ID: 1192520449

View in Genome Browser
Species Human (GRCh38)
Location X:71796176-71796198
Sequence GGGCTGGACCGGCACTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520449_1192520465 19 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520465 X:71796218-71796240 GGCCCACCTCATCACCAGGCAGG No data
1192520449_1192520454 -10 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520454 X:71796189-71796211 GGTCCAGCCCCCCACAGTCTCGG No data
1192520449_1192520459 -2 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520449_1192520469 25 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520449_1192520455 -9 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520455 X:71796190-71796212 GTCCAGCCCCCCACAGTCTCGGG No data
1192520449_1192520463 15 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520463 X:71796214-71796236 TCCAGGCCCACCTCATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520449 Original CRISPR GGGCTGGACCGGCACTGGGG TGG (reversed) Intergenic
No off target data available for this crispr