ID: 1192520468

View in Genome Browser
Species Human (GRCh38)
Location X:71796224-71796246
Sequence CCAGGGCCTGCCTGGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520468_1192520478 11 Left 1192520468 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520468_1192520474 -2 Left 1192520468 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520468_1192520477 6 Left 1192520468 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520468 Original CRISPR CCAGGGCCTGCCTGGTGATG AGG (reversed) Intergenic