ID: 1192506231

View in Genome Browser
Species Human (GRCh38)
Location X:71685328-71685350
Sequence GGCCTGCCTGGTGATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192506226_1192506231 -9 Left 1192506226 X:71685314-71685336 CCTGGGAAAACCAGGGCCTGCCT No data
Right 1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG No data
1192506220_1192506231 10 Left 1192506220 X:71685295-71685317 CCATGGGACCAGTCTGGAGCCTG No data
Right 1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG No data
1192506219_1192506231 15 Left 1192506219 X:71685290-71685312 CCTGGCCATGGGACCAGTCTGGA No data
Right 1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG No data
1192506223_1192506231 2 Left 1192506223 X:71685303-71685325 CCAGTCTGGAGCCTGGGAAAACC No data
Right 1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192506231 Original CRISPR GGCCTGCCTGGTGATGAGGT GGG Intergenic
No off target data available for this crispr