ID: 1192520460

View in Genome Browser
Species Human (GRCh38)
Location X:71796198-71796220
Sequence GCCTGGAGCCCGAGACTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520460_1192520465 -3 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520465 X:71796218-71796240 GGCCCACCTCATCACCAGGCAGG No data
1192520460_1192520471 13 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520460_1192520469 3 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520460_1192520474 24 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520460_1192520463 -7 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520463 X:71796214-71796236 TCCAGGCCCACCTCATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520460 Original CRISPR GCCTGGAGCCCGAGACTGTG GGG (reversed) Intergenic