ID: 1192509713

View in Genome Browser
Species Human (GRCh38)
Location X:71714600-71714622
Sequence CTCCTAAGGTACCATGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 3, 1: 0, 2: 0, 3: 10, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192509705_1192509713 2 Left 1192509705 X:71714575-71714597 CCTCAGCCAGGGCCAGCCCACAG 0: 4
1: 1
2: 6
3: 84
4: 640
Right 1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG 0: 3
1: 0
2: 0
3: 10
4: 80
1192509708_1192509713 -10 Left 1192509708 X:71714587-71714609 CCAGCCCACAGCCCTCCTAAGGT 0: 3
1: 3
2: 7
3: 15
4: 258
Right 1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG 0: 3
1: 0
2: 0
3: 10
4: 80
1192509706_1192509713 -4 Left 1192509706 X:71714581-71714603 CCAGGGCCAGCCCACAGCCCTCC 0: 6
1: 1
2: 8
3: 82
4: 826
Right 1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG 0: 3
1: 0
2: 0
3: 10
4: 80
1192509704_1192509713 3 Left 1192509704 X:71714574-71714596 CCCTCAGCCAGGGCCAGCCCACA 0: 3
1: 1
2: 9
3: 36
4: 392
Right 1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG 0: 3
1: 0
2: 0
3: 10
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192509713 Original CRISPR CTCCTAAGGTACCATGATTG TGG Intronic
901093162 1:6657049-6657071 CTCCTAAGGAACCATGCCTGCGG + Intronic
905039936 1:34947808-34947830 CTCCCAAGGTGCCGAGATTGCGG + Intergenic
906980786 1:50626483-50626505 CTTCTGAGGTACCATCATTGGGG - Intronic
910265050 1:85329685-85329707 CTCCTAAGGTAGCTTTGTTGGGG - Intronic
914333151 1:146691095-146691117 CTCCTGAGGTACCTTAATAGGGG + Intergenic
921345032 1:214174874-214174896 AGCTTAAGGTACCATGATTAAGG - Intergenic
1070595138 10:77827481-77827503 CTCCCAAAGTGCCATGATTACGG + Intronic
1072434969 10:95406485-95406507 CTCAAAAGGTACCAAGACTGGGG - Intronic
1077680656 11:4237428-4237450 CTCCCAAGGTGCCGGGATTGCGG + Intergenic
1077684937 11:4282826-4282848 CTCCCAAGGTGCCGGGATTGCGG + Intergenic
1077690253 11:4335104-4335126 CTCCCAAGGTGCCGGGATTGCGG - Intergenic
1079628178 11:22641169-22641191 CTGCTAAGGTTCCAGGATTCTGG + Intronic
1085093345 11:73738263-73738285 CTCCCAAAGTACCAGGATTATGG + Intronic
1090985469 11:131762273-131762295 TTCCTATGGTCCCAGGATTGTGG + Intronic
1092087557 12:5775973-5775995 ATCCTCACGTATCATGATTGAGG + Intronic
1095103102 12:38203130-38203152 CTGCTATGCTACCATGAGTGGGG + Intergenic
1097853888 12:64441934-64441956 CTCCTAAAGTCCCAGGATTACGG + Intronic
1098835607 12:75421084-75421106 CTCCTAAGGTCCCAAGGATGGGG - Intronic
1099062988 12:77935743-77935765 CTCCAAAGGTAGCATGGCTGGGG + Intronic
1099535791 12:83842699-83842721 TTCCTTATGTACCATGATTATGG + Intergenic
1101502668 12:105318852-105318874 CTCCTAAAGTGCCAGGATTGCGG - Intronic
1107198854 13:37689129-37689151 CTGCTAAGCTACCATTATTAAGG - Intronic
1114549933 14:23526803-23526825 CTCCCAAGGTACCAGGAAAGGGG - Intronic
1116837708 14:49787385-49787407 AGCCTAAGGTACCATCTTTGAGG - Intronic
1120005226 14:79348890-79348912 CTCCTAAGGTTCTATGATAAAGG - Intronic
1120665703 14:87304166-87304188 ATCCTACGGGACCGTGATTGAGG + Intergenic
1120909040 14:89648931-89648953 CTCCTAAAGTGCCAGGATTATGG - Intergenic
1122047185 14:99032503-99032525 CTTCAAATGTACCATGACTGTGG + Intergenic
1127245595 15:57170098-57170120 CTCCTAAGGTATTATGCTTAAGG + Intronic
1128544451 15:68557813-68557835 CTCCTAAAGGACCATGACTAAGG - Intergenic
1130118665 15:81027735-81027757 TTCCTTAGGTACCATTACTGTGG - Intronic
1131099017 15:89673561-89673583 CTCCCACGCTCCCATGATTGGGG - Intronic
1136513210 16:30751766-30751788 CTCCCTTGGTGCCATGATTGAGG + Intronic
1140000469 16:71020159-71020181 CTCCTGAGGTACCTTAATAGGGG - Exonic
1140965196 16:79959172-79959194 GACCTAAGGGACCAGGATTGGGG - Intergenic
1143865601 17:9920883-9920905 CTCCTATAGTATCATCATTGTGG + Intronic
1153771307 18:8418881-8418903 CTCCAAAGTTACCATCATTAAGG - Intergenic
1155604810 18:27592872-27592894 CTCCTAAGGTTTCAAAATTGTGG + Intergenic
1157869475 18:51216727-51216749 CACCAAAGCTACCAGGATTGTGG + Intronic
1158687486 18:59627953-59627975 CTCCCAAAGTACCCGGATTGTGG - Intronic
1158828714 18:61254163-61254185 TTCCTAGGGTACCATTATTCTGG - Intergenic
1162538280 19:11277103-11277125 CTCCCAAAGTGCCAAGATTGCGG - Intergenic
929979813 2:46667715-46667737 CTCCAAGTGTACCTTGATTGAGG + Intergenic
935501225 2:103842191-103842213 CACCTAAGGTAACATGTCTGGGG - Intergenic
937884541 2:126890819-126890841 ATCATAAGGTACCATCTTTGAGG + Intergenic
939636233 2:144585570-144585592 TTCCTAGGGTACCATAATTTAGG - Intergenic
943005663 2:182386102-182386124 CTCCTGAGGTGCCGGGATTGCGG + Intronic
944342480 2:198619004-198619026 CTCCTGAGTTACAATGATTGGGG + Intergenic
946909354 2:224444344-224444366 CTCCTAAGATTCCATGATTCTGG - Intergenic
948647228 2:239413240-239413262 CTCCTATGGTTGCATAATTGCGG + Intergenic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1180594087 22:16962393-16962415 CTCCTCATGTTCCAGGATTGAGG + Exonic
1181740547 22:24918245-24918267 CTCCTAAAGTACTAGGATTACGG - Intronic
1183716987 22:39539138-39539160 CCCCTAGGCTTCCATGATTGTGG + Intergenic
950791046 3:15472606-15472628 CTCCTAAGCTAACATCATTTTGG - Intronic
954799164 3:53177245-53177267 CTCCTGAAGTACCAAGATTATGG + Intronic
964525988 3:157615792-157615814 CTTCTAAGGGAGCATGAGTGGGG + Intronic
965798736 3:172468763-172468785 AGCCTAAGGTAACATGATTCTGG - Intergenic
968852902 4:3095141-3095163 CTCCCAAAGTGCCAAGATTGCGG - Intronic
969839627 4:9871323-9871345 CTCCTAAGACCCCATGTTTGTGG - Intronic
973588542 4:52416685-52416707 CTACTAAGCTACCATCAGTGGGG + Intergenic
979309172 4:119182379-119182401 TTCCTGAGGTACCATGATCCAGG - Intronic
989304398 5:39935701-39935723 ATTATCAGGTACCATGATTGGGG - Intergenic
989393650 5:40929325-40929347 CTCCTAAGTCTCCATGTTTGGGG + Intronic
991477813 5:67042163-67042185 CTTCTAATGTACCCTGGTTGTGG + Intronic
992880536 5:81105120-81105142 ATCTTAAGATACCCTGATTGTGG + Intronic
994666656 5:102713428-102713450 GTCACAAGCTACCATGATTGTGG - Intergenic
995104019 5:108352928-108352950 CTCCCAAGGTACCATCTTTTTGG - Intronic
997929685 5:138062009-138062031 CTCCCAAAGTACCAGGATTATGG + Intergenic
1006205895 6:32342409-32342431 CTCCTAAAGTGTCATGATTACGG + Intronic
1017812684 6:157995482-157995504 CTCCTAAGGTATTTTGAGTGCGG + Intronic
1024376777 7:48648659-48648681 CTCCTCAAGGACAATGATTGTGG - Intergenic
1027777553 7:82485364-82485386 CTCCTAAGATTCCAAGATGGCGG - Intergenic
1029901547 7:104046255-104046277 GTCCTAAGGTTTCATGCTTGAGG - Intergenic
1032145529 7:129376188-129376210 CTACTAAGGTACCACAATTGGGG + Intronic
1033326737 7:140385709-140385731 TTCCTAAGCTATAATGATTGGGG + Intronic
1035974157 8:4288288-4288310 TTCCTAAGGTACTATTTTTGGGG + Intronic
1037625799 8:20605766-20605788 CTCCCAAGGTTCCATCAATGGGG - Intergenic
1045329837 8:101146210-101146232 CTCCTAAGGTGCTGTGATTATGG + Intergenic
1049400946 8:142426955-142426977 CTGGTGAGGTACCATGCTTGGGG + Intergenic
1052598123 9:30588110-30588132 ATTCTAAGGTACTATGATTATGG - Intergenic
1052948836 9:34191352-34191374 CTCCTAAAGCACCAGGATTGTGG + Intronic
1059662607 9:116416918-116416940 CTGCTAAGTTTCCATGTTTGAGG + Intergenic
1062351874 9:136143436-136143458 CTCCTAGGGTTCCAGGCTTGTGG + Intergenic
1186540770 X:10397718-10397740 ATGCTAAGGTACCAGCATTGTGG + Intergenic
1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG + Intergenic
1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG + Intronic
1192511052 X:71720596-71720618 CTCCTAAGCTACCGGGATTGTGG - Intergenic
1192515645 X:71760957-71760979 CTCCTAAGCTACCGGGATTGTGG + Intergenic
1192516984 X:71766953-71766975 CTCCTAAGGTACCATGATTGTGG - Intronic
1192523631 X:71823486-71823508 CTCTTAAGCTACCGGGATTGTGG - Intergenic
1192528853 X:71869711-71869733 CTCCTAAGCTACCGGGATTGTGG + Intergenic
1193644108 X:84046472-84046494 CTTCTGAAGTACCAGGATTGTGG + Intergenic