ID: 1192520461

View in Genome Browser
Species Human (GRCh38)
Location X:71796199-71796221
Sequence GGCCTGGAGCCCGAGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520461_1192520463 -8 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520463 X:71796214-71796236 TCCAGGCCCACCTCATCACCAGG No data
1192520461_1192520471 12 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520461_1192520474 23 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520461_1192520469 2 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520461_1192520465 -4 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520465 X:71796218-71796240 GGCCCACCTCATCACCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520461 Original CRISPR GGCCTGGAGCCCGAGACTGT GGG (reversed) Intergenic
No off target data available for this crispr