ID: 1192502510

View in Genome Browser
Species Human (GRCh38)
Location X:71663224-71663246
Sequence CTCCTAAGGTACCATGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192502503_1192502510 -4 Left 1192502503 X:71663205-71663227 CCAGGGCCAGCCCACAGCCCTCC No data
Right 1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG No data
1192502501_1192502510 3 Left 1192502501 X:71663198-71663220 CCCTCAGCCAGGGCCAGCCCACA No data
Right 1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG No data
1192502505_1192502510 -10 Left 1192502505 X:71663211-71663233 CCAGCCCACAGCCCTCCTAAGGT No data
Right 1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG No data
1192502502_1192502510 2 Left 1192502502 X:71663199-71663221 CCTCAGCCAGGGCCAGCCCACAG No data
Right 1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192502510 Original CRISPR CTCCTAAGGTACCATGATTG TGG Intergenic
No off target data available for this crispr