ID: 1192520469

View in Genome Browser
Species Human (GRCh38)
Location X:71796224-71796246
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520460_1192520469 3 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520458_1192520469 4 Left 1192520458 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520461_1192520469 2 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520457_1192520469 5 Left 1192520457 X:71796196-71796218 CCCCCCACAGTCTCGGGCTCCAG No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520456_1192520469 9 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520451_1192520469 21 Left 1192520451 X:71796180-71796202 CCCAGTGCCGGTCCAGCCCCCCA No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520462_1192520469 1 Left 1192520462 X:71796200-71796222 CCACAGTCTCGGGCTCCAGGCCC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520450_1192520469 22 Left 1192520450 X:71796179-71796201 CCCCAGTGCCGGTCCAGCCCCCC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520452_1192520469 20 Left 1192520452 X:71796181-71796203 CCAGTGCCGGTCCAGCCCCCCAC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520449_1192520469 25 Left 1192520449 X:71796176-71796198 CCACCCCAGTGCCGGTCCAGCCC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
1192520453_1192520469 14 Left 1192520453 X:71796187-71796209 CCGGTCCAGCCCCCCACAGTCTC No data
Right 1192520469 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520469 Original CRISPR CCTCATCACCAGGCAGGCCC TGG Intergenic