ID: 1192517169

View in Genome Browser
Species Human (GRCh38)
Location X:71767879-71767901
Sequence CCTCCTTAGCTTCAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192517164_1192517169 17 Left 1192517164 X:71767839-71767861 CCTCACCTTTGAACCTTAGTTAC No data
Right 1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG No data
1192517167_1192517169 -5 Left 1192517167 X:71767861-71767883 CCAAATTCTGTCAGATCTCCTCC No data
Right 1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG No data
1192517166_1192517169 4 Left 1192517166 X:71767852-71767874 CCTTAGTTACCAAATTCTGTCAG No data
Right 1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG No data
1192517165_1192517169 12 Left 1192517165 X:71767844-71767866 CCTTTGAACCTTAGTTACCAAAT No data
Right 1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG No data
1192517163_1192517169 18 Left 1192517163 X:71767838-71767860 CCCTCACCTTTGAACCTTAGTTA No data
Right 1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG No data
1192517162_1192517169 26 Left 1192517162 X:71767830-71767852 CCTCTTAGCCCTCACCTTTGAAC No data
Right 1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192517169 Original CRISPR CCTCCTTAGCTTCAGTAGCC AGG Intergenic
No off target data available for this crispr