ID: 1192510367

View in Genome Browser
Species Human (GRCh38)
Location X:71717581-71717603
Sequence GCTGCTGGGGATCCACGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192510359_1192510367 0 Left 1192510359 X:71717558-71717580 CCTGGTGGGGCCTTTCGCAGAGG 0: 2
1: 0
2: 0
3: 7
4: 132
Right 1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG 0: 2
1: 0
2: 0
3: 7
4: 128
1192510364_1192510367 -10 Left 1192510364 X:71717568-71717590 CCTTTCGCAGAGGGCTGCTGGGG 0: 2
1: 0
2: 2
3: 14
4: 197
Right 1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG 0: 2
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192510367 Original CRISPR GCTGCTGGGGATCCACGCGG AGG Exonic
900222973 1:1519112-1519134 CCTGCTGGGGCTCCGCGGGGTGG + Intronic
900490510 1:2946509-2946531 GCTGCTGCACCTCCACGCGGTGG + Intergenic
900792531 1:4689833-4689855 GCTGCTGGGCATCCGCGAGAGGG - Intronic
902285407 1:15405236-15405258 GCTCCGGGGTATCCTCGCGGTGG + Intergenic
902568792 1:17333284-17333306 GCTCCTGAGGGGCCACGCGGAGG - Intronic
903542674 1:24105764-24105786 GCTGCTGGGGAACCAGGCCTGGG - Intronic
903646778 1:24900865-24900887 GCAGCTGGGGGTCCGCGGGGGGG + Exonic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
909567346 1:77067970-77067992 GCTGCTGGGAATCCAACTGGTGG + Intergenic
917797867 1:178544694-178544716 GGTGCTGGGGATCCAGCCCGTGG - Intronic
918109162 1:181440726-181440748 GCTGCGGTGGATCCAGGCTGGGG + Intronic
920096038 1:203487378-203487400 GGTGCCGGGGAACCAAGCGGCGG - Exonic
920823044 1:209399294-209399316 GCTGCTGGGGACCCACTCTGGGG + Intergenic
921377729 1:214491582-214491604 GCTGCTGTGGATCCAACAGGAGG + Intronic
1064086885 10:12351654-12351676 GCTGCTGAGGCTCCAAGCTGTGG + Intronic
1070823790 10:79379438-79379460 GCTGGTGGGAATCCGCTCGGTGG + Intergenic
1073057941 10:100714038-100714060 GCTGGTGGGGGTACACGCAGGGG + Intergenic
1077234856 11:1476033-1476055 GCGGCAGTGGATCCACACGGGGG + Intronic
1083332402 11:61904994-61905016 GCTGCTGGGGATCGACCTGCTGG - Intronic
1085465376 11:76719839-76719861 GGTGCTGTGGATGCACTCGGCGG - Intergenic
1088457684 11:110050034-110050056 GCTGCCCAGGATCCAGGCGGGGG + Intergenic
1096670876 12:53197649-53197671 GCTGCTGGGGCTCCCCTAGGGGG + Exonic
1098997230 12:77134841-77134863 ACTGCTGGGGAACCACTGGGGGG + Intergenic
1099776955 12:87146099-87146121 CCTGCTGGGTATCCACCCAGAGG - Intergenic
1102150942 12:110688937-110688959 CCTGCTGGGGCTCCACGGCGAGG + Intronic
1108409199 13:50130259-50130281 GCAGCTGGGGAGCCTCGCGGTGG + Intronic
1108738231 13:53307719-53307741 GATGGTGGGGATCCATGCAGAGG + Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1112616994 13:101016246-101016268 GAGGCTGGGGCACCACGCGGAGG + Intergenic
1113680488 13:112240287-112240309 GCTGTGGGCGCTCCACGCGGTGG + Intergenic
1119789863 14:77340523-77340545 GCTGCTGGGCCCCCAGGCGGAGG - Exonic
1120935472 14:89891865-89891887 GCTGCTGCGGAGCTACGTGGCGG + Intronic
1122776714 14:104120105-104120127 GCTGCTGGAGGGCCACGCCGGGG + Intergenic
1129273347 15:74430864-74430886 GCTGCTGGGGAGCCATTCTGGGG - Intronic
1129787502 15:78319505-78319527 GTTGCTGAGGATCCACGAGAGGG + Intergenic
1132575007 16:660212-660234 GGTGCTGGGGAGCCCTGCGGGGG - Intronic
1132831291 16:1929686-1929708 GGTGCTGGGGACCCAGGCCGAGG - Intergenic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1132882103 16:2167052-2167074 GCTGCTGGTGATCCCCTCAGGGG + Intronic
1133067455 16:3219245-3219267 GCTGCTGGGAATGCAGGCGCCGG + Intergenic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1134747467 16:16599346-16599368 GAAGCTGGGGATCCAGGCTGGGG + Intergenic
1136585039 16:31179440-31179462 GCCCCTGGGGAGCCACGGGGCGG - Intergenic
1144676865 17:17167615-17167637 GCTGCAGACGATCCACGAGGAGG + Intronic
1147196696 17:38771215-38771237 GCTGGTGGGCATCCACGACGTGG - Exonic
1148356268 17:46977999-46978021 GATCCTGGGGCTCCACGCGGAGG - Intronic
1151755938 17:76075277-76075299 GGAGATGGGCATCCACGCGGGGG + Intronic
1151927114 17:77206298-77206320 GCTGCTGCGGATCATCGAGGTGG + Exonic
1153429341 18:4999078-4999100 GCTGCTGGGGATGAAGGAGGGGG - Intergenic
1160499852 18:79396214-79396236 GGTGCTTGGCATCCGCGCGGCGG - Exonic
1160828074 19:1089922-1089944 GCTGCCCAGGATCCAGGCGGGGG - Exonic
1162495206 19:11019582-11019604 GCTGCTGGGGATCCCTGCAAGGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162546705 19:11335279-11335301 ATTGCAGGGGATCCACGCGCAGG - Intronic
1163128447 19:15257201-15257223 GCTGCTGGGTACCCAGGCCGCGG + Intronic
1164229873 19:23277766-23277788 GCTCCTGGGGATGCGCTCGGTGG - Intergenic
1165746060 19:38229876-38229898 GCTGCTGGGGATACAGGGAGGGG + Intergenic
1166837857 19:45678118-45678140 CCTGCTGGGTGTCCACGAGGTGG + Exonic
1167006106 19:46777527-46777549 TCTGGTGGGGATCCACTGGGTGG - Intronic
925127746 2:1472639-1472661 ACTTCTGGTGATCCACGCTGTGG - Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
926048779 2:9729886-9729908 GCTGCTGGGGACCCTTGCAGTGG + Intergenic
926772607 2:16391900-16391922 GCTACTGGGTATCCACCCAGAGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
936452113 2:112641559-112641581 GATGCTTGGGATCCAGGTGGGGG - Intergenic
937222937 2:120352554-120352576 GCTGCTGGGGCTCCGCCCTGGGG + Intergenic
938064367 2:128273085-128273107 GCTGCTGGGGAACCACACCAGGG + Intronic
948590549 2:239047120-239047142 GCTGCTGGGGGACCAGGCTGGGG - Intergenic
948795934 2:240402124-240402146 GCTGCTGGGGCTCCACCCTGAGG + Intergenic
948817823 2:240522023-240522045 GCTGGTGGGGAGCCTGGCGGTGG + Intronic
1168892629 20:1304947-1304969 CCAGCTGGGCCTCCACGCGGTGG - Exonic
1176173754 20:63708145-63708167 GCGGCTGGGAAACCGCGCGGAGG + Exonic
1178356035 21:31911468-31911490 GCTGCTGAGGAACAACGAGGAGG + Intronic
1179187149 21:39093841-39093863 GCTGCAGAGGATGCACACGGTGG - Intergenic
1179213969 21:39349980-39350002 AGTGCTGGGGATCCAAGCTGTGG + Intergenic
1179509263 21:41861664-41861686 GCTGCTGGGGATGAGCGGGGTGG - Exonic
1180921045 22:19521823-19521845 GCTGCTGTGGAACCAGCCGGTGG - Intergenic
1182704849 22:32270669-32270691 GCTGCTGGGCATCCACCTGCTGG + Intergenic
1184512704 22:44942718-44942740 GCTGTCGGGGAGCCACGTGGAGG + Intronic
1185220541 22:49627248-49627270 GCAGGGGGGGATCCACCCGGGGG + Intronic
1185220557 22:49627283-49627305 GCAGGGGGGGATCCACCCGGGGG + Intronic
950290454 3:11779858-11779880 TCAGCTGGGGATCCAGGAGGAGG - Intergenic
953974158 3:47370140-47370162 GGTGCTGGGGATCCACCCCAGGG + Intergenic
954295723 3:49673752-49673774 GCCGCGGGAGATCCACGCTGCGG + Intergenic
960479574 3:118171664-118171686 GAGGCTGGGGATCCGCGGGGGGG - Intergenic
962254478 3:133861020-133861042 GCTGCTGGGGATGGAGGGGGAGG - Intronic
966917794 3:184594433-184594455 GATCCTGGGAATCCACGTGGTGG - Intronic
968230789 3:197003448-197003470 GCCGCTGGGGACGAACGCGGCGG + Exonic
968489190 4:881070-881092 GCTGCTGTGGATCCCCAGGGAGG - Intronic
969715932 4:8868156-8868178 GCGGCTGGGGAGACACGCGGCGG - Exonic
970576439 4:17433226-17433248 GCTACTGGGGATCTACCCAGAGG + Intergenic
971310382 4:25521092-25521114 GCTCCTGGGGATGCGCGCGGTGG + Intergenic
973633107 4:52838056-52838078 GCTGCTGGGGAGCAATGGGGAGG - Intergenic
974008787 4:56587817-56587839 ACTGCTGGGTATCCACCCAGAGG - Intronic
985115715 4:186588606-186588628 GCTGCTGGGAATCCAGGGGCGGG + Exonic
985651142 5:1108304-1108326 GCTGCTGGGCATCCAGGCCGGGG - Intronic
985995815 5:3596282-3596304 GGTGCTGGGCATGTACGCGGCGG + Exonic
1001534899 5:172491357-172491379 GCTTCTGGGGTTCCAAGGGGAGG + Intergenic
1001628711 5:173158577-173158599 GTTGCTGGGGAACCAGGAGGCGG + Intronic
1002206914 5:177569261-177569283 GCTGCTGGGGCCCCACGGTGTGG + Intergenic
1005159986 6:22848216-22848238 GCTGCTGGGGCTACATGTGGAGG - Intergenic
1009952386 6:70412972-70412994 GCTGCAGGGGATCTGCGCCGGGG - Intronic
1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG + Intergenic
1017074989 6:150609736-150609758 GCTGTTGGGAATCCATGCAGTGG + Intronic
1022327622 7:29346242-29346264 GCTGCTGAGGACCCAAGCGTGGG + Intronic
1023922430 7:44639860-44639882 GCTGCTGGGAATCCCCGGGAAGG - Intronic
1024306981 7:47937611-47937633 GCAGCAGGGGATCCACTCAGAGG + Intronic
1026905840 7:74062228-74062250 GCTGCTGGGGGTCGGCGCTGAGG - Intronic
1028923422 7:96331233-96331255 GCTGATGGGGCTCCAGGCTGAGG - Intergenic
1029403497 7:100359349-100359371 GCTGCTGGGCCTCCAGGTGGTGG - Exonic
1029791934 7:102852830-102852852 ACTGCTGGGTATCTACCCGGAGG + Intronic
1030076715 7:105743189-105743211 GGTACAGGGGATCCACACGGAGG + Intronic
1035167431 7:157000036-157000058 GCTGCAGGGGACCCTCGGGGAGG - Intronic
1035610743 8:962478-962500 GCTGCTGGGAGTCCATGCTGGGG + Intergenic
1037525432 8:19719850-19719872 GCTGCAGGGGATCTAGGCGAGGG - Intronic
1040108139 8:43551633-43551655 GCTCCTGGGGATGCGCTCGGTGG - Intergenic
1040559968 8:48515047-48515069 CCTGCTGGCGATGCCCGCGGAGG + Intergenic
1045737867 8:105318274-105318296 AGTGCGGGGGATCCAGGCGGTGG - Intronic
1049510612 8:143025000-143025022 GCTGCTGGGCGGCCAGGCGGGGG + Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049693410 8:143972609-143972631 GCTGCTGGGGAGGGTCGCGGTGG - Intronic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1054704494 9:68448778-68448800 GCTGCTGGAGATGCATGCAGGGG + Intronic
1060984663 9:127813235-127813257 GCTGCTGGTGTTCCAGGCAGCGG - Exonic
1061874320 9:133536318-133536340 GGGGCTGGGGACCCAGGCGGGGG - Intronic
1061954419 9:133954126-133954148 GCTGCTGGGGAATCACTCCGTGG + Intronic
1189174867 X:38946101-38946123 ACTACTGGGTATCCACCCGGGGG - Intergenic
1189332086 X:40150653-40150675 GCTGCTGCAGATCCCCCCGGTGG + Intronic
1192496044 X:71617249-71617271 GCTGCTGGGCAACGGCGCGGTGG - Exonic
1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG + Exonic
1192516330 X:71763972-71763994 GCTGCTGGGGATCCACGCGGAGG - Exonic
1193736802 X:85166768-85166790 GCTGCTGGGTATCTACCCAGAGG + Intergenic
1195221027 X:102745742-102745764 GCGGCTGGGGACCCAGGCAGGGG - Intronic
1196994033 X:121361218-121361240 ACTGCTGGGTATCCACCCAGAGG - Intergenic
1197668614 X:129250733-129250755 GCTGCTGGGTATCTACCCAGAGG - Intergenic
1198859870 X:141057525-141057547 GCTCCTGGGGATGCGCTCGGTGG - Intergenic
1198902823 X:141529865-141529887 GCTCCTGGGGATGCGCTCGGTGG + Intergenic