ID: 1192520459

View in Genome Browser
Species Human (GRCh38)
Location X:71796197-71796219
Sequence CCCCCACAGTCTCGGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520451_1192520459 -6 Left 1192520451 X:71796180-71796202 CCCAGTGCCGGTCCAGCCCCCCA No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520452_1192520459 -7 Left 1192520452 X:71796181-71796203 CCAGTGCCGGTCCAGCCCCCCAC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520445_1192520459 28 Left 1192520445 X:71796146-71796168 CCAGGTCACCCACGCACACTGTC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520447_1192520459 19 Left 1192520447 X:71796155-71796177 CCACGCACACTGTCTTCAGCTCC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520450_1192520459 -5 Left 1192520450 X:71796179-71796201 CCCCAGTGCCGGTCCAGCCCCCC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520449_1192520459 -2 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
1192520446_1192520459 20 Left 1192520446 X:71796154-71796176 CCCACGCACACTGTCTTCAGCTC No data
Right 1192520459 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520459 Original CRISPR CCCCCACAGTCTCGGGCTCC AGG Intergenic