ID: 1192502503

View in Genome Browser
Species Human (GRCh38)
Location X:71663205-71663227
Sequence GGAGGGCTGTGGGCTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192502503_1192502516 8 Left 1192502503 X:71663205-71663227 CCAGGGCCAGCCCACAGCCCTCC No data
Right 1192502516 X:71663236-71663258 CATGATTGTGGAAAGGGGCATGG No data
1192502503_1192502513 2 Left 1192502503 X:71663205-71663227 CCAGGGCCAGCCCACAGCCCTCC No data
Right 1192502513 X:71663230-71663252 AGGTACCATGATTGTGGAAAGGG No data
1192502503_1192502514 3 Left 1192502503 X:71663205-71663227 CCAGGGCCAGCCCACAGCCCTCC No data
Right 1192502514 X:71663231-71663253 GGTACCATGATTGTGGAAAGGGG No data
1192502503_1192502512 1 Left 1192502503 X:71663205-71663227 CCAGGGCCAGCCCACAGCCCTCC No data
Right 1192502512 X:71663229-71663251 AAGGTACCATGATTGTGGAAAGG No data
1192502503_1192502510 -4 Left 1192502503 X:71663205-71663227 CCAGGGCCAGCCCACAGCCCTCC No data
Right 1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192502503 Original CRISPR GGAGGGCTGTGGGCTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr