ID: 1192520472

View in Genome Browser
Species Human (GRCh38)
Location X:71796241-71796263
Sequence TCTGGAGCCTGGGAAAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520472_1192520485 20 Left 1192520472 X:71796241-71796263 CCCTGGTTTTCCCAGGCTCCAGA No data
Right 1192520485 X:71796284-71796306 CTCCCTCAGCCCTAGACTCTGGG No data
1192520472_1192520484 19 Left 1192520472 X:71796241-71796263 CCCTGGTTTTCCCAGGCTCCAGA No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520472_1192520478 -6 Left 1192520472 X:71796241-71796263 CCCTGGTTTTCCCAGGCTCCAGA No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520472 Original CRISPR TCTGGAGCCTGGGAAAACCA GGG (reversed) Intergenic
No off target data available for this crispr