ID: 1192521931

View in Genome Browser
Species Human (GRCh38)
Location X:71809823-71809845
Sequence GTTCAGCAGCGCCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192521931_1192521932 -7 Left 1192521931 X:71809823-71809845 CCTACAGTGTGGCGCTGCTGAAC No data
Right 1192521932 X:71809839-71809861 GCTGAACAGCCACTCTGATTTGG 0: 21
1: 71
2: 56
3: 63
4: 141
1192521931_1192521934 5 Left 1192521931 X:71809823-71809845 CCTACAGTGTGGCGCTGCTGAAC No data
Right 1192521934 X:71809851-71809873 CTCTGATTTGGCATCTCCTTTGG 0: 25
1: 40
2: 53
3: 80
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192521931 Original CRISPR GTTCAGCAGCGCCACACTGT AGG (reversed) Intergenic
No off target data available for this crispr