ID: 1192520478

View in Genome Browser
Species Human (GRCh38)
Location X:71796258-71796280
Sequence TCCAGACTGGTCCCATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520466_1192520478 15 Left 1192520466 X:71796220-71796242 CCCACCTCATCACCAGGCAGGCC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520467_1192520478 14 Left 1192520467 X:71796221-71796243 CCACCTCATCACCAGGCAGGCCC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520468_1192520478 11 Left 1192520468 X:71796224-71796246 CCTCATCACCAGGCAGGCCCTGG No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520472_1192520478 -6 Left 1192520472 X:71796241-71796263 CCCTGGTTTTCCCAGGCTCCAGA No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520464_1192520478 20 Left 1192520464 X:71796215-71796237 CCAGGCCCACCTCATCACCAGGC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520470_1192520478 3 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data
1192520473_1192520478 -7 Left 1192520473 X:71796242-71796264 CCTGGTTTTCCCAGGCTCCAGAC No data
Right 1192520478 X:71796258-71796280 TCCAGACTGGTCCCATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520478 Original CRISPR TCCAGACTGGTCCCATGGCC AGG Intergenic
No off target data available for this crispr