ID: 1192502502

View in Genome Browser
Species Human (GRCh38)
Location X:71663199-71663221
Sequence CTGTGGGCTGGCCCTGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192502502_1192502513 8 Left 1192502502 X:71663199-71663221 CCTCAGCCAGGGCCAGCCCACAG No data
Right 1192502513 X:71663230-71663252 AGGTACCATGATTGTGGAAAGGG No data
1192502502_1192502512 7 Left 1192502502 X:71663199-71663221 CCTCAGCCAGGGCCAGCCCACAG No data
Right 1192502512 X:71663229-71663251 AAGGTACCATGATTGTGGAAAGG No data
1192502502_1192502516 14 Left 1192502502 X:71663199-71663221 CCTCAGCCAGGGCCAGCCCACAG No data
Right 1192502516 X:71663236-71663258 CATGATTGTGGAAAGGGGCATGG No data
1192502502_1192502510 2 Left 1192502502 X:71663199-71663221 CCTCAGCCAGGGCCAGCCCACAG No data
Right 1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG No data
1192502502_1192502514 9 Left 1192502502 X:71663199-71663221 CCTCAGCCAGGGCCAGCCCACAG No data
Right 1192502514 X:71663231-71663253 GGTACCATGATTGTGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192502502 Original CRISPR CTGTGGGCTGGCCCTGGCTG AGG (reversed) Intergenic
No off target data available for this crispr