ID: 1192524301

View in Genome Browser
Species Human (GRCh38)
Location X:71828348-71828370
Sequence GGCCTGCCTGGTGATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192524297_1192524301 -9 Left 1192524297 X:71828334-71828356 CCTGGGACAATCAGGGCCTGCCT No data
Right 1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG No data
1192524294_1192524301 2 Left 1192524294 X:71828323-71828345 CCAGTCTGGAGCCTGGGACAATC No data
Right 1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG No data
1192524291_1192524301 10 Left 1192524291 X:71828315-71828337 CCATGGGGCCAGTCTGGAGCCTG No data
Right 1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG No data
1192524290_1192524301 15 Left 1192524290 X:71828310-71828332 CCTGGCCATGGGGCCAGTCTGGA No data
Right 1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192524301 Original CRISPR GGCCTGCCTGGTGATGAGGT GGG Intergenic
No off target data available for this crispr