ID: 1192520477

View in Genome Browser
Species Human (GRCh38)
Location X:71796253-71796275
Sequence CAGGCTCCAGACTGGTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520466_1192520477 10 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520464_1192520477 15 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520467_1192520477 9 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520462_1192520477 30 Left 1192520462 X:71796200-71796222 CCACAGTCTCGGGCTCCAGGCCC No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520470_1192520477 -2 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data
1192520468_1192520477 6 Left 1192520468 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
Right 1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520477 Original CRISPR CAGGCTCCAGACTGGTCCCA TGG Intergenic
No off target data available for this crispr