ID: 1192507593 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:71698397-71698419 |
Sequence | TTCTGGGTTTGTGGTGACGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1192507585_1192507593 | -5 | Left | 1192507585 | X:71698379-71698401 | CCTGGGCAGGTTGCCCCTTTCTG | No data | ||
Right | 1192507593 | X:71698397-71698419 | TTCTGGGTTTGTGGTGACGGAGG | No data | ||||
1192507580_1192507593 | 24 | Left | 1192507580 | X:71698350-71698372 | CCATGGAGTGCACACTTGGTCAC | No data | ||
Right | 1192507593 | X:71698397-71698419 | TTCTGGGTTTGTGGTGACGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1192507593 | Original CRISPR | TTCTGGGTTTGTGGTGACGG AGG | Intergenic | ||
No off target data available for this crispr |