ID: 1192520470

View in Genome Browser
Species Human (GRCh38)
Location X:71796232-71796254
Sequence TGGGAAAACCAGGGCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520470_1192520484 28 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520470_1192520478 3 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520470_1192520474 -10 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520474 X:71796245-71796267 GGTTTTCCCAGGCTCCAGACTGG No data
1192520470_1192520485 29 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520485 X:71796284-71796306 CTCCCTCAGCCCTAGACTCTGGG No data
1192520470_1192520477 -2 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520470 Original CRISPR TGGGAAAACCAGGGCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr