ID: 1192502985

View in Genome Browser
Species Human (GRCh38)
Location X:71665436-71665458
Sequence AGCAAGGGACATAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192502970_1192502985 25 Left 1192502970 X:71665388-71665410 CCCTGATTGGGCATTCTAGTGTC No data
Right 1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG No data
1192502976_1192502985 -7 Left 1192502976 X:71665420-71665442 CCGATAACAACCCTTGAGCAAGG No data
Right 1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG No data
1192502973_1192502985 3 Left 1192502973 X:71665410-71665432 CCCTGGCCTTCCGATAACAACCC No data
Right 1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG No data
1192502971_1192502985 24 Left 1192502971 X:71665389-71665411 CCTGATTGGGCATTCTAGTGTCC No data
Right 1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG No data
1192502975_1192502985 -3 Left 1192502975 X:71665416-71665438 CCTTCCGATAACAACCCTTGAGC No data
Right 1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG No data
1192502974_1192502985 2 Left 1192502974 X:71665411-71665433 CCTGGCCTTCCGATAACAACCCT No data
Right 1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192502985 Original CRISPR AGCAAGGGACATAGGGGGCA TGG Intergenic
No off target data available for this crispr