:124019118-124019140 GAGGAGAGGAGGAAGAGGAGGGG - Intergenic
1032163156 7:129526032-129526054 TAAGAAAGGAGTTAGAGGCCAGG + Intergenic
1032400454 7:131620669-131620691 CAGGAAAGGAAGAGGAGGCCTGG - Intergenic
1032456877 7:132079872-132079894 GAGGAGAGGAGAGAGAGGACAGG - Intergenic
1032531225 7:132622245-132622267 GAGGAAAGAGGAAAGATGCCTGG + Intronic
1033103756 7:138500262-138500284 GAAAAAAGGAATAAGAGGCCAGG + Intronic
1033115377 7:138620332-138620354 GAGGTAAGGAGTTTGAGACCAGG - Intronic
1033303974 7:140210819-140210841 GAGGAAAGGCTCCAGAGGCCAGG + Intergenic
1033318792 7:140321023-140321045 AAGGACACCAGTAAGAGGCCGGG + Intronic
1033359278 7:140626638-140626660 GAGGAAAGGAAGAGGAGGACAGG - Intronic
1033458763 7:141526715-141526737 GAGGAAAAGAGGAAGAGGAAAGG - Intergenic
1033584562 7:142764498-142764520 GAGGGAAGAGGTAGGAGGCCAGG - Intergenic
1033991052 7:147287496-147287518 GAGGAAATGGATGAGAGGCCAGG - Intronic
1034034570 7:147805216-147805238 GAGGTGAGGAGTTCGAGGCCAGG - Intronic
1034061369 7:148094094-148094116 GAGAAAGGGAGTAAGAGTACAGG + Intronic
1034252890 7:149706525-149706547 GAGGGAAGGAGTAAGAGGAAAGG - Intergenic
1034259766 7:149747613-149747635 GACAAAAGGAGAAATAGGCCGGG + Intergenic
1034474983 7:151276713-151276735 GAGGAGGGGAGGAAGATGCCAGG + Intronic
1034517352 7:151591203-151591225 GAGAAAAGGAGTATGTGTCCAGG - Intronic
1034526875 7:151670200-151670222 GAGCAGAGGAGGAAGAGGGCAGG - Intronic
1034711146 7:153192484-153192506 GGGGAAGGGAGTATGAGCCCAGG - Intergenic
1034753015 7:153588308-153588330 GTGGAAAGAATTAAGAGCCCAGG + Intergenic
1035099649 7:156385967-156385989 AAGAAAAGGAGTAAAAGGCAGGG + Intergenic
1035157048 7:156922866-156922888 GAAGAAAGGGTTAACAGGCCAGG + Intergenic
1035232836 7:157476687-157476709 GAGGAAGGGAGACAGAGGCCAGG - Intergenic
1035288391 7:157821029-157821051 GAGGAGAGGAGGATGAGGCCAGG + Intronic
1035626001 8:1071075-1071097 GAGGCCAGGAGAGAGAGGCCCGG - Intergenic
1035924409 8:3711541-3711563 GAGAAGAGGAGGAAGACGCCAGG - Intronic
1036763848 8:11533611-11533633 GAGGAGAGGAGTAGGAGGAGGGG + Intronic
1037115258 8:15217872-15217894 GAGGTGAGGAGTTAGAGACCAGG + Intronic
1037551211 8:19973484-19973506 TAGGGAAAGAGTAAGAGGCCAGG - Intergenic
1037709321 8:21342971-21342993 GAGGAAAGGAGACTGAGGTCTGG - Intergenic
1038057066 8:23870072-23870094 GAGGTAAGGAGTTCGAGACCAGG + Intergenic
1038180590 8:25223526-25223548 GAGGACAGGAGTTGGAGACCAGG - Intronic
1038236694 8:25765644-25765666 CAGGAAAGGAGTTAGAGATCAGG + Intergenic
1038275823 8:26119884-26119906 GAGGTCAGGAGTTTGAGGCCAGG - Intergenic
1038456206 8:27673371-27673393 CAGGAAAGGAGGCAGAGACCAGG + Intronic
1038743344 8:30234754-30234776 GAGGAAGAGGGGAAGAGGCCAGG - Intergenic
1039237020 8:35513025-35513047 GAGGGAAGGCGTGAGAGGGCAGG - Intronic
1040950802 8:52937708-52937730 GTGGGAAGGAGTAAGATGGCTGG - Intergenic
1040987600 8:53313617-53313639 CAGGGAAGGAGGAAGAGGGCTGG + Intergenic
1041689720 8:60677844-60677866 GAGAAATGGAATAAGAGGCTCGG + Intergenic
1042081849 8:65062439-65062461 AAGGAGAGGAGAAAGAGGGCAGG + Intergenic
1042363666 8:67911606-67911628 GAGAAAAGGAGCAGGAGGACAGG - Intergenic
1042552829 8:70009746-70009768 GAGGTCAGGAGTTCGAGGCCAGG + Intergenic
1042889906 8:73597438-73597460 GAGGTCAGGAGTTGGAGGCCAGG + Intronic
1043437358 8:80247638-80247660 GAGGAAAGCAGTAGGAGGTAAGG + Intergenic
1043973055 8:86554108-86554130 GAGGAAAGGAGCAAGAGAGCTGG + Intronic
1045168228 8:99631128-99631150 GGGAAAAGGAGAGAGAGGCCTGG - Intronic
1045230898 8:100306008-100306030 GAGGGAAGGAGCAAGAAACCAGG - Intronic
1046132975 8:109991538-109991560 GAGGTCAGGAGTTAGAGACCAGG + Intergenic
1046304552 8:112346928-112346950 GAGGAAAAGGATAGGAGGCCTGG - Intronic
1047386907 8:124418202-124418224 GAGGCCAGGAGTTAGAGACCAGG + Intergenic
1047478343 8:125257068-125257090 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
1047938429 8:129804349-129804371 GAGGAAAAGAGTAAGAGTTGGGG - Intergenic
1048752575 8:137696988-137697010 GAGGACAGCAGTGAGAGGACGGG + Intergenic
1048921671 8:139237141-139237163 GAGGTAAGGAGTTTGAGACCAGG - Intergenic
1049044153 8:140136330-140136352 GAGGACAGGGGCACGAGGCCCGG + Intronic
1049203730 8:141353790-141353812 GAGGAGAGGAGAAAGAGGAGTGG + Intergenic
1049959553 9:725277-725299 GAGGTCAGGAGTTTGAGGCCAGG + Intronic
1050151028 9:2620000-2620022 GAGGAAAGGAGTAGAAGGGATGG - Intergenic
1050523070 9:6521807-6521829 GAGGTAAGGAGTTCGAGACCAGG - Intergenic
1050562223 9:6845709-6845731 CATGAAAGGAGAAAGGGGCCGGG + Intronic
1050796783 9:9556297-9556319 GAAGAAAGGAGGAAGAGGAGGGG + Intronic
1050920003 9:11188574-11188596 GAGGAAAGGACTAAGAGAAAGGG + Intergenic
1051283304 9:15466162-15466184 GAGGTCAGGAGTTCGAGGCCGGG + Intronic
1051385960 9:16509055-16509077 GAGGGAAGGAGTTTGAGGCCAGG - Intronic
1051457608 9:17278117-17278139 GGGTAAAGGAGAAAGAGGTCCGG - Intronic
1051930968 9:22385009-22385031 AAGGAAAGGAGAAAAAGGACAGG + Intergenic
1053138147 9:35664711-35664733 GAGGAAAGGAGGGAGAGTCCTGG - Intronic
1053424767 9:38003645-38003667 GAGGACAGGAGCATGGGGCCGGG + Intronic
1054457868 9:65444564-65444586 GAGGACAGGAGTGCCAGGCCTGG + Intergenic
1054770722 9:69080739-69080761 GAGGATAGGAGTTCGAGGCCAGG + Intronic
1054828382 9:69596361-69596383 GATGAAAGGATTTAGATGCCTGG - Intronic
1055035401 9:71812892-71812914 CAGCAAAGTAGAAAGAGGCCTGG + Intronic
1055566090 9:77569616-77569638 GTGGAAAGAAGAAAGAGCCCAGG + Intronic
1055738911 9:79364316-79364338 CAGGAAAGAATTGAGAGGCCAGG - Intergenic
1055805677 9:80090243-80090265 GAGGAAAAGAATAAGAGGATGGG + Intergenic
1056017634 9:82407488-82407510 AAGGAAAGGAGAAGGAAGCCAGG + Intergenic
1056090430 9:83200180-83200202 GAGGTCAGGAGTTTGAGGCCAGG + Intergenic
1056172724 9:84003278-84003300 GACGGCAGGAGTGAGAGGCCAGG - Exonic
1056620767 9:88211915-88211937 CAGGACAGGAGAAAGAGTCCAGG + Intergenic
1056855981 9:90130002-90130024 GAGGAAAGGAGCAGGAGGGCTGG + Intergenic
1057072696 9:92114058-92114080 GAGGCCAGGAGTTCGAGGCCAGG + Intronic
1057494909 9:95553274-95553296 GCGGGCAGGAGTCAGAGGCCGGG - Intergenic
1057874622 9:98744357-98744379 GAGGTGAAGAGAAAGAGGCCAGG + Intronic
1059911257 9:119046656-119046678 CAGGAAAAAAGTAAGAGGACAGG - Intergenic
1060168375 9:121439996-121440018 AAGGAAAGGAAAAAGAGCCCTGG + Intergenic
1060382914 9:123193600-123193622 GAGGAAAGGAATACAAGGACTGG - Intronic
1060967694 9:127720928-127720950 GAGGAAAGGAGGAAGGGGGAAGG - Intronic
1061206044 9:129164007-129164029 GAGGATGGGAGGGAGAGGCCAGG + Intergenic
1061546660 9:131308483-131308505 AAGCAAAGGGGCAAGAGGCCTGG - Exonic
1061630082 9:131866872-131866894 GAGGAAAGGAGGCAGACACCGGG - Intronic
1061808279 9:133148475-133148497 GGGGAAAGAAGAAAGAGGGCGGG - Intronic
1061865971 9:133491954-133491976 GAGGAAAGGATTAGGCTGCCTGG + Intergenic
1062714652 9:138002411-138002433 GATTTAAAGAGTAAGAGGCCAGG + Intronic
1203772076 EBV:54533-54555 GAGGAGCGGAGGAAGCGGCCGGG - Intergenic
1186330388 X:8526418-8526440 TTTGAAAAGAGTAAGAGGCCAGG - Intergenic
1187044436 X:15632362-15632384 GAGGTCAGGAGTTCGAGGCCAGG + Intronic
1187135103 X:16540575-16540597 AAGGAAAAGAGAAAGAGGCCGGG + Intergenic
1187196970 X:17096362-17096384 AAAGAAAAGAGGAAGAGGCCGGG + Intronic
1187758560 X:22553644-22553666 GGGGACAGGAGAAAGAGGCTGGG + Intergenic
1188626508 X:32291803-32291825 GAGAAGAGGAGTAAGATGGCAGG + Intronic
1189422139 X:40865558-40865580 GAGGAGAGGAGGAAGAGGAGAGG - Intergenic
1189763630 X:44347134-44347156 GAGGTCAGGAGTTCGAGGCCAGG - Intergenic
1190169262 X:48098920-48098942 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1190169265 X:48098934-48098956 GAGGCCAGGAGTTTGAGGCCAGG - Intergenic
1190662319 X:52666159-52666181 AAGGAAAGGATTTGGAGGCCAGG + Intronic
1191633530 X:63351221-63351243 AAGGCAAGGAGTAAGAGGGATGG + Exonic
1191743126 X:64456882-64456904 GAGGAAGGAAGGAAGAGTCCTGG + Intergenic
1192109844 X:68352855-68352877 GAAGAAAGGTGTATCAGGCCCGG + Intronic
1192119310 X:68439865-68439887 GAGGGCAGGAGTTCGAGGCCAGG + Intergenic
1192206475 X:69100158-69100180 GAGGTCAGGAGTTCGAGGCCTGG - Intergenic
1192493650 X:71598415-71598437 GAGGAAAGGAGTAAGAGGCCTGG + Intronic
1193223569 X:78955503-78955525 GAGAAAGGAAGTAAGAGGCTTGG + Intronic
1194717067 X:97298911-97298933 AAGAAAAGGACTAAGAGGCTGGG - Intronic
1195011264 X:100734237-100734259 CAGCAAAGGATTTAGAGGCCAGG + Intergenic
1195091379 X:101462991-101463013 GAGGAAAGGAGGGAAAGGCTTGG - Intronic
1195374080 X:104209246-104209268 AAAGAAAGGAGTTAGGGGCCAGG - Intergenic
1195560156 X:106274055-106274077 TAGGAGAGGAGAAAGAGTCCTGG - Intergenic
1195561806 X:106292284-106292306 TAGGAGAGGAGAAAGAGTCCTGG + Intergenic
1195697266 X:107676483-107676505 GGGGAAAGGGGAAAGTGGCCAGG - Intergenic
1196058096 X:111377764-111377786 GAGGAAGGGAGGAAGAGGAAAGG - Intronic
1196107140 X:111908921-111908943 GAGGCCAGGAGTTTGAGGCCAGG + Intronic
1196248476 X:113429038-113429060 GAGGAAAGGAGAGAGAAGACTGG + Intergenic
1196338096 X:114563079-114563101 GAAGAAAGGTGTTACAGGCCGGG + Intergenic
1196372945 X:114999079-114999101 GAGGTCAGGAGTTAGAGACCAGG + Intergenic
1196663453 X:118292850-118292872 AAGGAAAGGAGAAAGAGGGCAGG + Intergenic
1197329246 X:125133296-125133318 TAAGAAAGGAGTAAGAAGGCCGG - Intergenic
1197845603 X:130798773-130798795 GAGGACAGGGGTGAGTGGCCTGG - Intronic
1197931849 X:131704464-131704486 GTGGGAAGGAGGAAGAGGCGTGG + Intergenic
1198495504 X:137188184-137188206 GAGGAAATGAGGAAAAGGCATGG - Intergenic
1198520484 X:137447492-137447514 GAGGAAAAAAGAAAGAGGCCGGG + Intergenic
1198923192 X:141754123-141754145 GAGGTCAGGAGTTCGAGGCCCGG - Intergenic
1199320055 X:146427370-146427392 CAGAAAAGGAGGAGGAGGCCGGG - Intergenic
1200063656 X:153494875-153494897 GAGGAAAGGAGGGAGGGGGCTGG - Intronic
1200286740 X:154830082-154830104 GAGCAGAGGAGAAAGGGGCCAGG + Intronic
1201146195 Y:11066800-11066822 GAGGAAAGGAGAGAGAGGAAGGG + Intergenic
1201146481 Y:11067716-11067738 GAGGAAAGGAGGGAGAGGAAGGG + Intergenic
1202332831 Y:23772658-23772680 GAGGAAGGGAGAAAGAGGAAAGG - Intergenic
1202537938 Y:25897405-25897427 GAGGAAGGGAGAAAGAGGAAAGG + Intergenic