ID: 1192520467

View in Genome Browser
Species Human (GRCh38)
Location X:71796221-71796243
Sequence GGGCCTGCCTGGTGATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520467_1192520471 -10 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520467_1192520478 14 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520467_1192520477 9 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520467_1192520474 1 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520467 Original CRISPR GGGCCTGCCTGGTGATGAGG TGG (reversed) Intergenic