ID: 1192520484

View in Genome Browser
Species Human (GRCh38)
Location X:71796283-71796305
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192520479_1192520484 1 Left 1192520479 X:71796259-71796281 CCAGACTGGTCCCATGGCCAGGC No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520470_1192520484 28 Left 1192520470 X:71796232-71796254 CCAGGCAGGCCCTGGTTTTCCCA No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520473_1192520484 18 Left 1192520473 X:71796242-71796264 CCTGGTTTTCCCAGGCTCCAGAC No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520480_1192520484 -9 Left 1192520480 X:71796269-71796291 CCCATGGCCAGGCCGCTCCCTCA No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520475_1192520484 9 Left 1192520475 X:71796251-71796273 CCCAGGCTCCAGACTGGTCCCAT No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520472_1192520484 19 Left 1192520472 X:71796241-71796263 CCCTGGTTTTCCCAGGCTCCAGA No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520481_1192520484 -10 Left 1192520481 X:71796270-71796292 CCATGGCCAGGCCGCTCCCTCAG No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data
1192520476_1192520484 8 Left 1192520476 X:71796252-71796274 CCAGGCTCCAGACTGGTCCCATG No data
Right 1192520484 X:71796283-71796305 GCTCCCTCAGCCCTAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192520484 Original CRISPR GCTCCCTCAGCCCTAGACTC TGG Intergenic
No off target data available for this crispr