ID: 1192507593

View in Genome Browser
Species Human (GRCh38)
Location X:71698397-71698419
Sequence TTCTGGGTTTGTGGTGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192507585_1192507593 -5 Left 1192507585 X:71698379-71698401 CCTGGGCAGGTTGCCCCTTTCTG No data
Right 1192507593 X:71698397-71698419 TTCTGGGTTTGTGGTGACGGAGG No data
1192507580_1192507593 24 Left 1192507580 X:71698350-71698372 CCATGGAGTGCACACTTGGTCAC No data
Right 1192507593 X:71698397-71698419 TTCTGGGTTTGTGGTGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192507593 Original CRISPR TTCTGGGTTTGTGGTGACGG AGG Intergenic
No off target data available for this crispr