ID: 1192496977

View in Genome Browser
Species Human (GRCh38)
Location X:71622699-71622721
Sequence CCGGGCCCCACCTGTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192496972_1192496977 10 Left 1192496972 X:71622666-71622688 CCTGAGGAGGAAGTTAGTCAGAG No data
Right 1192496977 X:71622699-71622721 CCGGGCCCCACCTGTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192496977 Original CRISPR CCGGGCCCCACCTGTGGTCA AGG Intergenic
No off target data available for this crispr