ID: 1192520456

View in Genome Browser
Species Human (GRCh38)
Location X:71796192-71796214
Sequence AGCCCGAGACTGTGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520456_1192520463 -1 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520463 X:71796214-71796236 TCCAGGCCCACCTCATCACCAGG No data
1192520456_1192520469 9 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520456_1192520471 19 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520456_1192520474 30 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520456_1192520465 3 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520465 X:71796218-71796240 GGCCCACCTCATCACCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520456 Original CRISPR AGCCCGAGACTGTGGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr