ID: 1192494465

View in Genome Browser
Species Human (GRCh38)
Location X:71605872-71605894
Sequence TGAGTAGGAGGGCCCAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192494465 Original CRISPR TGAGTAGGAGGGCCCAAGCA AGG Intronic
901291232 1:8125933-8125955 TGGGAGTGAGGGCCCAAGCAGGG - Intergenic
901643829 1:10706241-10706263 TGGGCAGGAGGGCCCCAGCCTGG - Intronic
903045436 1:20561092-20561114 TAAGTAGGAGGGACCAGGAAGGG - Intergenic
903316038 1:22507853-22507875 TGTGTATGAGGCCCCAAGCCAGG + Intronic
905889103 1:41508633-41508655 TGTCTAGTAGGGACCAAGCAGGG + Exonic
906210396 1:44009675-44009697 TGAGATGGAGGGCCAAAGGAAGG + Intronic
907037119 1:51226163-51226185 TGAGTAAGAAGGCCCTAGAATGG + Intergenic
912510501 1:110186605-110186627 TGAGCAGGAGGGACCAGACAAGG - Intronic
913174456 1:116261508-116261530 TGAGAAGGCGGGACCGAGCATGG + Intergenic
916712193 1:167421545-167421567 AGAGTAGAAGGGCCAAAACAAGG - Exonic
922071859 1:222202954-222202976 AGCCTAGGAGGGTCCAAGCAGGG + Intergenic
923999969 1:239539755-239539777 TGAGTAGGTGGGACCATGCCCGG + Intronic
924478029 1:244398452-244398474 TGATTAGGAGTATCCAAGCATGG + Intergenic
924707277 1:246510831-246510853 TGAGTAAGAGGGCCCAGATACGG + Intergenic
1063112837 10:3051882-3051904 AGGGTGGGAGGGCCCGAGCATGG + Intergenic
1068629409 10:59284446-59284468 TGTGTTGGAGGGTCCTAGCAGGG - Intronic
1070723457 10:78772420-78772442 TGAGCAGGAGAGGCCAGGCAAGG - Intergenic
1073459020 10:103654955-103654977 TGAGTGGAAGGGCCCAAGACTGG + Intronic
1075194835 10:120347473-120347495 TGAGAAGGAGGGGCGGAGCAAGG + Intergenic
1075642042 10:124071860-124071882 TGACTAGGACGGCCGAAGAATGG - Intronic
1076733287 10:132448645-132448667 CGAGTGGGAGGGGCCAAGCAGGG - Exonic
1076733491 10:132449108-132449130 CGAGTGGGAGGGGCCAAGCAGGG - Exonic
1076785035 10:132745522-132745544 TGAGGAGGAAGGTCCCAGCAGGG - Intronic
1077351096 11:2093486-2093508 TGTGTGGGAGGGGCCTAGCATGG + Intergenic
1077669767 11:4146625-4146647 GGTGTAGGAGGTCCCCAGCAGGG + Intergenic
1079122668 11:17696500-17696522 TGAGCAGCAGGTCCCAAGGAAGG - Intergenic
1080704090 11:34672261-34672283 TTGGAAAGAGGGCCCAAGCAAGG + Intergenic
1081806564 11:45894017-45894039 TGAGTAGGAGGTCACTACCAAGG - Intronic
1083679467 11:64344524-64344546 GGAGCAGGAGGGCCCAAACCAGG + Exonic
1085315134 11:75540253-75540275 AGAGTAGGAAGGCACTAGCAGGG - Intergenic
1085888204 11:80545763-80545785 TGTGCTGGAGGGGCCAAGCAAGG - Intergenic
1087320093 11:96647412-96647434 TGAGAAGCAGGGCAGAAGCATGG + Intergenic
1089142002 11:116292819-116292841 TGAGTGGCAGGGCCCAAACAGGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090263922 11:125342371-125342393 TGAGTAGGGTGGCCGGAGCAGGG - Intronic
1090670642 11:128942895-128942917 TGAGCAGGCGAGCCCGAGCACGG + Exonic
1090706825 11:129345179-129345201 TGAGTAGGAGTCCCCATGCCTGG - Intergenic
1091123989 11:133080375-133080397 TGAGTAGGAAGGCCCTAAGAGGG + Intronic
1091782179 12:3220793-3220815 TGGGAAGGCGGGCCCAAGGAGGG + Intronic
1092818516 12:12331714-12331736 GGAGGAGGAGGGGCCAGGCAGGG + Intronic
1094249167 12:28339771-28339793 TGAGAAGCAGTGCCCAACCACGG + Intronic
1094272934 12:28637377-28637399 TGAGGAGAAGGGCGCCAGCAGGG - Intergenic
1094484959 12:30917782-30917804 TGAGTAGGAGGGACTACACAAGG + Intergenic
1096384603 12:51186756-51186778 GTGGCAGGAGGGCCCAAGCAGGG + Intergenic
1096480689 12:51938931-51938953 TGAGTAGGCGGGCCCATTCCTGG - Intergenic
1098913270 12:76232091-76232113 TGGGTTTGAGGGCCCAAGCATGG + Intergenic
1101549398 12:105747977-105747999 TGAGCAGGAGGGCACAGACAAGG + Intergenic
1104714437 12:131006987-131007009 TCAGCAGGAGGGGCCAAGGAAGG - Intronic
1104857981 12:131910718-131910740 TGGGTACGAGGGCACAGGCACGG - Exonic
1106406993 13:29483078-29483100 TGAGAAGGAGGCCCCAAGAGTGG - Intronic
1109129005 13:58556897-58556919 TGAGAAGGATGGCCCATGGAAGG + Intergenic
1109977895 13:69865289-69865311 TGAGTATGAGGGCCAGAGCATGG + Intronic
1111001850 13:82194931-82194953 TGAGTAGTACTGCACAAGCACGG + Intergenic
1111658509 13:91180584-91180606 TGAGGAGGAGGGCCAAAGCAAGG - Intergenic
1113937228 13:114000905-114000927 TGATCAAGAGGGCCCAAGGACGG - Exonic
1118995326 14:70830387-70830409 TGGGTAGAAAGGCCCAAACAAGG - Intergenic
1119533356 14:75379414-75379436 ACAGTATGAGGGCCCAGGCAGGG + Intergenic
1119601768 14:75981449-75981471 TGAGTAGGTGGGGAGAAGCAGGG + Intronic
1120577544 14:86202033-86202055 TGAGTAGTAGGTCTCAATCATGG - Intergenic
1121704636 14:95982277-95982299 TGATGAGGAGGGACCAACCAAGG - Intergenic
1122269322 14:100561274-100561296 TGGGCAGCAAGGCCCAAGCAGGG + Intronic
1122307811 14:100776743-100776765 TGAGAAGGAGAGCCGAAGCGGGG - Intergenic
1122887765 14:104718171-104718193 CCAGTGGGATGGCCCAAGCAGGG - Intronic
1122967971 14:105140071-105140093 TGAGGAGGGGGCCCCAGGCAAGG - Intergenic
1126183581 15:45809671-45809693 TGAGTAGAAACTCCCAAGCACGG - Intergenic
1126373506 15:47971518-47971540 TGAGAAGGAGAGACAAAGCATGG - Intergenic
1128360089 15:66955948-66955970 TGAGGAGAAGGGCCAGAGCATGG - Intergenic
1129028709 15:72603708-72603730 TGAGAAGGGGAGCCCAAGCTTGG - Intergenic
1129387885 15:75206008-75206030 TGAGTAGCAGGGGCCTAGGAGGG + Exonic
1135502415 16:23008099-23008121 TGGGTGGGAAGGCCCAAGGATGG + Intergenic
1136066879 16:27765335-27765357 TGAACAGGATGTCCCAAGCAAGG + Intronic
1137657755 16:50175029-50175051 AGAGTAAGAGGGGCCAGGCATGG - Intronic
1139307873 16:66003374-66003396 TGAGGTGCAGGGCCCAAGAAAGG + Intergenic
1141043824 16:80696839-80696861 TGAAGAGGAGGGCCCAGGCATGG + Intronic
1143908213 17:10226712-10226734 GGAGCAGGAAGGCCCAAGCTGGG - Intergenic
1145896779 17:28463073-28463095 GAGGTAGGAGGGTCCAAGCAGGG + Intronic
1148888005 17:50787369-50787391 TGAGTGGGAGGGCACCAGGATGG + Intergenic
1149866937 17:60156371-60156393 GGAGGAGGAGGGCCCAGGGAGGG + Intronic
1153019199 18:611406-611428 GGATTAGGAGGGCTCAGGCATGG + Intronic
1153492748 18:5666521-5666543 TGAGAAGTAGGTCCCAAGCATGG + Intergenic
1156174205 18:34522838-34522860 AGAGCAGATGGGCCCAAGCAGGG + Intronic
1157317513 18:46604624-46604646 TGAGAAGCAGAGCCCAGGCAAGG + Intronic
1159180597 18:64897777-64897799 GGAATAGGAGGGCCCGAGGAGGG + Intergenic
1161469303 19:4448275-4448297 TGAGCTGGAGGGGCCAGGCAGGG + Intronic
1163500395 19:17672784-17672806 AGTGTTGGAGGGCCCAAGGAAGG - Intronic
1163779304 19:19238102-19238124 TCAGGAGGAGGGGCCAGGCATGG + Intronic
1164703881 19:30305050-30305072 GGAGTAGGAGGGCTGAAGCTTGG + Intronic
1165188278 19:34040334-34040356 TCATTAGGTGGGACCAAGCAAGG - Intergenic
1166365949 19:42278612-42278634 GGAGTAGGAGGGCCAAAGAGAGG - Intronic
926226048 2:10967645-10967667 GGAGGAGGAGGGGCCAGGCAAGG - Intergenic
927961910 2:27245903-27245925 TGATTAGGAGAGCCAAAGAAAGG - Intergenic
930148191 2:48029293-48029315 TCAGTAGGAGAGACCAATCAGGG + Intergenic
930844361 2:55885822-55885844 AGAGAATGAGGGCCTAAGCAGGG - Intronic
931427083 2:62181058-62181080 TGAGAGGGAAGGGCCAAGCATGG - Intergenic
932411986 2:71553036-71553058 TGAGTAGAAGGCCGCAAACAGGG - Exonic
932697706 2:73970560-73970582 TGGGAAGGACGGTCCAAGCAGGG + Intergenic
932758637 2:74425512-74425534 GGAATGGGGGGGCCCAAGCATGG + Intronic
939179253 2:138784866-138784888 AGAGTAGTAGGGCCCAACCATGG - Intergenic
940614260 2:156030304-156030326 TGAGTAAGATTGCCCAAGCGTGG + Intergenic
940855026 2:158723099-158723121 TGGTGAGGAGTGCCCAAGCAGGG + Intergenic
945033632 2:205686207-205686229 GGAGGAGGAGGGCACAAGCATGG - Intronic
947675140 2:231971894-231971916 TAAGTAGGAGTGGCCAGGCACGG + Intronic
1169274018 20:4221185-4221207 TGAGTAGACAGCCCCAAGCATGG - Exonic
1169827661 20:9787502-9787524 AGAGTAGGAGAGCTAAAGCATGG + Intronic
1172759953 20:37314840-37314862 AGAAGAGGAGGGCCCATGCAGGG - Intronic
1173007257 20:39149947-39149969 TGATAAGGAGAGCCCAAGGAAGG - Intergenic
1175669029 20:60885626-60885648 TGAGCAGCATGGTCCAAGCAGGG + Intergenic
1176671664 21:9740441-9740463 GGAGTAGGAGAGCCAGAGCATGG + Intergenic
1180038434 21:45263294-45263316 TGCGTAGGAGGGCCGCTGCAGGG - Intergenic
1180125514 21:45787632-45787654 TGACCACCAGGGCCCAAGCAGGG - Intronic
1181119779 22:20658020-20658042 TGAGTAGGAGGGGGCAAGAGTGG + Intergenic
1183521536 22:38298575-38298597 TGGGCAGCAGGGCCCAGGCAGGG - Intronic
1184473962 22:44710801-44710823 AGAGTAGGTGGGCCCAGGCTGGG + Intronic
949188085 3:1218144-1218166 TGAGTGGCAGAGCCCAAGTAAGG + Intronic
949545926 3:5072285-5072307 TGGGTTGTAGGGCTCAAGCAGGG - Intergenic
952427269 3:33188369-33188391 TGAGTGGGAGGGAGCTAGCAGGG - Intronic
953107485 3:39898464-39898486 AGAATAGGAGACCCCAAGCATGG - Intronic
953572296 3:44080676-44080698 TGAGACAGAGGGGCCAAGCAGGG + Intergenic
961575820 3:127835304-127835326 TTAGTAACCGGGCCCAAGCACGG + Intergenic
964457893 3:156888138-156888160 TGCGTAGGAGGGCTCAAAGAAGG + Intronic
966419781 3:179726170-179726192 TGAGAAGGAGCTGCCAAGCAAGG + Intronic
971485395 4:27155053-27155075 TTAGTAGGAGAGACAAAGCAGGG - Intergenic
975279188 4:72540703-72540725 TGACTAAAAGGGGCCAAGCATGG + Intronic
975635884 4:76447673-76447695 TGAGTAGCAGGGCAAAAACAAGG + Intronic
977927905 4:102721735-102721757 AGAGTAGAATGGGCCAAGCATGG + Intronic
981011846 4:139933277-139933299 TGAGTAGGAAGAGCCAACCAGGG - Intronic
982348114 4:154384323-154384345 TGAGGAGGAGGGCCATAACATGG - Intronic
986819340 5:11447780-11447802 TGAGTAGCAGGGGCCAAGGAAGG + Intronic
986885153 5:12225613-12225635 TGAAGAGGAGGACCCAAGCCTGG - Intergenic
987102606 5:14605261-14605283 TGACTAAAAGGGGCCAAGCAAGG - Intronic
996371746 5:122760477-122760499 TGAGTAGGAGGGCCTGATCTAGG + Intergenic
1001339101 5:170827323-170827345 AGTGTAGGAGGGTCCAAGTAAGG + Intergenic
1002160303 5:177310912-177310934 TGGGTATGAGGGCCCTAACAAGG + Intronic
1003693336 6:8376695-8376717 TGAGTAGCAAGGCCCAGGTAGGG - Intergenic
1004046824 6:12033420-12033442 TGATTAGAAGGGGCAAAGCAAGG + Intronic
1004982047 6:21035357-21035379 TGTGTAGGAGATCCCCAGCAGGG - Intronic
1008655252 6:53605609-53605631 TGAGAAGGAGGGATTAAGCAAGG + Intronic
1011402193 6:86975556-86975578 TGGGTAACAGAGCCCAAGCAGGG - Intronic
1017025618 6:150178138-150178160 GGAGTAGGAGGGCACACACAAGG - Intronic
1019771820 7:2888056-2888078 TGAGCAGCAGAACCCAAGCAGGG - Intergenic
1021486488 7:21173902-21173924 TAAGTAGGAGGGATAAAGCACGG - Intergenic
1028102436 7:86837633-86837655 TGAAGAGGAGGGCCTAGGCAGGG + Intronic
1030078552 7:105757923-105757945 TGTGTACCAGGGCCCAGGCAGGG - Intronic
1034364315 7:150533512-150533534 TGTGCTGGAGGGCCCAAGCCAGG + Intergenic
1034364463 7:150534342-150534364 TGAGTAGGATCTCCCAACCAGGG - Intergenic
1037274825 8:17166681-17166703 TGAGAAGGAGCGCCCAATGAAGG + Intronic
1038959562 8:32504098-32504120 TGGGTAAGTGGGCTCAAGCATGG - Intronic
1040558920 8:48506434-48506456 TGAGGAAGAGGGCCCGTGCAAGG + Intergenic
1049373305 8:142277892-142277914 TGAGAAGGAGGGGCCTGGCAGGG - Intronic
1049585844 8:143432074-143432096 GGAGTGGGAGGGCCCAGGGAAGG - Intergenic
1050725332 9:8642928-8642950 TGCTTAGGAGGGCAAAAGCATGG + Intronic
1051206450 9:14693596-14693618 TGAGAAGGACGGCTCAAGTAGGG - Intergenic
1051834633 9:21321664-21321686 TGAGTAGGAGGACTCCAGCCTGG + Intergenic
1053163088 9:35827095-35827117 TGACCAGCAGGGGCCAAGCACGG - Intronic
1055876317 9:80946208-80946230 TGAGAAGGTGGGTCCAAGGAAGG - Intergenic
1056951723 9:91045449-91045471 TGAGTAGGAGGCTCCAGGCATGG - Intergenic
1056979873 9:91299896-91299918 TGAGCTGGAGGGCCTTAGCAAGG - Intronic
1061098007 9:128471284-128471306 TGAGCAGGGGGACCCAGGCAGGG - Intronic
1061522868 9:131131461-131131483 TGAGGAGGAAGGCACAAGAAAGG - Intronic
1061636760 9:131915833-131915855 TGAGTAGAAATGGCCAAGCAAGG + Intronic
1061765234 9:132877655-132877677 TGAGGAGGAGGGACCAAGGTGGG + Intronic
1062096849 9:134708022-134708044 TGAGCAGCAGGGCCCAGGGAAGG - Intronic
1188432715 X:30123484-30123506 TGAGTAGTAGGTCTCAAACATGG - Intergenic
1192494465 X:71605872-71605894 TGAGTAGGAGGGCCCAAGCAAGG + Intronic
1194995199 X:100584363-100584385 TGAGGAAGAGGACCCAAGAAAGG + Intergenic
1195758550 X:108222961-108222983 TGAGTAGGAGGTCGAAAGCATGG + Intronic
1198580233 X:138055729-138055751 TGAGTAGGATGCCACATGCATGG + Intergenic
1200068150 X:153514793-153514815 TGAGAGGGAGGGCCCAGGCCTGG - Intergenic