ID: 1192520471

View in Genome Browser
Species Human (GRCh38)
Location X:71796234-71796256
Sequence AGGCAGGCCCTGGTTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520464_1192520471 -4 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520458_1192520471 14 Left 1192520458 X:71796197-71796219 CCCCCACAGTCTCGGGCTCCAGG No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520466_1192520471 -9 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520467_1192520471 -10 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520457_1192520471 15 Left 1192520457 X:71796196-71796218 CCCCCCACAGTCTCGGGCTCCAG No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520461_1192520471 12 Left 1192520461 X:71796199-71796221 CCCACAGTCTCGGGCTCCAGGCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520460_1192520471 13 Left 1192520460 X:71796198-71796220 CCCCACAGTCTCGGGCTCCAGGC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520462_1192520471 11 Left 1192520462 X:71796200-71796222 CCACAGTCTCGGGCTCCAGGCCC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520452_1192520471 30 Left 1192520452 X:71796181-71796203 CCAGTGCCGGTCCAGCCCCCCAC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520456_1192520471 19 Left 1192520456 X:71796192-71796214 CCAGCCCCCCACAGTCTCGGGCT No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data
1192520453_1192520471 24 Left 1192520453 X:71796187-71796209 CCGGTCCAGCCCCCCACAGTCTC No data
Right 1192520471 X:71796234-71796256 AGGCAGGCCCTGGTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520471 Original CRISPR AGGCAGGCCCTGGTTTTCCC AGG Intergenic
No off target data available for this crispr