ID: 1192520464

View in Genome Browser
Species Human (GRCh38)
Location X:71796215-71796237
Sequence GCCTGGTGATGAGGTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520464_1192520471 -4 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520464_1192520474 7 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520464_1192520478 20 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520464_1192520477 15 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520464 Original CRISPR GCCTGGTGATGAGGTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr