ID: 1192509528

View in Genome Browser
Species Human (GRCh38)
Location X:71713674-71713696
Sequence CCTCCTTAGCTTCAGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192509528_1192509530 -5 Left 1192509528 X:71713674-71713696 CCTGGCTACTGAAGCTAAGGAGG No data
Right 1192509530 X:71713692-71713714 GGAGGAGATCTGACAGAATTTGG No data
1192509528_1192509531 4 Left 1192509528 X:71713674-71713696 CCTGGCTACTGAAGCTAAGGAGG No data
Right 1192509531 X:71713701-71713723 CTGACAGAATTTGGTAACTAAGG No data
1192509528_1192509533 17 Left 1192509528 X:71713674-71713696 CCTGGCTACTGAAGCTAAGGAGG No data
Right 1192509533 X:71713714-71713736 GTAACTAAGGTTCAAAGGTGAGG No data
1192509528_1192509532 12 Left 1192509528 X:71713674-71713696 CCTGGCTACTGAAGCTAAGGAGG No data
Right 1192509532 X:71713709-71713731 ATTTGGTAACTAAGGTTCAAAGG No data
1192509528_1192509535 26 Left 1192509528 X:71713674-71713696 CCTGGCTACTGAAGCTAAGGAGG No data
Right 1192509535 X:71713723-71713745 GTTCAAAGGTGAGGGCTAAGAGG No data
1192509528_1192509534 18 Left 1192509528 X:71713674-71713696 CCTGGCTACTGAAGCTAAGGAGG No data
Right 1192509534 X:71713715-71713737 TAACTAAGGTTCAAAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192509528 Original CRISPR CCTCCTTAGCTTCAGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr