ID: 1192502173

View in Genome Browser
Species Human (GRCh38)
Location X:71661390-71661412
Sequence TCGGGCTCTCAGAATGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192502173_1192502178 -3 Left 1192502173 X:71661390-71661412 CCTCCAGCATTCTGAGAGCCCGA No data
Right 1192502178 X:71661410-71661432 CGACACCCATCCCTGTGTTTGGG No data
1192502173_1192502179 -2 Left 1192502173 X:71661390-71661412 CCTCCAGCATTCTGAGAGCCCGA No data
Right 1192502179 X:71661411-71661433 GACACCCATCCCTGTGTTTGGGG No data
1192502173_1192502177 -4 Left 1192502173 X:71661390-71661412 CCTCCAGCATTCTGAGAGCCCGA No data
Right 1192502177 X:71661409-71661431 CCGACACCCATCCCTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192502173 Original CRISPR TCGGGCTCTCAGAATGCTGG AGG (reversed) Intergenic
No off target data available for this crispr