ID: 1192520466

View in Genome Browser
Species Human (GRCh38)
Location X:71796220-71796242
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520466_1192520478 15 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520466_1192520477 10 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520466_1192520474 2 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520466_1192520471 -9 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520466 Original CRISPR GGCCTGCCTGGTGATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr